|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 January 2008
doi: 10.1242/dev.015206
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biochemistry, Faculty of Medicine, The Hebrew University, PO Box
12272, Jerusalem 91120, Israel.
2 Department of Cellular Biochemistry and Human Genetics, Faculty of Medicine,
The Hebrew University, PO Box 12272, Jerusalem 91120, Israel.
3 The Rappaport Faculty of Medicine and Research Institute, Technion-Israel
Institute of Technology, Haifa 31096, Israel.
4 Institut de Biologia Molecular de Barcelona-CSIC and Institució
Catalana de Recerca i Estudis Avançats, Parc Científic de
Barcelona, 08028-Barcelona, Spain.
* Author for correspondence (e-mail: zparoush{at}cc.huji.ac.il)
Accepted 12 December 2007
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Drosophila, Groucho, TLE, phosphorylation, RTK signalling, Repression
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
);
two FGF receptors (FGFR) are required for the patterning of the mesoderm and
trachea (Huang and Stern,
2005); and the EGF receptor (EGFR) pathway controls various
processes such as the formation of the ventral neuroectoderm, the
specification of muscle precursors and the invagination of tracheal branches
(Shilo, 2003). These
differential transcriptional and morphological responses to RTK activation are
context specific, and probably depend on the strength, range and duration of
the signal. Additional specificity of the response is conferred by crosstalk
between RTK and other signalling pathways
(Culi et al., 2001), as well
as by the combinatorial activity of nuclear pathway effectors together with
distinct tissue-specific factors, at the level of specific DNA enhancers
(Flores et al., 2000;
Simon, 2000).
The EGFR pathway induces broad changes in target gene expression in
responding cells by activating, as well as inactivating, specific DNA-binding
transcription factors belonging to the Ets family
(Shilo, 2005). We have
recently found that this pathway also modulates the function of Groucho (Gro),
a pivotal global corepressor that contains two putative, evolutionarily
conserved MAPK consensus sites. Specifically, Gro is phosphorylated in
response to EGFR-dependent signalling, and this modification leads to the
downregulation of its repressor capacity
(Hasson et al., 2005). In
particular, we have shown that the activation of the EGFR pathway attenuates
Gro-mediated repression in vivo, whereas mutations in either Egfr or
Ras produce an opposite effect, i.e. Gro-mediated repression is
strengthened. Significantly, the ubiquitously expressed Gro and its
Transducin-like Enhancer-of-split (TLE) mammalian homologues interact with,
and potentiate the repressor function of, a large number of transcription
factors (Buscarlet and Stifani,
2007; Chen and Courey,
2000). By compromising the ability of Gro/TLE to function as a
general negative transcriptional co-regulator, EGFR signalling can thus
simultaneously override an entire group of repressors, affecting the spatial
and temporal regulation of their target genes. In this way, relief of
Gro/TLE-dependent gene silencing in response to EGFR signalling could
potentially permit the coordinated derepression of a large number of genes,
allowing for wide-range changes in gene expression profiles, and consequently
in cell fates (Hasson and Paroush,
2006).
Here, we have generated antibodies that specifically recognise the phosphorylated form of Gro, allowing us to detect it in its modified state during the different stages of embryonic development. We use these anti-sera to explore the dynamics of Gro phosphorylation in vivo, and find that it is modified downstream of several RTK pathways. Our data suggest that Gro is phosphorylated directly by MAPK or by the MAPK kinase MEK. Importantly, a large proportion of the pool of Gro molecules per nucleus is phosphorylated, indicating that the repressor capability of Gro is attenuated by an efficient mechanism. We focus on the regulation of terminal patterning by the Torso RTK pathway, and show that Gro phosphorylation and the resulting downregulation of its repressor function is essential for the transcriptional output of this pathway and for terminal cell specification. Finally, we demonstrate that phosphorylation of Gro does not alter its subcellular localisation, nor does it bring about its degradation. Rather, nuclear Gro persists in its phosphorylated state long after MAPK/ERK activation has terminated. We propose that inactivation of Gro via phosphorylation is an essential, shared response to RTK signal transduction, and discuss a model whereby phosphorylation of Gro provides a transcriptional `memory' mechanism that allows RTK cascades to confer long-lasting effects on target gene expression.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Fly stocks and germ-line clones
The following mutant alleles and Gal4 drivers were used:
tsl691, EGFRf2,
torY9, upd1 (FlyBase),
nos-Gal4-VP16, UASp-lacZ (provided by Pernille Rørth) and
btl-Gal4;tau-GFP (gift of Benny Shilo). The yw stock served
as wild-type control.
Embryos lacking maternal gro or DSor activities were
derived from mosaic groE48 and
groBX22; or DsorLH110 (FlyBase) mutant
germlines, respectively (Chou et al.,
1993).
Cuticle preparation
Unhatched larvae (24-48 hours old) were dechorionated in bleach,
transferred into 50% lactic acid and 50% hoyers medium, and baked at 70°C
overnight.
In situ hybridisation and antibody staining
One- to 3.5-hour-old embryos were dechorionated in bleach and fixed in 4%
formaldehyde/PBS/heptane for 15-20 minutes. Expression patterns of tll,
hkb, kni, hb and nos were visualised by whole-mount in situ
hybridisation using digoxigenin-UTP labelled antisense RNA probes and anti
digoxigenin antibodies conjugated to alkaline phosphatase (Roche).
Fluorescent immunohistochemical detection of activated MAPK, in freshly
fixed embryos (10% formaldehyde/PBS/Heptane buffer), was achieved with a
monoclonal antibody against diphosphorylated Erk (dpERK) (1:100; Sigma) using
the TSA biotin system (PerkinElmer Life Sciences). Secondary antibodies were
conjugated to biotin (1:2000; Chemicon) and visualised by the addition of
Streptavidin Cy-2 (1:500; Jackson Laboratories). Polyclonal 
pGro
(1:100) antibodies were generated and affinity-purified by Biosynthesis
(www.biosyn.com).
Rabbits were immunised with the following peptide:
NH2-GCSLKTKDMEK-PGpTPGAKAR-OH. For viewing the endogenous Gro protein,
monoclonal Gro antibodies were used (1:1000; Developmental Studies
Hybridoma Bank). Other antibodies were: HA monoclonal antibody (1:1000;
Jackson Laboratories); pSTAT (1:1000; Cell Signalling Technology),
Even-skipped (1:10; Hybridoma Bank), Lamin (monoclonal; 1:1000;
gift of Yosef Gruenbaum) and Cic (1:1000)
(Jiménez et al., 2000).
For Cic detection, a preabsorbed alkaline-phosphatase-coupled secondary
antibody was utilised (1:1500; Jackson Laboratories). Secondary antibodies
were FITC- (1:2000), Rhodamine- (1:2000) or Cy5-conjugated (1:800) (Jackson
Laboratories). Embryos were mounted using DakoCytomation medium.
Germ-line transformations
P-element-mediated transformations were performed as previously described
(Goldstein et al., 2005). At
least two independent insertions were analysed for each Gro variant. For
maternal expression, homozygous nanos-Gal4-VP16 females were mated to
homozygous Gro transgenic males. Virgin female offspring with one copy of the
Gal4 driver and one copy of the Gro transgenic line were mated with
corresponding homozygous Gro transgenic males, and their progeny collected.
Maternal expression of Gro and mutant variants was confirmed by similarly
driving HA-tagged Gro and staining with HA antibodies. High uniform
nuclear expression of Gro-HA was observed from stage 1 embryos up to stage
9.
Plasmids
Gro, GroAA or GroDD fragments
(Hasson et al., 2005) were
generated by PCR amplification and subcloned, first into pBluescript
(Stratagene) and, once sequenced, into the pUASp vector
(Rørth, 1998).
Additional details are available on request.
In vitro kinase assay and western blot analyses
A HIS-tagged ERK2 fusion protein was expressed in Escherichia
coli, purified on nickel beads (Qiagen) and activated using active MEK1
(Upstate). A GST-Gro fusion protein was expressed in Escherichia
coli, bound to glutathione-agarose beads (Sigma) and incubated with or
without 0.2 µg active ERK2 in a total volume of 50 µl of kinase reaction
buffer (20 mM HEPES, 0.1 mM benzamidine, 25 mM β-glycerophosphate, 0.1 mM
DTT, 1 mM Na3VO4, 10 mM MgCl2 and 0.1 mM ATP)
for 30 minutes at 30°C. The agarose beads were then washed in 1xPBS
and the bound GST-Gro protein eluted at 95°C for 5 minutes in SDS sample
buffer. Proteins were separated by SDS-PAGE and analysed by Western blotting.
Dephosphorylation was performed by incubation with calf intestinal phosphatase
(CIP; Roche).
Quantitative PCR
For each transgene, total RNA was prepared from 200 embryos aged 1-2 hours.
QPCR was performed using the ABI Prism 7300 cycler and the Power SYBR PCR
master mix (Applied Biosystems) and analysed as described
(Livak and Schmittgen, 2001).
The primers used were specific for the transgenic forms of gro:
(gro) 5'CGATAAGAAGGCTACTGTCTACGA3', (UASp)
5'GCAGAAATGTTTACTCTTGACCAT3'. RNA levels were normalised to the
expression level of the eIF4A gene in the same samples:
5'AAGCAGGAGAACTGGAAACTG3',
5'CGGTGAAGTTGTGGATAGACAT3'.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
pGro) antibodies, and use them to reveal the
stereotyped pattern of Gro phosphorylation in vivo, that is distinct at
different developmental stages.
We have previously shown that Gro repressor activity is downregulated by
the EGFR pathway in the wing disc. Consistent with this, we find strong
pGro staining in the ventral neuroectoderm of stage 10 embryos on both
sides of the midline, in a region that matches the domain of EGFR activation
(Fig. 1A)
(Gabay et al., 1997a). Indeed,
the pGro staining in this region largely overlaps with that of the doubly
phosphorylated active form of MAPK (dpERK)
(Fig. 1A-C), which serves as an
effective readout for EGFR (and other) RTK signalling
(Gabay et al., 1997a;
Gabay et al., 1997b).
Immunofluorescence analysis, using the available monoclonal anti-Gro antibody
(Gro) (Delidakis et al.,
1991), shows a reduction in staining in the ventral neuroectoderm,
relative to more lateral ectodermal cells. To compare the Gro and
pGro patterns further, we performed double labelling experiments. We
find that the pattern detected by the Gro antibody is largely
complementary to the domain of pGro (Fig.
1D-F). The opposing Gro and pGro staining is evident
throughout embryonic development (e.g. Fig.
2; data not shown).
The above results suggest that phosphorylation of Gro reduces its detection
by the monoclonal Gro antibody, perhaps because the epitope recognised
by this antibody undergoes phosphorylation in response to signalling.
Alternatively, phosphorylation could be inducing conformational changes in the
Gro protein, or might be promoting the association of pGro-specific
interacting cofactors that mask the anti-Gro epitope. To distinguish between
these possibilities, we performed in vitro phosphorylation assays of Gro,
followed by western blot analyses. As depicted in
Fig. 1J, the largely mutually
exclusive recognition by the pGro and Gro antibodies is observed
even under denaturing conditions, arguing that these antibodies are directed
against the same epitope and that the phosphorylation event itself is enough
to cause their differential recognition.
Based on the clear regional distinction between the ON/OFF state of Gro phosphorylation in the embryo, we conclude that during Drosophila embryonic development, the majority of Gro molecules are phosphorylated in cells that respond to EGFR activation.
|
pGro and
Gro antibodies. In such mutants, phosphorylation of Gro in the
neuroectodermal region appears greatly reduced, with a concomitant expansion
of Gro staining into that region
(Fig. 1G-I). Taken together,
these data suggest that Gro phosphorylation in the ventral neuroectoderm is
EGFR-dependent.
Groucho is phosphorylated by the Torso RTK pathway
The pattern of pGro in stage 5 syncytial blastoderm embryos includes both
poles, as well as seven transverse stripes in the central region of the embryo
(Fig. 2A). Here too, the
Gro staining pattern is mostly complementary to that of pGro
(Fig. 2C); at this stage,
unphosphorylated Gro accumulates everywhere except for the embryonic termini
and the seven stripes, which stain only weakly
(Fig. 2B). Pole cells are also
strongly stained by Gro, but not with pGro, antibodies
(Fig. 2C). Importantly, the
pGro staining is completely lost in embryos devoid of maternally
contributed gro (Fig.
2D), confirming the specificity of our pGro antibodies.
The phosphorylation of Gro at the termini coincides with the areas of Torso
pathway activity, which is mandatory for the establishment of the anterior and
posterior termini of the early embryo
(Furriols and Casanova, 2003).
Consistently, the domains of dpERK and pGro staining overlap at
the anterior and posterior poles of blastoderm embryos
(Fig. 2E-G)
(Gabay et al., 1997b).
Furthermore, phosphorylation of Gro is sensitive to mutations that disrupt the
Torso pathway. For example, no staining is observed for pGro or dpERK at the
poles of embryos laid by torso-like691
(tsl691) mutant females, in which the Torso ligand is not
processed properly (Fig. 3B and
data not shown) (Casali and Casanova,
2001; Casanova et al.,
1995; Stevens et al.,
1990). Conversely, overactivation of the Torso pathway in
torY9 gain-of-function mutants
(Duffy and Perrimon, 1994;
Sprenger and Nusslein Volhard,
1992; Sprenger et al.,
1989) leads to expansion of the terminal pGro domain towards the
centre of the embryo (Fig. 3C).
Notably, the seven pGro trunk stripes are largely unaffected in
tsl691 or torY9 mutants, suggesting
that they are Torso independent (Fig.
3B,C) (see below).
Phosphorylation of Groucho correlates with FGFR-mediated signalling
In the Drosophila embryo, the FGFR pathway controls tracheal
branching and morphogenesis. In stage 12 embryos, for example, localised
activation of the Breathless FGFR occurs mainly in the posterior lateral
migrating tip cells of the tracheal branches and, consequently, ERK is
activated in these cells (see Fig. S1A in the supplementary material,
arrowhead; GFP expression marks the tracheal field)
(Gabay et al., 1997b). Double
labelling with pGro and dpERK antibodies shows coincident
staining (see Fig. S1C in the supplementary material), correlating
phosphorylation of Gro with FGFR pathway activation.
Taken together, the above findings indicate that Gro is phosphorylated in response to multiple RTK pathways that operate at different times and places in the embryo.
Groucho is phosphorylated by MAPK and by other kinases
We next asked whether Gro is directly phosphorylated by MAPK, an idea
consistent with Gro phosphorylation by multiple RTK pathways (Figs
1,
2 and
3, see Fig. S1 in the
supplementary material) and with the modification of Gro by MAPK/ERK in vitro
(Fig. 1J)
(Hasson et al., 2005).
Unfortunately, the direct analysis of mutants devoid of maternal MAPK is
technically unfeasible (Berghella and
Dimitri, 1996). Instead, we monitored phosphorylation of Gro in
embryos mutant for DSor (Drosophila MEK), lacking the
maternal contribution of the only fly MAPK kinase
(Hsu and Perrimon, 1994;
Tsuda et al., 1993); these
embryos do not accumulate active dpERK protein at their poles (data not
shown). As shown in Fig. 3E, we
find that DSor mutant embryos also lack detectable pGro protein at
their termini. Conversely, staining of these DSor embryos with the
Gro antibody reveals increased staining at the poles relative to
wild-type embryos (Fig. 3F).
These results are in agreement with Gro being a direct target for MAPK, though
they do not formally rule out the possibility that it is MEK that
phosphorylates Gro at the poles. Notably, the seven stripes of pGro still
persist in DSor mutants, suggesting that some other kinase accounts
for this striped pattern.
|
|
; Furriols and Casanova,
2003). We therefore chose this system to test whether
phosphorylation of Gro in the embryo also results in the downregulation of its
repressor activity, as has been demonstrated in the adult, and whether this
modification is important for terminal patterning.
Expression of the downstream zygotic targets of the Torso pathway,
tailless (tll) and huckebein (hkb), is
blocked outside the termini by both Gro and the DNA-binding HMG-box repressor
Capicua (Cic). At the termini, activation of the Torso pathway induces
expression of tll and hkb by locally inhibiting repression
exerted by Gro and Cic (Jiménez et
al., 2000; Paroush et al.,
1997). Phosphorylation of Cic by MAPK is one molecular mechanism
employed by the Torso pathway to relieve repression in terminal regions
(Astigarraga et al., 2007);
once phosphorylated, Cic is targeted for degradation and is thus cleared from
the poles (Jiménez et al.,
2000). We therefore asked whether downregulation of Cic at the
poles is the sole molecular event required for the derepression of
tll and hkb, or whether phosphorylation-dependent
attenuation of Gro-mediated repression is also important. To this end, we used
the GAL4/UAS system to maternally express throughout the embryo (see Fig. S2
in the supplementary material) either the native form of Gro or two modified
derivatives: (1) a GroAA variant, in which alanines replace the
phospho-acceptor residues within the two MAPK consensus sites of Gro,
rendering it unphosphorylatable; and (2) a GroDD form, in which
these two amino acids are substituted by phosphomimetic aspartates
(Hasson et al., 2005). If
phosphorylation by Torso signalling is required to attenuate the repressor
activity of endogenous Gro at the termini, then the two Gro derivatives are
predicted to exert distinct effects on terminal gap gene expression:
GroAA should be refractory to downregulation by the Torso pathway,
and hence should cause dominant repression of pathway target genes;
GroDD, however, mimics the effects of phosphorylation, and should
be unable to repress tll and hkb expression.
|
;
Weigel et al., 1990). As
Fig. 4B,F show, the
tll and hkb domains are spatially reduced at both termini by
the expression of the native form of Gro, an outcome that is consistent with
the role of Gro as a co-repressor of terminal gap gene expression
(Paroush et al., 1997). The
effects brought about by GroAA, are much stronger, however, as it
causes an almost complete loss of tll and hkb expression
(Fig. 4C,G). Notably,
tll and hkb expression persists in a small ventral patch at
the posterior pole in a significant proportion of these embryos. By contrast,
expression of the pseudo-phosphorylated GroDD derivative has no
effect, indicating that this form cannot repress tll and hkb
(Fig. 4D,H). These results
suggest that the Torso pathway is required to downregulate the co-repressor
activity of Gro for correct terminal gap gene expression.
Downregulation of Groucho via phosphorylation is required for terminal patterning
GroAA and GroDD also exert differential effects on
the expression of knirps (kni) and hunchback
(hb), two gap genes that are regulated by Tll and Hkb. The posterior
boundary of kni is established by direct Tll-mediated repression. Tll
also indirectly activates the posterior hb stripe, partly by
repressing kni, a repressor of hb
(Moran and Jiménez,
2006). Hkb also targets hb expression, repressing it at
the posterior tip (Margolis et al.,
1995). We find that the posterior stripe of hb shifts
posteriorly upon expression of GroAA, in accordance with the
reduction in tll and hkb expression in these embryos
(Fig. 5C). Notably, the small
ventroposterior domain where hkb expression persists appears devoid
of hb transcripts (Fig.
5C, compare with Fig.
4G). Similarly, kni is derepressed posteriorly in embryos
expressing GroAA (see Fig. S3C in the supplementary material). By
contrast, GroDD does not cause significant effects on hb
and kni expression (Fig.
5D, see Fig. S3D in the supplementary material).
Maternal expression of Gro, GroAA and GroDD also
leads to patterning defects that parallel their effects on terminal gene
expression. Expression of native Gro leads to a low hatching rate and causes a
range of segmental cuticular defects, consistent with the well-established
role of Gro in segmentation (not shown)
(Chen and Courey, 2000;
Paroush et al., 1994). In
34.2% of the dead larvae, we also observe a loss or reduction of terminal
structures, such as the head and filzkörper (see Fig. S3F in the
supplementary material). Expression of GroAA also causes a low
hatching rate, and in 30.5% of unhatched larvae the filzkörper is reduced
even further and at times completely lost, in accordance with a strong
reduction of tll and hkb expression at the posterior pole
(see Fig. S3G in the supplementary material and
Fig. 4B,C,F,G). Expression of
GroDD also leads to early lethality; however, the effects on
terminal structure morphology are minimal and are observed in only 11.1% of
dead larvae, whereas the vast majority of these larvae show a fully extended
filzkörper (see Fig. S3H in the supplementary material).
Collectively, these data suggest that Torso signalling downregulates Gro repressor activity via phosphorylation, and that this mode of Gro regulation is essential for accurate expression of terminal gap genes and their targets, as well as for correct specification of terminal cell fates.
Groucho may repress terminal gap genes independently of Capicua
The expression of Gro and its derivatives in the germline could potentially
interfere with the early steps of anteroposterior (AP) axis specification, and
hence the effects on tll and hkb gene expression may be
indirect. To rule out this possibility, we confirmed that anterior and
posterior determinants are correctly localised in embryos expressing Gro,
GroAA and GroDD. In all three cases, we find that
expression of hb at the anterior and that of nanos
(nos) at the posterior are indistinguishable from the wild type
(Fig. 5A-H), suggesting that
maternal expression of Gro or its variants does not disrupt early embryonic AP
axis formation.
Another possible explanation for GroAA repression of tll and hkb is that its expression leads to a failure in the clearance of Cic from the termini. However, as Fig. 5I-L shows, Cic is properly downregulated in those embryos. The ability of GroAA, and to a lesser extent of native Gro, to repress terminal gap gene expression at the pole regions where Cic is absent suggests that Gro acts in these regions in association with some other Gro-dependent repressor(s).
|
Second, a comparison of the dpERK and pGro patterns shows that MAPK is only transiently phosphorylated, whereas pGro perdures for longer periods of time. For example, dpERK is no longer detected in the pole regions of gastrulating embryos, yet Gro is still phosphorylated in these domains (Fig. 6B-D). Similarly, Gro, but not MAPK, remains phosphorylated at stage 9 in the ventral neuroectoderm, as a consequence of EGFR activation at stage 7 (data not shown). In addition, at stages 9 and 10, the extent of the pGro neuroectodermal domain is evidently larger than that of dpERK, probably reflecting the large domain of dpERK staining at the earlier stage (Fig. 1A). Thus, pGro is a stable protein that appears to undergo dephosphorylation at a low rate. Below, we discuss the implication of these findings to the regulation of target gene expression by RTK signalling.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). The key RTK effector is MAPK, which, upon activation,
translocates to the nucleus and directly targets substrate transcription
factors. Intriguingly, a surprisingly low number of transcriptional regulators
that are phosphorylated by MAPK have been identified and confirmed to date,
despite their potential vital roles in normal development and in cancer.
In this context, we have recently found that the global corepressor Gro is
phosphorylated in response to EGFR signalling, and that such regulation is
essential for the correct patterning of the adult wing
(Hasson et al., 2005). Here,
we confirm and extend these findings by showing that at least three RTK
pathways - mediated by the EGFR, FGFR and Torso receptors - elicit
phosphorylation of Gro in various embryonic processes. In addition, we provide
several lines of evidence indicating that such phosphorylation is directly
mediated by MAPK: first, MAPK/ERK2 can phosphorylate Gro in vitro
(Fig. 1); second, our
pGro sera was raised against, and detects phosphorylation on, a MAPK
consensus site; and third, DSor mutant embryos lack detectable pGro
protein in the termini and neuroectoderm
(Fig. 3; data not shown). Based
on these findings, we conclude that phosphorylation of Gro is probably a
general outcome of RTK activation in Drosophila, and possibly in
higher organisms as well. Indeed, a recent report identified TLE proteins as
possible targets of EGFR phosphorylation in mammalian cells
(Olsen et al., 2006).
Notably, the pGro antibodies also detect phosphorylated Gro in
places and times where RTK pathways are not known to be active. For example,
seven stripes of pGro staining, which overlap with the Even-skipped
pair-rule stripes, can be seen at the centre of early cellular blastoderm
embryos (Fig. 2; data not
shown). Given that this pattern is also observed in a DSor background
(Fig. 3), we hypothesise that
other MAPK family members phosphorylate Gro. In principle, several kinases
that are active in the early embryo could account for this seven-striped
pattern (e.g. p38, JNK and Nemo-like). We have ruled out the possibility that
this phosphorylation is catalysed directly or indirectly by JAK, a tyrosine
kinase that acts in segmentation (Binari
and Perrimon, 1994): the stripes of pGro and of phosphorylated
STAT (the target for JAK activity) do not overlap, and pGro is detected even
when the JAK/STAT pathway is genetically blocked (e.g. in unpaired
mutants; not shown) (Harrison et al.,
1998). Future studies will be required to uncover those additional
kinases and pathways that phosphorylate Gro, and to determine whether
modification of Gro in stripes is required to downregulate its activity
vis-à-vis one or more of its dependent repressors that act in the
process of segmentation (e.g. Hairy and Even-skipped).
|
),
where Gro is phosphorylated, suggesting that Cic-mediated repression is
insensitive to the phosphorylation state of Gro; second, the GroAA
derivative represses terminal gap gene expression at the poles, despite the
normal clearance of Cic (Fig.
4C,G, Fig. 5K).
According to the latter model, Gro would have to be recruited to promoters of
terminal gap genes by an as yet unidentified repressor. NTF-1 or GAGA, which
can bind a cis-regulatory module in the tll promoter that mediates
repression (Liaw et al.,
1995), could correspond to this repressor. Future studies will
establish whether these are Gro-dependent repressors, and whether their
function is sensitive to the phosphorylation state of Gro. In any case, our
findings provide evidence for a new level of regulation of terminal gene
expression, that acts in parallel to the regulation of Cic by the Torso
pathway and to other inputs, such as the anterior and dorsal maternal systems
at the anterior pole (Pignoni et al.,
1992), and the posterior maternal group at the posterior
(Cinnamon et al., 2004).
Regulation of Groucho-dependent repression by phosphorylation
How does MAPK phosphorylation affect Gro activity? Hypothetically, it could
influence any of the steps between the recruitment of Gro by its DNA-binding
repressor partners and its interaction with other co-factors that leads to
gene silencing. For example, phosphorylation of Gro by HIPK2 and CK2 impacts
on its interactions with transcription factors and/or with chromatin
(Choi et al., 2005;
Nuthall et al., 2004). In our
case, we find that MAPK phosphorylation does not affect the strength of
interactions between Gro and Hairy or Odd-skipped, or with the Rpd3 histone
deacetylase (HDAC) (Chen et al.,
1999; Goldstein et al.,
2005; Jiménez et al.,
1997; Mannervik and Levine,
1999; Paroush et al.,
1994), at least in vitro (A.H. and Z.P., unpublished). pGro is
evidently a stable nuclear protein, excluding the possibility that, once
modified, it is exported from the nucleus or degraded. It is possible that
phosphorylation alters the sub-nuclear localisation of Gro in a way that
precludes its ability to repress transcription. However, a more plausible
explanation, insinuated by the finding that phosphorylation of Gro abrogates
recognition by the Gro antibody, is that modified pGro can no longer
form active complexes with HDACs and/or other co-regulatory proteins.
One of our main findings is that the phosphorylated and unphosphorylated
states of Gro are largely mutually exclusive. This inference is based on the
observation that the Gro antibody hardly recognises pGro, resulting in
reduced or no staining where Gro is phosphorylated. This observation indicates
that Gro is phosphorylated by a mechanism that is highly efficient, and
supports the biological significance of Gro downregulation via
phosphorylation; if only a fraction of the pool of Gro molecules in the
nucleus were phosphorylated, then the remaining nonphosphorylated proteins
could still be active and repression would not be relieved in response to
signalling. Similarly, Cic and Yan, two repressor proteins that are also
targeted by MAPK, are effectively degraded as a result of phosphorylation by
RTK signals (Astigarraga et al.,
2007; Rebay and Rubin,
1995). By contrast, lower levels of phosphorylation should suffice
for the upregulation of transcriptional activators and signal transducers
(e.g. Pointed and MAPK, respectively).
Another aspect of Gro regulation via phosphorylation concerns its duration. A comparison between pGro and dpERK staining reveals overlapping domains at different stages of embryogenesis, suggesting that the overall dynamics of Gro phosphorylation are similar to those of RTK signalling (Figs 1, 2; see Fig. S1 in the supplementary material). A closer inspection, however, reveals that phosphorylation of MAPK precedes that of Gro, and that pGro persists after dpERK staining has faded away. For example, pGro remains at the termini until the beginning of gastrulation, when dpERK staining is no longer observed (Fig. 6B-D). Thus, pGro seems to be a stable protein, which becomes dephosphorylated at lower rates than activated MAPK. We propose that the persistence of pGro protein is an important feature of its regulation by MAPK. Thus, it is possible that prolonged phosphorylation of Gro imparts cells with long-term memory of previous RTK signalling, by enabling continuous effects on gene expression that would be necessary for cellular differentiation (Fig. 6E-E'').
Concluding remarks
Gro and its TLE mammalian homologues act as co-repressors for nuclear
effectors of multiple, conserved signal transduction pathways that include
Dpp/TGFβ, Notch and Wg/Wnt. Gro/TLE therefore makes an ideal focal point
for crosstalk between RTK and other developmental pathways
(Hasson et al., 2005;
Hasson and Paroush, 2006;
Orian et al., 2007). By
phosphorylating and downregulating the repressor function of Gro/TLE, multiple
RTK signals could impinge on the transcriptional output of other pathways,
providing a synchronised regulatory mechanism of numerous target genes via a
single yet efficient and persistent phosphorylation event.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/5/829/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Astigarraga, S., Grossman, R., Diaz-Delfin, J., Caelles, C.,
Paroush, Z. and Jiménez, G. (2007). A MAPK docking
site is critical for downregulation of Capicua by Torso and EGFR RTK
signalling. EMBO J. 26,668
-677.[CrossRef][Medline]
Berghella, L. and Dimitri, P. (1996). The
heterochromatic rolled gene of Drosophila melanogaster is
extensively polytenized and transcriptionally active in the salivary gland
chromocenter. Genetics
144,117
-125.[Abstract]
Binari, R. and Perrimon, N. (1994).
Stripe-specific regulation of pair-rule genes by hopscotch, a
putative Jak family tyrosine kinase in Drosophila. Genes
Dev. 8,300
-312.
Bronner, G., Chu-LaGraff, Q., Doe, C. Q., Cohen, B., Weigel, D.,
Taubert, H. and Jackle, H. (1994). Sp1/egr-like zinc-finger
protein required for endoderm specification and germ-layer formation in
Drosophila. Nature
369,664
-668.[CrossRef][Medline]
Buscarlet, M. and Stifani, S. (2007). The
`Marx' of Groucho on development and disease. Trends Cell
Biol. 17,353
-361.[CrossRef][Medline]
Casali, A. and Casanova, J. (2001). The spatial
control of Torso RTK activation: a C-terminal fragment of the Trunk protein
acts as a signal for Torso receptor in the Drosophila embryo.
Development 128,1709
-1715.[Abstract]
Casanova, J., Furriols, M., McCormick, C. A. and Struhl, G.
(1995). Similarities between trunk and spatzle,
putative extracellular ligands specifying body pattern in Drosophila.
Genes Dev. 9,2539
-2544.
Chen, G. and Courey, A. J. (2000). Groucho/TLE
family proteins and transcriptional repression. Gene
249, 1-16.[CrossRef][Medline]
Chen, G., Fernandez, J., Mische, S. and Courey, A. J.
(1999). A functional interaction between the histone deacetylase
Rpd3 and the corepressor groucho in Drosophila development.
Genes Dev. 13,2218
-2230.
Choi, C. Y., Kim, Y. H., Kim, Y. O., Park, S. J., Kim, E. A.,
Riemenschneider, W., Gajewski, K., Schulz, R. A. and Kim, Y.
(2005). Phosphorylation by the DHIPK2 protein kinase modulates
the corepressor activity of Groucho. J. Biol. Chem.
280,21427
-21436.
Chou, T. B., Noll, E. and Perrimon, N. (1993).
Autosomal P[ovoD1] dominant female-sterile insertions in
Drosophila and their use in generating germ-line chimeras.
Development 119,1359
-1369.[Abstract]
Cinnamon, E., Gur-Wahnon, D., Helman, A., St Johnston, D.,
Jiménez, G. and Paroush, Z. (2004). Capicua integrates
input from two maternal systems in Drosophila terminal patterning.
EMBO J. 23,4571
-4582.[CrossRef][Medline]
Culi, J., Martin-Blanco, E. and Modolell, J.
(2001). The EGF receptor and N signalling pathways act
antagonistically in Drosophila mesothorax bristle patterning.
Development 128,299
-308.[Abstract]
Delidakis, C., Preiss, A., Hartley, D. A. and
Artavanis-Tsakonas, S. (1991). Two genetically and
molecularly distinct functions involved in early neurogenesis reside within
the Enhancer of split locus of Drosophila melanogaster.
Genetics 129,803
-823.[Abstract]
Duffy, J. B. and Perrimon, N. (1994). The
torso pathway in Drosophila: lessons on receptor tyrosine
kinase signalling and pattern formation. Dev. Biol.
166,380
-395.[CrossRef][Medline]
Flores, G. V., Duan, H., Yan, H., Nagaraj, R., Fu, W., Zou, Y.,
Noll, M. and Banerjee, U. (2000). Combinatorial signalling in
the specification of unique cell fates. Cell
103, 75-85.[CrossRef][Medline]
Furriols, M. and Casanova, J. (2003). In and
out of Torso RTK signalling. EMBO J.
22,1947
-1952.[CrossRef][Medline]
Gabay, L., Seger, R. and Shilo, B. Z. (1997a).
In situ activation pattern of Drosophila EGF receptor pathway during
development. Science
277,1103
-1106.
Gabay, L., Seger, R. and Shilo, B. Z. (1997b).
MAP kinase in situ activation atlas during Drosophila embryogenesis.
Development 124,3535
-3541.[Abstract]
Goldstein, R. E., Cook, O., Dinur, T., Pisante, A., Karandikar,
U. C., Bidwai, A. and Paroush, Z. (2005). An eh1-like motif
in odd-skipped mediates recruitment of Groucho and repression in
vivo. Mol. Cell. Biol.
25,10711
-10720.
Harrison, D. A., McCoon, P. E., Binari, R., Gilman, M. and
Perrimon, N. (1998). Drosophila unpaired encodes a
secreted protein that activates the JAK signalling pathway. Genes
Dev. 12,3252
-3263.
Hasson, P. and Paroush, Z. (2006). Crosstalk
between the EGFR and other signalling pathways at the level of the global
transcriptional corepressor Groucho/TLE. Br. J. Cancer
94,771
-775.[CrossRef][Medline]
Hasson, P., Egoz, N., Winkler, C., Volohonsky, G., Jia, S.,
Dinur, T., Volk, T., Courey, A. J. and Paroush, Z. (2005).
EGFR signalling attenuates Groucho-dependent repression to antagonize Notch
transcriptional output. Nat. Genet.
37,101
-105.[Medline]
Hsu, J. C. and Perrimon, N. (1994). A
temperature-sensitive MEK mutation demonstrates the conservation of the
signalling pathways activated by receptor tyrosine kinases. Genes
Dev. 8,2176
-2187.
Huang, P. and Stern, M. J. (2005). FGF
signalling in flies and worms: more and more relevant to vertebrate biology.
Cytokine Growth Factor Rev.
16,151
-158.[CrossRef][Medline]
Jiménez, G., Paroush, Z. and Ish-Horowicz, D.
(1997). Groucho acts as a corepressor for a subset of negative
regulators, including Hairy and Engrailed. Genes Dev.
11,3072
-3082.
Jiménez, G., Guichet, A., Ephrussi, A. and Casanova,
J. (2000). Relief of gene repression by torso RTK
signalling: role of capicua in Drosophila terminal and
dorsoventral patterning. Genes Dev.
14,224
-231.
Liaw, G. J., Rudolph, K. M., Huang, J. D., Dubnicoff, T.,
Courey, A. J. and Lengyel, J. A. (1995). The torso
response element binds GAGA and NTF-1/Elf-1, and regulates tailless
by relief of repression. Genes Dev.
9,3163
-3176.
Livak, K. J. and Schmittgen, T. D. (2001).
Analysis of relative gene expression data using real-time quantitative PCR and
the 2-
CT method.
Methods 25,402
-408.[CrossRef][Medline]
Mannervik, M. and Levine, M. (1999). The Rpd3
histone deacetylase is required for segmentation of the Drosophila
embryo. Proc. Natl. Acad. Sci. USA
96,6797
-6801.
Margolis, J. S., Borowsky, M. L., Steingrimsson, E., Shim, C.
W., Lengyel, J. A. and Posakony, J. W. (1995). Posterior
stripe expression of hunchback is driven from two promoters by a
common enhancer element. Development
121,3067
-3077.[Abstract]
Moran, E. and Jiménez, G. (2006). The
tailless nuclear receptor acts as a dedicated repressor in the early
Drosophila embryo. Mol. Cell. Biol.
26,3446
-3454.
Nuthall, H. N., Joachim, K. and Stifani, S.
(2004). Phosphorylation of serine 239 of Groucho/TLE1 by protein
kinase CK2 is important for inhibition of neuronal differentiation.
Mol. Cell. Biol. 24,8395
-8407.
Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C.,
Mortensen, P. and Mann, M. (2006). Global, in vivo, and
site-specific phosphorylation dynamics in signalling networks.
Cell 127,635
-648.[CrossRef][Medline]
Orian, A., Delrow, J. J., Rosales Nieves, A. E., Abed, M.,
Metzger, D., Paroush, Z., Eisenman, R. N. and Parkhurst, S. M.
(2007). A Myc-Groucho complex integrates EGF and Notch signalling
to regulate neural development. Proc. Natl. Acad. Sci.
USA 104,15771
-15776.
Paroush, Z., Finley, R. L., Jr, Kidd, T., Wainwright, S. M.,
Ingham, P. W., Brent, R. and Ish-Horowicz, D. (1994). Groucho
is required for Drosophila neurogenesis, segmentation, and sex
determination and interacts directly with hairy-related bHLH
proteins. Cell 79,805
-815.[CrossRef][Medline]
Paroush, Z., Wainwright, S. M. and Ish-Horowicz, D.
(1997). Torso signalling regulates terminal patterning in
Drosophila by antagonising Groucho-mediated repression.
Development 124,3827
-3834.[Abstract]
Pignoni, F., Steingrimsson, E. and Lengyel, J. A.
(1992). bicoid and the terminal system activate
tailless expression in the early Drosophila embryo.
Development 115,239
-251.[Abstract]
Rebay, I. and Rubin, G. M. (1995). Yan
functions as a general inhibitor of differentiation and is negatively
regulated by activation of the Ras1/MAPK pathway. Cell
81,857
-866.[CrossRef][Medline]
Rørth, P. (1998). Gal4 in the
Drosophila female germline. Mech. Dev.
78,113
-118.[CrossRef][Medline]
Shilo, B. Z. (2003). Signalling by the
Drosophila epidermal growth factor receptor pathway during
development. Exp. Cell Res.
284,140
-149.[CrossRef][Medline]
Shilo, B. Z. (2005). Regulating the dynamics of
EGF receptor signalling in space and time. Development
132,4017
-4027.
Simon, M. A. (2000). Receptor tyrosine kinases:
specific outcomes from general signals. Cell
103, 13-15.[CrossRef][Medline]
Sprenger, F. and Nüsslein Volhard, C.
(1992). Torso receptor activity is regulated by a diffusible
ligand produced at the extracellular terminal regions of the
Drosophila egg. Cell
71,987
-1001.[CrossRef][Medline]
Sprenger, F., Stevens, L. M. and Nüsslein-Volhard, C.
(1989). The Drosophila gene torso encodes a
putative receptor tyrosine kinase. Nature
338,478
-483.[CrossRef][Medline]
Stevens, L. M., Frohnhofer, H. G., Klingler, M. and
Nüsslein Volhard, C. (1990). Localized requirement for
torso-like expression in follicle cells for development of terminal
anlagen of the Drosophila embryo. Nature
346,660
-663.[CrossRef][Medline]
Tan, P. B. and Kim, S. K. (1999). Signalling
specificity: the RTK/RAS/MAP kinase pathway in metazoans. Trends
Genet. 15,145
-149.[CrossRef][Medline]
Tsuda, L., Inoue, Y. H., Yoo, M. A., Mizuno, M., Hata, M., Lim,
Y. M., Adachi-Yamada, T., Ryo, H., Masamune, Y. and Nishida, Y.
(1993). A protein kinase similar to MAP kinase activator acts
downstream of the raf kinase in Drosophila.
Cell 72,407
-414.[CrossRef][Medline]
Weigel, D., Jurgens, G., Klingler, M. and Jackle, H.
(1990). Two gap genes mediate maternal terminal pattern
information in Drosophila. Science
248,495
-498.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
