|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 January 2008
doi: 10.1242/dev.014779
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20982, USA.
* Author for correspondence (e-mail: jk14p{at}nih.gov)
Accepted 2 December 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Polycomb group genes, Polycomb-group response elements (PREs), Gene silencing, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
In Drosophila, PcG proteins work through DNA elements called PcG
response elements (PREs). Endogenous PREs extend over several kilobases and
can be divided into subfragments with similar activities
(Kassis, 1994
;
Horard et al., 2000
). Minimal
PRE fragments have been identified using two types of assays in transgenic
Drosophila. In mini-white silencing, the PRE represses the
expression of the linked marker gene mini-white in transgenic
Drosophila. As the degree of repression is often enhanced in
homozygotes, this effect has been called `pairing-sensitive silencing' and the
fragments that mediate it `pairing-sensitive elements' or PSEs. The second
assay, which more accurately reflects the true biological function, tests the
ability of the PRE to maintain correct patterned expression of a reporter
construct (for a review, see Kassis,
2002
). Several protein-binding sites are known to be important for
PRE function (reviewed by Müller and
Kassis, 2006
; Ringrose and
Paro, 2007
), and computer programs exist to predict PREs based on
clustering of some of these sites
(Ringrose et al., 2003
;
Fiedler and Rehmsmeier, 2006
),
but it is still not possible to predict accurately what constitutes a PRE
(reviewed by Ringrose and Paro,
2007
).
Trithorax-group proteins act through trxG response elements or TREs. TREs
are not as well defined and, at least for the bithorax complex and the
hedgehog gene, seem to overlap with or closely adjoin PREs
(Cavalli and Paro, 1998
;
Tillib et al., 1999
;
Maurange and Paro, 2002
). It
is not yet known how the same DNA fragment can act as both a PRE and a TRE
especially in light of recent experiments that show that the bxd PRE
is bound by PcG proteins in both the on and off transcriptional state
(Papp and Müller, 2006
).
Several studies provide evidence that transcription through a PRE inactivates
it (Hogga and Karch, 2002
;
Rank et al., 2002
;
Bender and Fitzgerald, 2002
),
and some suggest that transcription through a PRE converts it into a TRE
(Schmitt et al., 2005
).
Although this is an attractive model, another recent study suggests that
transcription through the bxd PRE actually contributes to
transcriptional silencing (Petruk et al.,
2006
). Thus, the exact relationship between TREs and PREs is not
yet understood.
We have been studying a PRE from the Drosophila engrailed
(en) gene. en encodes a homeodomain-containing protein
important for segmentation in the embryo and formation of posterior
compartments in adults. en is regulated by PcG- and Trx-group genes
in both embryos and larvae (Moazed and
O'Farrell, 1992
; McKeon et
al., 1994
; Breen et al.,
1995
). We have been studying a multipartite PRE near the
en transcription start site (from -2.4 kb to -395 bp) that is bound
by PcG proteins in tissue culture cells, embryos and adults
(Strutt and Paro, 1997
;
Négre et al., 2006
;
Schwartz et al., 2006
;
Comet et al., 2006
). We
previously studied its mini-white silencing activity and ability to
act as a PRE in an Ubx-bxd-reporter construct
(Kassis et al., 1991
;
Kassis, 1994
;
Americo et al., 2002
). Here, we
examine the role of this DNA at the en gene itself. We find that, in
addition to its role as a PRE in maintaining en-like expression from
a reporter gene in embryos, this DNA is able to play an activating role in
transgenes. This activation function occurs relatively late in development,
beginning at about 6 hours, when the maintenance phase normally begins. Two
adjoining subfragments of this multipartite PRE are both able to mediate
positive and negative regulatory effects with many different tissue-specific
enhancers. We also generated a 530 bp deletion of DNA from the endogenous
en gene. This deletion generates a weak loss-of-function en
phenotype, suggesting that this DNA plays a redundant role as a PRE, but is
required for en activation. Our data are consistent with a model
whereby en PREs facilitate interactions between distantly located
regulatory elements to maintain either transcriptional activation or
silencing.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PSE2], the 8 kb SphI fragment was cut with ClaI, generating
a 7.5 kb SphI-ClaI fragment. A PCR fragment containing the
181 bp deletion was created using the primers GTCTGGCAAATCGATATTCGA (which
contained the upstream natural ClaI site), and
GCGGCATGCTTTCCACAGACACTTTCA, which added a synthetic SphI site at
-576 bp upstream of the en transcription start site. The 7.5 kb
SphI-ClaI fragment, ClaI-SphI cut PCR
fragment and SphI cut construct H were ligated. The resulting clone
was sequenced to confirm the 181 bp deletion. For P[
both], the 8 kb
SphI fragment was cut with XbaI and a 5 kb fragment was
isolated. The 2 kb deletion present in P[
both] was generated by PCR
using the primers CTCTATCTAGATAACTATTCTGTATCC, which contains the natural
XbaI site, and GCGGCATGCGAATTCAAATGATGAGAATATAAGATAAGC, which added a
synthetic SphI site before the EcoRI site present at -2.407
kb. The 5 kb SphI-XbaI fragment, XbaI-SphI
cut PCR fragment and SphI cut construct H were ligated. The resulting
clone was sequenced around the XbaI junction and in the area of the
deletion. P[
both] contains two SphI sites, one at -395 and one
at -8 kb. A 10 kb BamHI, SacII subfragment of P[
both]
that contained only the SphI site present at -395 was cloned into an
intermediary vector where it would be the only SphI site (clone
SRK1). For P[en2], PCR fragments were generated to flank PSE1 by LoxP sites
and PSE2 by FRT sites. The PSE1 LoxP primer had a 5' SphI site,
and the 3' primer had an Asp718 site. For PSE2, the 5'
primer had an Asp718 site, and the 3' primer had a
SphI site. The primers used were: 5' Lox P,
GCGGCATGCATAACTTCGTATAATGTATGCTATACGAAGTTATAATTCCGTTGATATGATCGC; 3' Lox
P, GCGGGTACCATAACTTCGTATAGCATACATTATACGAAGTTATTTTCCACAGACACTTTTCAT; 5'
FRT,GCGGGTACCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGAGATGGCATGTGGCTCT; and
3' FRT, GCGGCATGCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCCATGCTGGAGCTGTCAGCC.
SphI-Asp718 cut PCR fragments were cloned into
SphI-cut SRK1. The resulting clone was cut with
Bam-SacII to yield a 12 kb band and put back into
BamHI-SacII P[
both] vector. P[en2] was completely
sequenced in the region of the PCR fragments. P[en3] was generated by cutting
Construct H with SphI and cloning in the SphI fragment from
P[en2] that contained PSE1 and PSE2 flanked by Lox P and FRT sites.
Transgenic lines
P[en1], P[
PSE2] and P[
both] were generated by injections into
homozygous Df(1)w67c2, y embryos in our laboratory using standard
procedures. Some P[en1], P[
PSE2] and P[
both] lines were also
obtained by transposon mobilization using a P[
2,3],
99B line (Robertson et al.,
1988
). P[en2] and P[en3] were obtained from injections into
w1118 by Genetic Services (Sudbury, MA). The chromosomal
insertion sites of transgenes were localized by inverse PCR. The presence of a
single transgene insertion site was confirmed for P[en3]-tou, P[en3]-en and
P[en3]-9C by Southern blotting (data not shown). Derivatives of P[en2] and
P[en3] were generated by treating with hsFLP and hsCre recombinase separately,
then sequentially for
both lines. The presence of the deletions was
verified by PCR.
Generations of deletions in the en gene in situ
We used an insertion of P[en1-ry] at -412 in the en gene
(Kassis et al., 1992
) as the
recipient and an insertion of P[
PSE2] into tou
(P[
PSE2]-tou) as the donor to try to generate a gene conversion event
to precisely delete PSE2. Males of the genotype
P[en1-ry+]-en/Sp P[
PSE2]-tou;
ry506/ry506 P[ry+
2-3]99B
were crossed to Sco/CyO; ry506/ry506
virgins. Sp+; ry- that were either
CyO or Sco (ry- derivatives of the
P[en1-ry+]-en chromosome) were crossed to
Sco/CyO; ry506/ry506 virgins or males.
Flies of the genotype P[en1-ry-]-en/CyO were analyzed by
PCR for the presence of the P-ends and for the deletion of PSE2. These flies
were also crossed to Df(2R)enX31 to check whether they complemented
this en/inv deficiency chromosome. Three-hundred and three
ry- flies were screened. No gene conversion events were
recovered, but we did obtain four deletions of DNA flanking the P-element, two
with small deletions in the direction of the en promoter, one large
deletion and the one described here.
| RESULTS |
|---|
|
|
|---|
As PSE1 and PSE2 do not contain any en enhancers, we examined
their activity in the context of a larger en reporter construct.
Eight kilobases of upstream en sequences are sufficient to drive a
reporter gene in en-like stripes in embryos but not imaginal discs
(Hama et al., 1990
) (S.K.D.,
D.K., J.L.B. and J.A.K., unpublished). P[en1] contains 8 kb of upstream
en sequences, the en promoter, and 188 bases of the
untranslated leader (from -8 kb to +188 bp) fused to Adh-lacZ
(Fig. 1B). We obtained six
lines for this construct, and, as expected, all expressed lacZ in
en-like stripes throughout embryonic development (an example is shown
in Fig. 1C). In order to assess
whether P[en1] contains PRE activity, we crossed it into a
polyhomeotic (ph) mutant background. Both En and β-gal
are expressed throughout the embryo in a ph mutant, instead of in
stripes as seen in the wild-type embryo
(Fig. 1C). This suggests that
this reporter construct contains a PRE for en expression.
|
|
PSE2],
Fig. 1B), and another that
deleted both PSEs (P[
both], Fig.
1B). We examined expression from multiple lines from each
construct. If β-gal is being accurately expressed, β-gal protein is
only detected in the regions of en stripes in embryos
(Fig. 1C). Detection of
β-gal in cells between the stripes indicates that expression is not
accurate (misexpression, ME, Fig.
1B). Misexpression began at about 7 hours of development, when PcG
repression normally occurs. In two out of six P[en1] chromosomal insertion
sites, a few cells between each stripe expressed β-gal at similar levels
to those seen in Fig. 2G. When
PSE2 was deleted in P[
PSE2], five of seven lines had a small amount of
misexpression. By contrast, all 11 lines generated from P[
both] gave a
large amount of misexpression, similar to what is shown in
Fig. 2I and to what is seen
when β-gal is expressed from P[en1] in a ph mutant background.
These data showed that the fragment extending from -2.4 to -395 has PRE
activity, but did not allow us to determine accurately the role of PSE2 in PcG
repression.
In order to further delineate the role of PSE1 and PSE2 as en PRE
elements, we looked at the effect of deleting PSE1 and PSE2 from the same
insertion site. We made a construct (P[en2],
Fig. 2A) that contains the same
8 kb of upstream sequences, but where PSE2 is flanked by FRT sites and PSE1 is
flanked by loxP sites, allowing us to remove either one or both fragments at a
single genomic location. We obtained four lines with this construct. For two
lines, β-gal was accurately expressed in stripes throughout development
(Fig. 2B,F). One of these two
lines was unusual in that it was inserted in E(Pc), the gene next to
invected (inv) and this will be discussed below. The third
P[en2] line had weak misexpression similar to that seen in
Fig. 2G, and the fourth line
had strong misexpression, similar to that seen in
Fig. 2H. We examined the effect
of loss of PSE1, PSE2 and both at all chromosomal locations. Loss of either
PSE1 or PSE2 increased misexpression (in all but P[en2]-E(Pc), see below),
with the most misexpression seen in P[en2]
both at three out of four
insertion sites (misexpression in the fourth line was already massive in the
PSE1 and
PSE2 derivatives). In
Fig. 2 we show an example of
one line, from an insertion on the X chromosome, where β-gal was
accurately expressed in the starting P[en2] line. Removal of PSE2 led to weak
misexpression between the stripes (Fig.
2G). Removal of PSE1 led to considerably more lacZ
misexpression (Fig. 2H), with
the most misexpression seen when both PSE1 and 2 were removed
(Fig. 2I). β-Gal
expression was correctly initiated from all lines
(Fig. 2B-E) and misexpression
did not begin until about 7 hours of development, consistent with the role of
these fragments as PREs. These data show that PSE2 can act as a PRE with
en enhancers. The repressive role of PSE2 is best seen by comparing
the amount of misexpression seen in P[en2]
PSE1
(Fig. 2H), which contains PSE2,
with the much more extensive misexpression seen in P[en2]
both
(Fig. 2I). However, these data
also show that deletion of PSE2 alone led to very little misexpression,
showing that PSE1 can largely substitute for the role of PSE2 in the intact
reporter construct.
|
70 kb away from the endogenous en PRE,
and 20 kb upstream of the inv transcription start site. The
inv gene is expressed in the same pattern as en, shares
sequence homology in the homeodomain region of the protein, and is
functionally redundant with en
(Gustavson et al., 1996
Taken together, these data indicate that PSE1 and 2 act together to repress
en transcription between the stripes in embryos. As PcG proteins are
known to bind to these fragments and the misexpression seen when deleting
these fragments occurs at a time when PcG proteins act to repress en
between the stripes (Moazed and O'Farrell,
1992
), these fragments act as bona fide PREs for en
expression.
PSE1 and PSE2 can also act as positive elements
Construct P[en3] acts as an enhancer trap; that is, it contains no
information for patterning on its own and expression of lacZ is
governed by enhancers and silencers flanking its genomic insertion site
(Fig. 4A)
(Kassis, 1990
). Because the
fragment of en DNA in P[en3] causes P-elements to home to the
en locus (Kassis et al.,
1992
), we recovered two lines with P[en3] inserted into the
chromosomal region of en, one 6 kb upstream of the endogenous
en transcription start site (line P[en3]-en) and one 66 kb upstream,
in the tou transcription unit (line P[en3]-tou;
Fig. 4). As expected,
β-gal is expressed in exactly the same way as endogenous en from
P[en3]-en (Fig. 4C). Enhancer
traps in tou are usually not expressed like en, but
expression from P[en3]-tou showed many aspects of en expression
(Fig. 4D). Although there was
no β-gal detected early, lacZ was expressed in en-like
stripes beginning at about 6 hours of development, around the time when
en would begin to be regulated by the PcG and trxG genes.
Interestingly, when the stripes are turned on in P[en3]-tou, it is done so in
a stochastic way: initially single β-gal-expressing cells were observed,
but by about 6.5 hours of development, every cell in a stripe is expressing
β-gal (Fig. 4D).
β-Gal is also detected in the posterior compartment of the P[en3]-tou
imaginal discs, although at a lower level than in line P[en3]-en.
What happens when PSE1 or PSE2 are deleted from P[en3]-en and P[en3]-tou?
Deletion of both PSE1 and PSE2 from P[en3]-en did not change the expression of
lacZ (Fig. 5). Thus,
these elements are not important for expression of lacZ when P[en3]
is inserted at -6 kb, just 4 kb upstream of the endogenous PSE1 and PSE2
fragments. By contrast, lacZ expression from P[en3]-tou was somewhat
altered by the deletion of PSE2, and dramatically by the loss of PSE1
(Fig. 5). In embryos, deletion
of PSE1, and to a lesser extent, PSE2 lead to a loss in the intensity of the
stripes, especially in the head and thoracic segments. Loss of both PSE1 and
PSE2 led to both a decrease in the intensity of the stripes and a rise in the
background staining, suggesting both a loss of activation and repression.
Deletion of PSE1 and PSE2 from P[en3]-tou also had effects in larval tissues.
A wing disc is shown in Fig. 5,
and similar effects were seen in all other discs (data not shown). Expression
of β-gal in larval tissues was entirely dependent on the presence of PSE1
or PSE2. Loss of PSE1 had the most dramatic effect. P[en3]
PSE1-tou wing
discs had very little β-gal activity but this small amount of activity is
due to the activating effects of PSE2, as there is no activity in
P[en3]
both-tou discs. The activating effects of PSE1 and PSE2 in larvae
are also seen when examining expression from P[en2] inserted in E(Pc)
(Fig. 3C). Although the
β-gal expression pattern in wing discs from P[en2]-E(Pc) is remarkably
similar to en, deletion of both PSE1 and PSE2 from this line
drastically lowered the expression level. Thus, although PSE1 and PSE2 are not
required for striped embryonic expression from P[en2]-E(Pc)
(Fig. 3B, because P[en2] has 8
kb of upstream DNA and carries the embryonic enhancers), they are necessary to
activate lacZ expression in larvae, where activity is coming from
endogenous en/inv enhancers. These data clearly show that both PSE1
and PSE2 are able to mediate activation by en enhancers that are
located many kilobases away from the insertion sites of P[en3]-tou and
P[en2]-E(Pc).
|
|
both] from most of the lines
we recovered (15 lines). In seven of the 15 lines, we saw differences in
β-gal expression patterns when the PSEs were deleted. The PSEs were
important for activation or repression, dependent on the tissue. An example is
shown in Fig. 6. In the
proventriculus and in wing disks from line P[en3]-9C, PSE1 and PSE2 act as
silencing elements. There is very little β-gal expressed in a
proventriculus or wing disc from P[en3]-9C larvae, some in
P[en3]
PSE1-9C and expression everywhere in P[en3]
both-9C larvae.
By contrast, PSE1 and PSE2 act as activators of expression in the larval
brain. There is very little expression of lacZ in the
P[en3]
both-9C larval brain, and this expression is increased in both
P[en3]
PSE1 and P[en3]-9C larvae. Expression in the P[en3]-9C brain is
variegated, suggesting a competition between activation and repression. These
data suggest that PSE1 and PSE2 can act to either activate or repress
transcription in a tissue-specific way and that they can mediate responses
with enhancers and silencers at many genomic positions.
|
|
Deletion of PSE2 from the endogenous en gene causes a loss of function phenotype
We generated a deletion of 530 bp of en DNA, removing sequences
from -942 to -412, including almost all of PSE2 and 366 bp of additional
upstream sequences (Fig. 1A)
from an imprecise excision of a P-element inserted at -412 (see Materials and
methods). We called this mutation
en
530. Our data suggest that
the sequences deleted in en
530
are important for en activation.
en
530 behaves genetically like
a recessive double-mutant loss-of-function allele in en and
inv, causing a defect in the posterior compartment of the wing
(Fig. 7;
Table 1). That is, although
there is no phenotype when
en
530 is put over a wild-type
chromosome, crosses to either inv or en alleles gave flies
with the same wing phenotype. This suggests that this small deletion may alter
the expression pattern of both Inv and En. This is perhaps not that surprising
as En and Inv have been previously reported to share regulatory DNA
(Gustavson et al., 1996
;
Goldsborough and Kornberg,
1994
). It is possible that this small deletion alters the
chromatin structure of the en/inv region, causing a small decrease in
the level of expression.
|
530 or when
en
530 was combined with an
en/inv double mutant or a deficiency for the region. This suggests
that either En or Inv can partially compensate for the loss of both in
en
530. This is consistent with
data that suggests En and Inv have redundant activities
(Gustavson et al., 1996
Because en
530 completely
deletes PSE2, we examined embryos to see whether En or Inv antigen could be
detected in cells between the stripes in
en
530 homozygous embryos. We
did not observe any misexpression of En or Inv in
en
530 homozygous embryos. Thus,
it appears that the repressive activity of PSE2 can be replaced by other PREs
located throughout the en locus.
The phenotype of the en PRE deletion can be contrasted with
phenotypes observed by deleting the iab-7 PRE (also called the
Fab7-PRE) and the bxd PRE from the endogenous AbdB gene and
Ubx genes, respectively. As stated above, previous studies on the
iab7- and bxd-PREs have shown that, in transgenes, these
sequences can mediate both repression and persistent activation of a linked
mini-white marker (Cavalli and
Paro, 1998
; Rank et al.,
2002
). The activation is thought to be mediated by the Trithorax
group genes. This led to the idea that these PREs would be necessary for both
activation and repression of AbdB and Ubx. However, deletion
of the iab-7 PRE from within the AbdB gene and the
bxd PRE from the Ubx gene in situ led to phenotypes that
were consistent with a role only in repression
(Mihaly et al., 1997
;
Sipos et al., 2007
). Thus, for
both the iab-7 PRE and the bxd PRE, no activating role could
be seen in vivo. It cannot be ruled out that there are other TREs within the
endogenous Ubx and AbdB gene that play redundant roles to
those of the deleted fragments. These result also do not rule out the
hypothesis that one role of the Trithorax group genes is to counteract the
activity of the Polycomb group genes.
Are the en PREs also TREs?
We tested whether the en PREs could act as TREs in the vector pUZ
in transgenic Drosophila. This vector has been used to show that
fragments of DNA that include the bxd, Mcp, Fab7 and
hedgehog PREs could act as both PREs and TREs for the expression of
the linked marker gene mini-white
(Rank et al., 2002
;
Maurange and Paro, 2002
). We
tested three versions of the en PRE in pUZ (the entire 2 kb fragment,
PSE2 and the 530 bp fragment deleted in
en
530) for their ability to
mediate silencing and activation of mini-white in pUZ (data not
shown). Although all three fragments mediated silencing of mini-white
in this vector, none was able to activate mini-white expression (data
not shown). Thus, we found no evidence that the en PRE could behave
as a TRE in this assay.
As the β-gal expression level from P[en3]-tou is relatively weak, we reasoned that we might be able to observe an effect of heterozygous mutations in trxG genes on its expression level. We checked the effect of heterozygous mutations in the trxG group genes brahma, trithorax and ash-1 on β-gal expression from P[en3]-tou in discs and did not observe any effect (data not shown). Thus, we do not have any evidence that the positive regulatory effects of these fragments are due to trxG genes.
| DISCUSSION |
|---|
|
|
|---|
The en PRE we are studying is able to activate or repress transcription from a distance, dependent on the context. Unlike the PREs in the bithorax complex, which are located tens of kilobases away from their promoters, the en PRE is located right next to the en promoter. We suggest that one of its activities is to bring together the promoter with en enhancers or silencers, irrespective of the transcription state. The regulatory DNA of the en gene is spread over 70 kb and is intimately linked with inv. We suggest that en PREs are crucial for establishing the correct chromatin structure of this complex locus.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/4/669/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Americo, J., Whiteley, M., Brown, J. L., Fujioka, M., Jaynes, J.
B. and Kassis, J. A. (2002). A complex array of DNA binding
proteins required for pairing-sensitive silencing by a Polycomb-group response
element from the Drosophila engrailed gene.
Genetics 160,1561
-1571.
Bantignies, F., Grimaud, C., Lavrov, S., Gabut, M. and Cavalli,
G. (2003). Inheritance of Polycomb-dependent chromosomal
interactions in Drosophila. Genes Dev.
17,2406
-2420.
Bender, W. and Fitzgerald, D. P. (2002).
Transcription activates repressed domains in the Drosophila bithorax complex.
Development 129,4923
-4930.
Breen, T. R., Chinwalla, V. and Harte, P.
(1995). Trithorax is required to maintain engrailed
expression in a subset of engrailed-expressing cells.
Mech. Dev. 52,89
-98.[CrossRef][Medline]
Brown, J. L., Grau, D. J., DeVido, S. K. and Kassis, J. A.
(2005). An Sp1/KLF binding site is important for the activity of
a Polycomb group response element from the Drosophila engrailed gene.
Nucleic Acids Res. 33,5181
-5189.
Cavalli, G. and Paro, R. (1998). The Drosophila
Fab-7 chromosomal element conveys epigenetic inheritance during mitosis and
meiosis. Cell 93,505
-518.[CrossRef][Medline]
Comet, I., Savitskaya, E., Schuettengruber, B., Nègre,
N., Lavrov, S., Parshikov, A., Juge, F., Gracheva, E., Georgiev, P. and
Cavalli, G. (2006). PRE-mediated bypass of two Su(Hw)
insulators targets PcG proteins to a downstream promoter. Dev.
Cell 11,117
-124.[CrossRef][Medline]
Déjardin, J., Rappailes, A., Cuvier, O., Grimaud, C.,
Decoville, M., Locker, D. and Cavalli, G. (2005). Recruitment
of Drosophila Polycomb group proteins to chromatin by DSP1.
Nature 434,533
-538.[CrossRef][Medline]
Fiedler, T. and Rehmsmeier, M. (2006).
jPREdictor: a versatile tool for the prediction of cis-regulatory elements.
Nucleic Acids Res. 34,W546
-W550.
Goldsborough, A. S. and Kornberg, T. B. (1994).
Allele-specific quantification of Drosophila engrailed and invected
transcripts. Proc. Natl. Acad. Sci. USA
91,12696
-12700.
Gustavson, E., Goldsborough, A. S., Ali, Z. and Kornberg, T.
B. (1996). The Drosophila engrailed and
invected genes: partners in regulation, expression and function.
Genetics 142,893
-906.[Abstract]
Hama, C., Ali, Z. and Kornberg, T. B. (1990).
Region-specific recombination and expression are directed by portions of the
Drosophila engrailed promoter. Genes Dev.
4,1079
-1093.
Hogga, I. and Karch, F. (2002). Transcription
through the iab-7 cis-regulatory domain of the bithorax complex interferes
with maintenance of Polycomb-mediated silencing.
Development 129,4915
-4922.
Horard, B., Tatout, C., Poux, S. and Pirrotta, V.
(2000). Structure of a Polycomb response element and in
vitro binding of Polycomb group complexes containing GAGA Factor.
Mol. Cell. Biol. 20,3187
-3197.
Kassis, J. A. (1990). Spatial and temporal
control elements of the Drosophila engrailed gene. Genes
Dev. 4,433
-443.
Kassis, J. A. (1994). Unusual properties of
regulatory DNA from the Drosophila engrailed gene: three
"pairing-sensitive" sites within a 1.6 kb region.
Genetics 136,1025
-1038.[Abstract]
Kassis, J. A. (2002). Pairing-sensitive
silencing, Polycomb group response elements, and transposon homing in
Drosophila. Adv. Genet.
46,421
-438.[Medline]
Kassis, J. A., VanSickle, P. E. and Sensabaugh, S. M.
(1991). A fragment of engrailed regulatory DNA can
mediate transvection of the white gene in Drosophila.
Genetics 128,751
-761.[Abstract]
Kassis, J. A., Noll, E., VanSickle, E. P., Odenwald, W. and
Perrimon, N. (1992). Altering the insertional specificity of
a Drosophila transposable element. Proc. Natl. Acad. Sci.
USA 89,919
-1923.
Klymenko, T. and Müller, J. (2004). The
histone methyltransferases Trithorax and Ash1 prevent transcriptional
silencing by Polycomb group proteins. EMBO Rep.
5, 373-377.[CrossRef][Medline]
Klymenko, T., Papp, B., Fischle, W., Köcher, T., Schelder,
M., Fritsch, C., Wild, B., Wilm, M. and Müller, J.
(2006). A Polycomb group protein complex with sequence-specific
DNA-binding and selective methyl-lysine-binding activities. Genes
Dev. 20,1110
-1122.
Kuner, J. M., Nakanishi, M., Ali, Z., Drees, B., Gustavson, E.,
Theis, J., Kauvar, L., Kornberg, T. and O'Farrell, P. H.
(1985). Molecular Cloning of engrailed: A gene involved
in the development of pattern in Drosophila melanogaster.
Cell 42,309
-316.[CrossRef][Medline]
Lanzuolo, C., Roure, V., Dekker, J., Bantignies, F. and Orlando,
V. (2007). Polycomb response elements mediate the formation
of chromsome higher-order structures in the bithorax complex. Nat.
Cell Biol. 9,1167
-1174.[CrossRef][Medline]
Lavigne, M., Francis, N. J., King, I. F. G. and Kingston, R.
E. (2004). Propagation of silencing: recruitment and
repression of naïve chromatin in trans by Polycomb repressed chromatin.
Mol. Cell 13,415
-425.[CrossRef][Medline]
Lin, Q., Chen, Q., Lin, L. and Zhou, J. (2004).
The promoter targeting sequence mediates epigenetically heritable
transcription memory. Genes Dev.
18,2639
-2651.
Maurange, C. and Paro, R. (2002). A cellular
memory module conveys epigenetic inheritance of hedgehog expression
during Drosophila wing imaginal disc development. Genes
Dev. 16,2672
-2683.
McKeon, J., Slade, E., Sinclair, D. A. R., Cheng, N. S.,
Couling, M. and Brock, H. W. (1994). Mutations in some
Polycomb group genes of Drosophila interfere with regulation of segmentation
genes. Mol. Gen. Genet.
244,474
-483.[CrossRef][Medline]
Mihaly, J., Hogga, I., Gausz, J., Gyurkovics, H. and Karch,
F. (1997). In situ dissection of the Fab-7 region of the
bithorax complex into a chromatin domain boundary and a Polycomb-response
element. Development
124,1809
-1829.[Abstract]
Moazed, D. and O'Farrell, P. H. (1992).
Maintenance of the engrailed expression pattern by Polycomb group
genes in Drosophila. Development
116,805
-810.[Abstract]
Müller, J. and Kassis, J. A. (2006).
Polycomb response elements and targeting of Polycomb group proteins in
Drosophila. Curr. Opin. Genet. Dev.
16,476
-484.[CrossRef][Medline]
Négre, N., Hennetin, J., Sun, L. V., Lavrov, S., Bellis,
M., White, K. P. and Cavalli, G. (2006). Chromosomal
distribution of PcG proteins during Drosophila development. PLoS
Biol. 4,e170
.[CrossRef][Medline]
Papp, B. and Müller, J. (2006). Histone
trimethylation and the maintenance of transcriptional ON and OFF states by
trxG and PcG proteins. Genes Dev.
20,2014
-2054.
Petruk, S., Sedkov, Y., Riley, K. M., Hodgson, J., Schweisguth,
F., Hirose, S., Jaynes, J. B., Brock, H. W. and Mazo, A.
(2006). Transcription of bxd noncoding RNAs promoted by trithorax
repressed Ubx in cis by transcriptional interference.
Cell 127,1209
-1211.[CrossRef][Medline]
Poux, S., Horard, B., Sigrist, C. J. A. and Pirrotta, V.
(2002). The Drosophila Trithorax protein is a coactivator
required to prevent reestablishment of Polycomb silencing.
Development 129,2483
-2493.[Medline]
Rank, G., Prestel, M. and Paro, R. (2002).
Transcription through intergenic chromosomal memory elements of the Drosophila
bithorax complex correlates with an epigenetic switch. Mol. Cell.
Biol. 22,8026
-8034.
Ringrose, L. and Paro, R. (2004). Epigenetic
regulation of cellular memory by the polycomb and trithorax group proteins.
Annu. Rev. Genet. 38,413
-443.[CrossRef][Medline]
Ringrose, L. and Paro, R. (2007).
Polycomb/Trithorax response elements and epigenetic memory of cell identity.
Development 134,223
-232.
Ringrose, L., Rehmsmeier, M., Dura, J. M. and Paro, R.
(2003). Genome-wide prediction of Polycomb/Trithorax response
elements in Drosophila melanogaster. Dev. Cell
5, 759-771.[CrossRef][Medline]
Robertson, H. M., Preston, C. R., Phillis, R. W.,
Johnson-Schlitz, D. M., Betz, W. K. and Engels, W. R. (1988).
A stable genomic source of P element transposase in Drosophila
melanogaster. Genetics
118,461
-470.
Schmitt, S., Prestel, M. and Paro, R. (2005).
Intergenic transcription through a Polycomb group response element counteracts
silencing. Genes Dev.
19,697
-708.
Schwartz, Y. B., Kahn, T. G., Nix, D. A., Li, X.-Y., Bourgon,
R., Biggin, M. and Pirrotta, V. (2006). Genome-wide analysis
of Polycomb targets in Drosophila melanogaster. Nat.
Genet. 38,700
-705.[CrossRef][Medline]
Sipos, L., Kozma, G., Molnár, E. and Bender, W.
(2007). In situ dissection of a Polycomb response element in
Drosophila melanogaster. Proc. Natl. Acad. Sci.
USA 104,12416
-12421.
Sparmann, A. and van Lohuizen, M. (2006).
Polycomb silencers control cell fate, development and cancer. Nat.
Rev. Cancer 6,846
-856.[CrossRef][Medline]
Strutt, H. and Paro, R. (1997). The Polycomb
group protein complex of Drosophila melanogaster has different
compositions at different target genes. Mol. Cell.
Biol. 17,6773
-6783.[Abstract]
Tillib, S., Petruk, S., Sedkov, Y., Kuzin, A, Fujioka, M., Goto,
T. and Mazo, A. (1999). Trithorax- and Polycomb-group
response elements within an Ultrabithorax maintenance unit consist of closely
situated but separable sequences. Mol. Cell. Biol.
19,5189
-5202.
Zhou, J. and Levine, M. (1999). A novel
cis-regulatory element, the PTS, mediates an anti-insulator activity
in the Drosophila embryo. Cell
99,567
-575.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. Kwon, D. Mucci, K. K. Langlais, J. L. Americo, S. K. DeVido, Y. Cheng, and J. A. Kassis Enhancer-promoter communication at the Drosophila engrailed locus Development, September 15, 2009; 136(18): 3067 - 3075. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujioka, X. Wu, and J. B. Jaynes A chromatin insulator mediates transgene homing and very long-range enhancer-promoter communication Development, September 15, 2009; 136(18): 3077 - 3087. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fang, H. Ren, J. Liu, K. M. Cadigan, S. R. Patel, and G. R. Dressler Drosophila ptip is essential for anterior/posterior patterning in development and interacts with the PcG and trxG pathways Development, June 1, 2009; 136(11): 1929 - 1938. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujioka, G. L. Yusibova, J. Zhou, and J. B. Jaynes The DNA-binding Polycomb-group protein Pleiohomeotic maintains both active and repressed transcriptional states through a single site Development, December 15, 2008; 135(24): 4131 - 4139. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||