|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 January 2008
doi: 10.1242/dev.011932
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Report |
1 CABD, CSIC-Universidad Pablo de Olavide, 41013 Seville, Spain.
2 SARS Institute, N-5008 Bergen, Norway.
3 IBMC, Universidade do Porto, 4159-180 Oporto, Portugal.
Author for correspondence (e-mail:
fcasfer{at}upo.es)
Accepted 21 December 2007
SUMMARY
During eye development, retinal progenitors are drawn from a multipotent, proliferative cell population. In Drosophila the maintenance of this cell population requires the function of the TALE-homeodomain transcription factor Hth, although its mechanisms of action are still unknown. Here we investigate whether members of the Meis gene family, the vertebrate homologs of hth, are also involved in early stages of eye development in the zebrafish. We show that meis1 is initially expressed throughout the eye primordium. Later, meis1 becomes repressed as neurogenesis is initiated, and its expression is confined to the ciliary margin, where the retinal stem population resides. Knocking down meis1 function through morpholino injection causes a delay in the G1-to-S phase transition of the eye cells, and results in severely reduced eyes. This role in cell cycle control is mediated by meis1 regulating cyclin D1 and c-myc transcription. The forced maintenance of meis1 expression in cell clones is incompatible with the normal differentiation of the meis1-expressing cells, which in turn tend to reside in undifferentiated regions of the retinal neuroepithelium, such as the ciliary margin. Together, these results implicate meis1 as a positive cell cycle regulator in early retinal cells, and provide evidence of an evolutionary conserved function for Hth/Meis genes in the maintenance of the proliferative, multipotent cell state during early eye development.
Key words: meis1, Zebrafish, Cell cycle, Eye development, cyclin D1, c-myc (myca)
INTRODUCTION
During the development of the eye, in vertebrates and invertebrates, neural
progenitors derive from multipotent and proliferative cells (reviewed by
Chow and Lang, 2001
;
Dominguez and Casares, 2005).
In the Drosophila eye primordium, the TALE-class homeodomain
transcription factor Homothorax (Hth) is expressed in this multipotent
population, where it is required to maintain these cells in a proliferative
state and to prevent their premature differentiation
(Pai et al., 1998;
Pichaud and Casares, 2000;
Bessa et al., 2002). The
homologs of hth in vertebrates are the Meis and Prep (also known as
Pknox) gene families (reviewed by Burglin,
1997; Moens and Selleri,
2006). Whereas the expression of Prep genes is widespread in mice
and zebrafish, Meis genes show specific transcription patterns in vertebrates,
including expression in the developing eye
(Ferretti et al., 1999;
Toresson et al., 2000;
Waskiewicz et al., 2001;
Maeda et al., 2002;
Zhang et al., 2002;
Hisa et al., 2004).
Recent work points to a role for Meis genes in eye development: Meis1 and
Meis2 are upstream regulators of Pax6 in the developing lens in chicken and
mouse (Zhang et al., 2002),
and mouse embryos homozygous for a homeodomain-less Meis1 gene show
eye malformations (Hisa et al.,
2004). Still, the precise role(s) played by Meis genes during eye
development remain(s) unknown. If the parallels in early eye development
between flies and vertebrates hold true for Hth/Meis, Meis genes might be
involved in stimulating proliferation, or preventing premature differentiation
in the optic primordium, or both. Here, we investigated these hypotheses in
the zebrafish (Danio rerio).
MATERIALS AND METHODS
Probe preparation, in situ hybridization and immunolabeling
Antisense RNA probes were prepared from cDNAs and labeled with digoxigenin.
Specimens were fixed, hybridized and stained as described
(Tena et al., 2007).
Fluorescent probes and antibodies
Propidium iodide (PI) was used as nuclear stain; FITC-phalloidin to mark
filamentous actin; anti-Islet1 mouse monoclonal antibody labels GCL [36 hours
post-fertilization (hpf)] and ganglion cell layer (GCL) plus inner nuclear
layer (INL) (48-72hpf) (from DSHB, University of Iowa); rabbit anti-GFP
(A11122, Molecular Probes), mouse anti-Myc (MMS 150P, Covance), mouse
anti-cleaved Caspase 3 (Cell Signaling Technology). Fluorescent secondary
antibodies were from Molecular Probes. Dissected eyes from stained embryos
were imaged using a Leica-SP2 confocal system, and data processed with Adobe
Photoshop.
In vitro RNA synthesis and microinjection of mRNA and morpholinos
cDNAs were linearized and transcribed as described
(Tena et al., 2007). One- to
two-cell-stage zebrafish embryos were injected in the yolk with mRNA and/or
morpholino (MO) diluted in 
5 nl of injection solution (10% Phenol Red in
DEPC-treated water).
MOs targeting the ATG region of meis1, meis2.2, meis3 and meis4 mRNAs (see Fig. S1A in the supplementary material) were synthesized by GeneTools. We verified the target specificity of meis1- and meis2.2-MOs in Xenopus laevis assays (see Fig. S1B in the supplementary material), and the biological specificity of the meis1-MO by testing its ability to reduce the rhombomere-3 expression of krox20 (also known as egr2 - ZFIN) (see Figs S2 and S5 in the supplementary material).
As controls, we injected similar amounts (8-16 ng) of a control MO directed against the Xenopus tropicalis olig2 gene that shows no match in the zebrafish genome (see Fig. S1 in the supplementary material). The meis3-MO, which has nine and seven mismatches with meis1 and meis2.2, respectively, also served as control MO in some experiments.
|
2 test.
Plasmid constructs
I.M.A.G.E. cDNA clones, from the Lawrence Livermore National Laboratory
Consortium, used were: ccnd1 (IMAGE IRALp962K2356Q), c-myc (IRBOp991F125D),
meis1 (IRAKp961C08136Q), meis2.1 (IRBOp991C0733D), meis2.2 (IRBOp991D0437D),
meis3 (IRALp962E1456Q) and meis4 (MPMGp609N1326Q). pCS2-ccnd1 was generated by
inserting the full-length cDNA into EcoRI and XbaI sites of
pCS2+. To generate GFP-meis1, MT-meis1, meis1-MT, MT-meis2.2, meis2.2-MT,
MT-meis3, meis3-MT, MT-meis4 and meis4-MT constructs, we PCR amplified the
corresponding Meis coding regions with the following primer pairs
(5'-3'; EcoRI and XhoI sites underlined):
GAATTCGATGGCGCAGAGGT and CTCGAGCATGTAGTGCCACTGTCCC for
meis1; GAATTCGATGGCGCAAAGGTACGA and
CTCGAGCATGTAGTGCCACTGGCC for meis2.2;
GAATTCCATGGATA AGAGGTATGAGGAGTT and
CTCGAGGTGGGCATGTATGTCAA for meis3; and
GAATTCCATGGCGCAACGGTACGA and CTCGAGCATGTAGTGCCACTGACTCTC
for meis4.
The PCR fragments were subcloned into pGEMT-Easy (Promega) and sequenced. Meis cDNAs were cloned into pCS2 MT, pCS2p+MTC2 or pCS2eGFP (kindly provided by D. Turner, University of Michigan, USA) to generate N-terminal (Myc-meis) and C-terminal (meis-Myc) Myc-tagged meis or N-terminal GFP-tagged meis1 (GFP-meis1), respectively. To generate the Tol2-GFP-meis1 and Tol2-GFP constructs, we inserted the GFP-meis1 and GFP fragments, respectively, into SalI and SspI sites of Tol2 (pT2KXIG).
Acridine Orange staining
Acridine Orange staining was performed as described
(Perkins et al., 2005).
DNA content analysis and flow cytometry
Eyes dissected from 19hpf zebrafish embryos were disaggregated, and PI
staining carried out as described
(Langenau et al., 2003). DNA
content was analyzed on a BD FACSAria and results processed with FloJo
software (Tree Star). A 2 test was used for statistical data
analysis.
Induction of ectopic expression mosaics
The Tol2 transposon/transposase method of transgenesis
(Kawakami et al., 2004) was
used with minor modifications. Four- to 16-cell-stage zebrafish embryos were
injected in the yolk with 5-12.5 pg of either Tol2-GFP-meis1 or
Tol2-GFP constructs, plus 125 pg of transposase-encoding mRNA in a final
volume of 5 nl of injection solution. Embryos were cultured at 28.5°C,
staged and fixed. Anti-GFP antibody was used to detect the GFP- or
GFP-meis1-expressing clones. A stack of confocal z-sections
was obtained for each eye analyzed. Three-dimensional reconstruction of the
stacks was used to determine the location of the clones.
RESULTS AND DISCUSSSION
meis1 expression is restricted to the undifferentiated and proliferating cells of the early zebrafish eye
Of all five zebrafish Meis genes (meis1, 2.1, 2.2, 3 and
4.1), only meis1 and meis2.2 are expressed during
early stages of eye development (Kudoh et
al., 2001; Waskiewicz et al.,
2001; Zerucha and Prince,
2001; Thisse and Thisse,
2005) (this work). meis1, as monitored by in situ
hybridization, or by a YFP insertional reporter inserted close to
meis1, was seen to be uniformly transcribed in the eye primordium
from 15 to 24hpf (Fig. 1A
and see Fig. S3 in the supplementary material), a period in which all cells
proliferate (Li et al., 2000).
After this time, meis1 expression progressively retracted in the
retina (Fig. 1B-D,K,L) as the
neurogenic wave, marked by ath5 (also known as atoh7 - ZFIN)
expression, expands from antero-nasal to posterior-temporal positions
(Fig. 1F-H)
(Hu and Easter, 1999;
Li et al., 2000;
Masai et al., 2000).
meis1 remained transiently expressed in the ciliary margin zone
(CMZ), where the retinal stem population resides
(Fig. 1D,M). meis2.2
was also found to be expressed uniformly in early eye primordia, but its
expression faded away by 20hpf (see Fig. S3 in the supplementary material).
Similar to the situation found in chicken and mouse
(Zhang et al., 2002),
meis1 was expressed in the prospective lens ectoderm, but was turned
off as the lens placode started to thicken
(Fig. 1I,J). Therefore,
meis1 expression is associated with the undifferentiated,
proliferative cells during the early development of the zebrafish eye. In
addition, a new wave of Meis gene expression starts in postmitotic neurons at
around 36-42hpf (Fig. 1M and
see Fig. S3 in the supplementary material). Interestingly, at 4 days
post-fertilization (dpf), meis2.2 expression had replaced
meis1 at the CMZ.
|
)
seemed unaffected, when observed by in situ hybridization (see Fig. S4A,B in
the supplementary material and data not shown). In agreement with this, we
found that the expression of the Pax6 gene eyeless is independent of
hth during the development of the Drosophila eye (see Fig.
S4E,F in the supplementary material). To further dissect the mechanisms underlying the observed microphthalmia, we assessed whether meis1 controls the cell cycle. meis1-morphant eyes, at 19hpf, had a significantly higher percentage of cells in G1 phase than control embryos (Fig. 3A,E), indicating a requirement of meis1 in promoting the G1-S transition. Viability of these cells was not compromised, as meis1-morphant eyes did not show a significant increase in the levels of active Caspase 3, or in the vital incorporation of Acridine Orange (not shown).
cyclin D1 (ccnd1) and c-myc (also known as
myca - ZFIN) are two major G1 regulators of the cell cycle in
vertebrates (Levine and Green,
2004). During the development of the zebrafish eye, cyclin
D1 and c-myc are first widely expressed in the optic vesicle,
followed by a progressive restriction to the proliferating cells of the neural
retina (Thisse and Thisse,
2005; Yamaguchi et al.,
2005), a pattern that is reminiscent of that of meis1. In
addition, recent work shows that cyclin D1 is required for
proliferation in the zebrafish developing retina, as cyclin D1
morphants are microphthalmic (Duffy et al.,
2005). The similarity between the patterns of expression of
meis1, cyclin D1 and c-myc, and the similar eye phenotypes
of cyclin D1 and meis1 morphants, prompted us to ask whether
cyclin D1 and c-myc were under meis1 control.
Indeed, meis1 morphants showed a dramatic reduction of cyclin
D1 and c-myc expression in the eye when compared with
control-injected embryos (Fig.
3F-I and see Fig. S5 in the supplementary material). In addition,
the co-injection of either cyclin D1 or c-myc mRNAs
partially rescued the cell cycle defects of meis1 morphants to levels
similar to those obtained by co-injection of GFP-meis1 mRNA
(Fig. 3B-E). These results
place cyclin D1 and c-myc functionally downstream of
meis1 in the control of cell cycle progression in the developing eye.
Whether meis1 regulates the transcription of cyclin D1 and
c-myc directly or indirectly is unknown.
Maintenance of meis1 expression is incompatible with cell differentiation
In Drosophila, hth not only promotes proliferation in the eye
primordium, but forced maintenance of its expression results in a delay or
block of retinal differentiation (Pai et
al., 1998; Pichaud and
Casares, 2000; Bessa et al.,
2002). Similarly, in the early zebrafish eye, meis1
expression is found in undifferentiated cells but is turned off as
neurogenesis advances (Fig. 1).
To test whether maintaining meis1 expression is incompatible with
retinal differentiation, we analyzed the distribution of clones of cells
expressing either GFP or GFP-tagged-Meis1 in developing retinas, prior to and
after the initiation of neuronal differentiation
(Fig. 4 and see Fig. S6 in the
supplementary material). Differentiation was followed using the GCL marker
islet1. When analyzed between 24 and 30hpf, a stage at which most of
the retina is undifferentiated, all GFP- and 80% of GFP-Meis1-expressing
clones spanned the whole width of the neuroepithelium (n=57 and 46,
respectively; Fig. 4A,D). Later
in development, when retinal differentiation is ongoing and layering becomes
apparent, most GFP clones appeared in the central retina and contained both
Islet1-expressing and non-expressing cells (90%)
(Fig. 4B,C), whereas only a few
(7%) were found in the CMZ (n=41). By contrast, of the GFP-Meis1
clones located in the central retina (72%, n=39), none contained
Islet1-positive cells at this stage (Fig.
4E). In addition, a large portion of these Meis1-expressing clones
(28%, n=39) was found in the CMZ
(Fig. 4F). The fact that
Meis1-expressing cells were always found in undifferentiated regions of the
neuroepithelium, leads us to conclude that maintenance of meis1
expression in the first 48 hours of eye development is incompatible with
neuronal differentiation.
|
|
). Although
retinal lamination in meis1 morphants is not grossly affected, we
cannot rule out specific effects on the specification and/or differentiation
of specific retinal cell types, as meis1, together with
meis2.1 and meis2.2, is redeployed in postmitotic cells of
the ganglion cell and inner nuclear layers
(Fig. 1M and see Fig. S3 in the
supplementary material).
The expression of meis1 in the CMZ, and the fact that forcing
meis1 expression results in the localization of the expressing cells
to the CMZ, suggest that meis1 might function in specifying the
retinal stem cells of the zebrafish. In this regard, it is interesting to note
that meis1 expression resembles that of Pax6, a previously
described retinal progenitor transcription factor
(Raymond et al., 2006)
(reviewed by Amato et al.,
2004). In Drosophila, previous results showed that
hth and eyeless are co-expressed in the undifferentiated
domain and that their products might directly interact in vivo
(Bessa et al., 2002). All these
results seem to indicate that a common molecular mechanism to maintain a
multipotent stem-like state exists during eye development in vertebrates and
invertebrates.
In addition to controlling several developmental processes, Meis genes are
overexpressed in an increasing number of cancer types
(Lawrence et al., 1999;
Segal et al., 2004;
Geerts et al., 2005;
Dekel et al., 2006). Therefore,
the identification of functional targets of the Meis genes involved in the
maintenance of the undifferentiated and proliferative state during normal
development, such as cyclin D1 and c-myc, is likely to be
instrumental in deciphering the mechanisms underlying Meis-associated
tumors.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/5/799/DC1
ACKNOWLEDGMENTS
We are grateful to Dorothea Schulte for communicating results prior to publication. This work was supported by grants BMC2003-06248 and BFU2006-00349/BMC from the Spanish Ministry of Education and Science, co-funded by FEDER, to F.C. J.B., M.J.T. and J.S. are supported by the Fundação para Ciência e Tecnologia, Portugal. The CABD is institutionally supported by Junta de Andalucía.
Footnotes
* These authors contributed equally to this work 
REFERENCES
Amato, M. A., Arnault, E. and Perron, M. (2004). Retinal stem cells in vertebrates: parallels and divergences. Int. J. Dev. Biol. 48,993 -1001.[CrossRef][Medline]
Bessa, J., Gebelein, B., Pichaud, F., Casares, F. and Mann, R.
S. (2002). Combinatorial control of Drosophila eye
development by eyeless, homothorax, and teashirt. Genes
Dev. 16,2415
-2427.
Burglin, T. R. (1997). Analysis of TALE
superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel
domain conserved between plants and animals. Nucleic Acids
Res. 25,4173
-4180.
Choe, S.-K., Vlachakis, N. and Sagerström, C. G.
(2002). Meis family proteins are required for hindbrain
development in the zebrafish. Development
129,585
-595.
Chow, R. L. and Lang, R. A. (2001). Early eye development in vertebrates. Annu. Rev. Cell Dev. Biol. 17,255 -296.[CrossRef][Medline]
Dekel, B., Metsuyanim, S., Schmidt-Ott, K. M., Fridman, E.,
Jacob-Hirsch, J., Simon, A., Pinthus, J., Mor, Y., Barasch, J., Amariglio, N.
et al. (2006). Multiple imprinted and stemness genes provide
a link between normal and tumor progenitor cells of the developing human
kidney. Cancer Res. 66,6040
-6049.
Dominguez, M. and Casares, F. (2005). Organ specification-growth control connection: new in-sights from the Drosophila eye-antennal disc. Dev. Dyn. 232,673 -684.[CrossRef][Medline]
Duffy, K. T., McAleer, M. F., Davidson, W. R., Kari, L., Kari,
C., Liu, C. G., Farber, S. A., Cheng, K. C., Mest, J. R., Wickstrom, E. et
al. (2005). Coordinate control of cell cycle regulatory genes
in zebrafish development tested by cyclin D1 knockdown with morpholino
phosphorodiamidates and hydroxyprolyl-phosphono peptide nucleic acids.
Nucleic Acids Res. 33,4914
-4921.
Ferretti, E., Schulz, H., Talarico, D., Blasi, F. and Berthelsen, J. (1999). The PBX-regulating protein PREP1 is present in different PBX-complexed forms in mouse. Mech. Dev. 83,53 -64.[CrossRef][Medline]
Geerts, D., Revet, I., Jorritsma, G., Schilderink, N. and Versteeg, R. (2005). MEIS homeobox genes in neuroblastoma. Cancer Lett. 228,43 -50.[CrossRef][Medline]
Heine, P., Dohle, E., Bumsted-O'Brien, K., Engelkamp, D. and
Schulte, D. (2008). Evidence for an evolutionary conserved
role of homothorax/Meis during vertebrate retina development.
Development 135,805
-811.
Hisa, T., Spence, S. E., Rachel, R. A., Fujita, M., Nakamura, T., Ward, J. M., Devor-Henneman, D. E., Saiki, Y., Kutsuna, H., Tessarollo, L. et al. (2004). Hematopoietic, angiogenic and eye defects in Meis1 mutant animals. EMBO J. 23,450 -459.[CrossRef][Medline]
Hu, M. and Easter, S. S. (1999). Retinal neurogenesis: the formation of the initial central patch of postmitotic cells. Dev. Biol. 207,309 -321.[CrossRef][Medline]
Huang, H., Paliouras, M., Rambaldi, I., Lasko, P. and
Featherstone, M. (2003). Nonmuscle myosin promotes
cytoplasmic localization of PBX. Mol. Cell. Biol.
23,3636
-3645.
Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, M., Matsuda, N. and Mishina, M. (2004). A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Dev. Cell 7,133 -144.[CrossRef][Medline]
Kudoh, T., Tsang, M., Hukriede, N. A., Chen, X., Dedekian, M.,
Clarke, C. J., Kiang, A., Schultz, S., Epstein, J. A., Toyama, R. et al.
(2001). A gene expression screen in zebrafish embryogenesis.
Genome Res. 11,1979
-1987.
Langenau, D. M., Traver, D., Ferrando, A. A., Kutok, J. L.,
Aster, J. C., Kanki, J. P., Lin, S., Prochownik, E., Trede, N. S., Zon, L. I.
et al. (2003). Myc-induced T cell leukemia in transgenic
zebrafish. Science 299,887
-890.
Laplante, M., Kikuta, H., Konig, M. and Becker, T. S. (2006). Enhancer detection in the zebrafish using pseudotyped murine retroviruses. Methods 39,189 -198.[CrossRef][Medline]
Lawrence, H. J., Rozenfeld, S., Cruz, C., Matsukuma, K., Kwong, A., Komuves, L., Buchberg, A. M. and Largman, C. (1999). Frequent co-expression of the HOXA9 and MEIS1 homeobox genes in human myeloid leukemias. Leukemia 13,1993 -1999.[CrossRef][Medline]
Levine, E. M. and Green, E. S. (2004). Cell-intrinsic regulators of proliferation in vertebrate retinal progenitors. Semin. Cell Dev. Biol. 15, 63-74.[CrossRef][Medline]
Li, Z., Hu, M., Ochocinska, M. J., Joseph, N. M. and Easter, S. S., Jr (2000). Modulation of cell proliferation in the embryonic retina of zebrafish (Danio rerio). Dev. Dyn. 219,391 -401.[CrossRef][Medline]
Maeda, R., Ishimura, A., Mood, K., Park, E. K., Buchberg, A. M.
and Daar, I. O. (2002). Xpbx1b and Xmeis1b play a
collaborative role in hindbrain and neural crest gene expression in Xenopus
embryos. Proc. Natl. Acad. Sci. USA
99,5448
-5453.
Masai, I., Stemple, D. L., Okamoto, H. and Wilson, S. W. (2000). Midline signals regulate retinal neurogenesis in zebrafish. Neuron 27,251 -263.[CrossRef][Medline]
Moens, C. B. and Selleri, L. (2006). Hox cofactors in vertebrate development. Dev. Biol. 291,193 -206.[CrossRef][Medline]
Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T.,
Bessarab, D. A., Salzberg, A. and Sun, Y. H. (1998). The
Homothorax homeoprotein activates the nuclear localization of another
homeoprotein, extradenticle, and suppresses eye development in Drosophila.
Genes Dev. 12,435
-446.
Perkins, B. D., Nicholas, C. S., Baye, L. M., Link, B. A. and Dowling, J. E. (2005). dazed gene is necessary for late cell type development and retinal cell maintenance in the zebrafish retina. Dev. Dyn. 233,680 -694.[CrossRef][Medline]
Pichaud, F. and Casares, F. (2000). homothorax and iroquois-C genes are required for the establishment of territories within the developing eye disc. Mech. Dev. 96, 15-25.[CrossRef][Medline]
Raymond, P. A., Barthel, L. K., Bernardos, R. L. and Perkowski, J. J. (2006). Molecular characterization of retinal stem cells and their niches in adult zebrafish. BMC Dev. Biol. 6,36 .[CrossRef][Medline]
Segal, E., Friedman, N., Koller, D. and Regev, A. (2004). A module map showing conditional activity of expression modules in cancer. Nat. Genet. 36,1090 -1098.[Medline]
Stigloher, C., Ninkovic, J., Laplante, M., Geling, A.,
Tannhauser, B., Topp, S., Kikuta, H., Becker, T. S., Houart, C. and
Bally-Cuif, L. (2006). Segregation of telencephalic and
eye-field identities inside the zebrafish forebrain territory is controlled by
Rx3. Development 133,2925
-2935.
Tena, J. J., Neto, A., de la Calle-Mustienes, E., Bras-Pereira, C., Casares, F. and Gomez-Skarmeta, J. L. (2007). Odd-skipped genes encode repressors that control kidney development. Dev. Biol. 301,518 -531.[CrossRef][Medline]
Thisse, C. and Thisse, B. (2005). High throughput expression analysis of ZF-models consortium clones. ZFIN Direct Data Submission, http://zfin.org.
Toresson, H., Parmar, M. and Campbell, K. (2000). Expression of Meis and Pbx genes and their protein products in the developing telencephalon: implications for regional differentiation. Mech. Dev. 94,183 -187.[CrossRef][Medline]
Vlachakis, N., Choe, S. K. and Sagerstrom, C. G. (2001). Meis3 synergizes with Pbx4 and Hoxb1b in promoting hindbrain fates in the zebrafish. Development 128,1299 -1312.[Abstract]
Waskiewicz, A. J., Rikhof, H. A., Hernandez, R. E. and Moens, C.
B. (2001). Zebrafish Meis functions to stabilize Pbx proteins
and regulate hindbrain patterning. Development
128,4139
-4151.
Yamaguchi, M., Tonou-Fujimori, N., Komori, A., Maeda, R.,
Nojima, Y., Li, H., Okamoto, H. and Masai, I. (2005). Histone
deacetylase 1 regulates retinal neurogenesis in zebrafish by suppressing Wnt
and Notch signaling pathways. Development
132,3027
-3043.
Zerucha, T. and Prince, V. E. (2001). Cloning and developmental expression of a zebrafish meis2 homeobox gene. Mech. Dev. 102,247 -250.[CrossRef][Medline]
Zhang, X., Friedman, A., Heaney, S., Purcell, P. and Maas, R.
L. (2002). Meis homeoproteins directly regulate Pax6 during
vertebrate lens morphogenesis. Genes Dev.
16,2097
-2107.
This article has been cited by other articles:
|
|
 |
|
  P. Heine, E. Dohle, K. Bumsted-O'Brien, D. Engelkamp, and D. Schulte Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development Development, March 1, 2008; 135(5): 805 - 811. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
