|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 January 2008
doi: 10.1242/dev.017590
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Howard Hughes Medical Institute, Carnegie Institution, Department of Embryology, 3520 San Martin Drive, Baltimore, MD 21218, USA.
* Author for correspondence (e-mail: spradling{at}ciwemb.edu)
Accepted 17 December 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Prostaglandin, Cyclooxygenase, Actin, Ovarian follicle, Oogenesis
| INTRODUCTION |
|---|
|
|
|---|
In a variety of organisms, prostaglandins regulate female reproduction,
including follicle maturation, ovulation, fertilization, maintenance of
pregnancy, and induction of labor
(Langenbach et al., 1999
;
Loftin et al., 2002
). Cox2
knockout mice are defective in all aspects of female reproduction
(Lim et al., 1997
), while loss
of Cox1 blocks labor. PGs and PG synthetic activity has also been found in
many invertebrates (Stanley,
2006
; Stanley-Samuelson and
Pedibhotla, 1996
), including Drosophila
(Pages et al., 1986
). PG
levels in these animals frequently rise upon mating, while exogenous PGs
stimulate both egg development and laying
(Stanley, 2006
;
Stanley-Samuelson and Pedibhotla,
1996
). However, the molecular mechanisms of PG signaling during
oogenesis have not been established.
The Drosophila ovary is composed of ovarioles containing
sequentially maturing follicles termed egg chambers
(Spradling, 1993
). New
follicles are continuously produced from stem cells in the anterior region or
germarium. Groups of 16 interconnected sibling germline cells differentiate
into 15 nurse cells and an oocyte before being surrounded by epithelial cells
to form follicles. Subsequently, follicles mature through 14 morphological
stages (S1-14), during which they increase greatly in size (S1-10), take up
yolk proteins from the hemolymph (S8-10), and dump the nurse cell contents
into the oocyte (S11). Follicles subsequently undergo a complex process of
maturation that involves the programmed migration of specific subpopulations
of follicle cells, including the border cells, centripetal cells and dorsal
appendage cells that secrete and shape distinct parts of the protective
eggshell.
We have used pharmacology and genetics to explore the roles of PGs during Drosophila oogenesis. By using an in vitro egg maturation assay, in which S10B egg chambers mature to S14s in culture, we find that Drosophila egg maturation requires a Cox1-like activity. Genetic studies of the COX-like peroxidase Pxt indicate that it functions upstream of PGs to regulate actin during nurse cell dumping. These studies provide the first evidence that PGs mediate Drosophila oogenesis, making this a valuable system with which to elucidate the molecular mechanisms by which prostaglandin signaling acts during reproduction.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In vitro egg maturation (IVEM)
S10B follicles were hand dissected in room temperature freshly made IVEM
media composed of Grace's medium (BioWhittaker, Cambrex) with heat-inactivated
10% fetal bovine serum (Invitrogen) and 1x penicillin/streptomycin
glutamine (100x, Gibco). Dissected S10Bs were transferred to fresh IVEM
media while dissection continued and were then transferred into 24-well tissue
culture plates with 1 ml of IVEM media plus COX inhibitors and PGs as
indicated and allowed to develop. For each experiment, controls were treated
with the same volume of ethanol and/or DMSO used for the experimental
conditions. S10Bs were allowed to develop for 10 or more hours and then stages
were scored. Those chambers not undergoing nurse cell dumping (s10-11) were
scored as stalled, while those mostly through completely dumped were scored as
developed. Each experiment was performed at least in duplicate and standard
deviations are shown, except that standard error is presented for experiments
with three or more replicates. COX inhibitors were obtained from Cayman
Chemical, except indomethacin (Sigma). U44069, the stabilized form of
PGH2, Fluprostenol and PGF2a were from Cayman Chemical.
All other prostaglandins were from Sigma. Live time-lapse movies of S10Bs were
generated using a Zeiss Stereolumar, images were taken every 10 minutes for 10
hours.
Fertility counts
Fertility was determined by mating a known number of females with
y1w1 males, in the case of the pxt
alleles, and heterozygous sibling males for the rescue experiments. The flies
were allowed to mate for 3-4 days and then sequentially transferred to new
vials over a period of 2-3 weeks. All transfers were kept and the progeny were
counted 20 days after mating.
Transgenics
Full-length pxt cDNA, LD43174, and mouse Cox1 cDNA, B0811H12, were
cloned into the Gateway entry vector (Invitrogen), and swapped into a pUASp
vector (a kind gift from Terence Murphy), thereby placing the cDNA expression
under the control of the yeast upstream activating sequence (UAS) modified to
enhance germline expression. Mouse Cox1 was also cloned by the same means
without the starting ATG and placed into the pUASp Venus vector (kind gift
from Terence Murphy), generating an N-terminal Venus fusion. P-element
transformation was performed by Genetic Services (Cambridge, MA). Multiple
insertion lines were generated for each element. Chromosomal locations of the
P-elements were determined by standard crosses. Insertions on the 2nd
chromosome were crossed to pxtf01000 to obtain a stock of
UASp/balancer;f01000/balancer. These flies were crossed to hsGAL4 or
c587;Sco/CyO;f01000/balancer to generate GAL4;UASp;f01000/f01000. hsGAL4 flies
were incubated at 37°C (air) for 1 hour, on three consecutive days. A
known number of females were then allowed to lay eggs in a new vial over the
next 4 days. Fertility/female was assessed by counting the number of adults
eclosing by day 19.
RT-PCR
Total RNA was isolated from fattened ovaries (15-20 pairs of ovaries) or
whole flies (15-20 females) using either TriZOL reagent (Invitrogen) or Qiagen
RNeasy kit following the manufacturers' directions. RNA was treated overnight
at room temperature with 2U RNase-free DNase (Ambion). Concentration was
quantified using UV spectrometry. RNA (1 µg) was used to generate cDNA via
the Reverse Transcription System (Promega) using random primers and following
manufacturer's directions. PCR was then performed using 2 µl or 1/10th of
the RT reaction with primers to pxt and rps17, as the
control. The following pxt primers were used: to generate a
750
bp fragment starting from the ATG, 5'pxt rt ATGAGTCGCATTTTATTT and
3' pxt rt TGTGGTTCTGGATTATTG; to generate a
550 bp fragment,
5' pxt 901 GATCGTCCTCATCCTAAGT and 3' pxt 1390/1450 3'
TGGTTTGTTCGGCCATCT; and to generate the control
250 bp fragment of
rps17, 5' rps17 CGAACCAAGACGGTGAAGAAG and 3' rps17
CCTGCAACTTGATGGAGATACC. An MJ Research PTC-100 Programmable Thermal Controller
was used to amplify 50 µl reactions with GoTaq Flexi DNA polymerase and 2.5
mM MgCl2 with the following program: 2 minutes at 95°C, 30
cycles of 30 seconds at 95°C, 30 seconds at 42°C, 1 minute at
72°C, followed by 5 minutes at 72°C. Products were resolved on 0.8%
agarose LE gels (Roche) in 1xTAE buffer with 0.25 µg/µl ethidium
bromide and imaged with BioRad Gel Doc XR Scanner and Quantity One software
(V4.5.2). Experiments were carried out at least in triplicate and
representative data are shown. Real time quantitative RT-PCR reactions were
performed on ovary RT reactions on an Opticon Monitor 2 (MJ Research) using a
50 µl reaction comprising 2 µl RT and 0.5 µl of a 7.5x SYBR
Green stock (Molecular Probes). The program used was 2 minutes at 95°C, 35
cycles of 30 seconds at 95°C, 30 seconds at 42°C, 1 minute at
72°C, followed by 5 minutes at 72°, and a melting curve of each sample
was determined. Results were analyzed using the Opticon Monitor software.
Transcripts were expressed relative to the level of the control rps17
gene and normalized to the control ovaries. Each reaction was carried out in
triplicate on at least two separate RNA samples.
In situ hybridization
Whole-mount in situ hybridization was performed as previously described
(Lecuyer et al., 2008
) using
an antisense RNA probe to full-length pxt cDNA generated by in vitro
T7 transcription from HindIII-digested LD43174.
Immunofluorescence
Whole-mount samples were fixed with 4% paraformaldehyde for 15 minutes and
processed using standard procedures (Cox
and Spradling, 2003
). The following antisera from the
Developmental Studies Hybridoma Bank were used: mouse anti-Hts (1B1, 1:20) and
mouse anti-Fas3 (7G10, 1:50). Goat anti-mouse conjugated to Alexa 488
(Molecular Probes) was used at 1:2000. Rhodamine phalloidin (1:200;
Invitrogen) was added to both the primary and secondary antibody incubations.
To visualize DNA, DAPI (1 µg/ml) was added to the final wash before
mounting the samples in Vectashield (Vector Labs).
Microscopy
DIC imaging was performed on a Zeiss Axiophot microscope with a Qimaging
RETIGA 1300 camera and QCapture software. Time-lapse microscopy was performed
on Zeiss Stereolumar microscope and acquired with AxioVision software. Static
confocal images were taken with either a 20x(NA 0.7) or a 63x(NA
1.32) PlanApo lens on laser-scanning confocal microscope (SP2 or SP5; Leica).
All confocal images are projected z-stacks.
| RESULTS |
|---|
|
|
|---|
|
|
, inhibit egg
chamber development after stage 12 (see Fig. S2 in the supplementary
material). This suggests that during S10-14 egg chamber development
PGH2 is processed into PGF2
, and not the other
PGs, to facilitate maturation. Consequently, we tested whether exogenous
PGF2
can rescue COX inhibition. Both PGF2
(not shown) and its stabilized analog Fluprostenol (Flu) significantly rescue
the aspirin or NS-398-induced block in maturation
(Fig. 1L). We conclude that COX
inhibitors block cultured Drosophila egg chamber development at
expected concentrations and this inhibition is significantly overcome by
supplying exogenous PGs. These observations strongly suggest that a COX-like
enzyme and PGs play a physiological role during late follicle development in
Drosophila.
Identifying a COX-like enzyme in Drosophila
We used BLAST analysis to identify the pxt gene (AY119616) as a
candidate Drosophila COX. Mammalian COX enzymes are thought to have
evolved from heme-dependent peroxidases such as myeloperoxidase by acquiring a
cyclooxygenase activity center (Garavito
and Mulichak, 2003
; Picot et
al., 1994
). Drosophila Pxt is such a heme peroxidase,
with the conserved catalytic residues needed for heme coordination. Within the
362 amino acids of the homology region, Pxt is 38% similar and 24% identical
to vertebrate Cox1 enzymes, the closest such match among Drosophila
proteins. Like mammalian COX enzymes (Otto
et al., 1993
), Pxt is predicted to be membrane bound, as the first
18 amino acids encode a signal peptide, and to be glycosylated (PROSITE
analysis) (Hulo et al.,
2006
).
Mutations of pxt have been recovered in large insertional mutagenesis screens that allow the function of this gene to be probed. We studied two such alleles: a P-element insertion EY03052 and a Piggybac insertion f01000 (Fig. 2A). The pxtEY03052 insertion is located 17 bp upstream of the predicted 5' UTR, while pxtf01000 contains an insertion within the 5' UTR, 38 bp upstream of the starting methionine. Reverse transcriptase-PCR (RT-PCR and qRT-PCR) indicates that both insertions substantially reduce the level of pxt RNA in the ovary (Fig. 2B) and whole fly (data not shown). However, whole-mount in situ hybridization (see Fig. S3 in the supplementary material) indicates that pxtEY03052 exhibits some mislocalized and misregulated pxt expression, while pxtf01000 exhibits almost a complete loss of expression.
Like genetic loss of mammalian COX enzymes
(Lim et al., 1997
;
Stanley, 2006
;
Stanley-Samuelson and Pedibhotla,
1996
), loss of pxt affects female fertility. Homozygous
pxtf01000 females are sterile, while the fertility of
pxtEY03052 females drops with age more rapidly than normal
(Fig. 2C). pxt mutant
follicles frequently show defects in nurse cell dumping
(Fig. 2D) that resemble
wild-type chambers developed in vitro in the presence of COX inhibitors
(Fig. 1F). In 4-day-old
pxtf01000females, 93% of S14 follicles are short in length
and failed to undergo complete nurse cell dumping (n=131).
pxtEY03052 and
pxtEY03052/pxtf01000 mutant follicles
display these same phenotypes but with lower penetrance and less severity
(data not shown), in agreement with the molecular data suggesting that
pxtEY03052 is a weaker allele. Thus, both genetic loss of
pxt and COX inhibition cause a block in nurse cell dumping.
|
pxt mutants are rescued by pxt cDNA
To verify that the sterility of pxtf01000 females and
their egg chamber defects are caused by disruption of pxt, we
performed rescue experiments. Expression of a full-length pxt cDNA
under the control of the UASp promoter (which allows expression in the
germline) using heat-shock GAL4 (HS-GAL4) beginning in adulthood, restored
fertility at an average level of 18 progeny/female over the 4 days following
heat shock treatment (Fig. 3A).
For comparison, pxt heterozygous females produced 26 progeny/female
in a similar period, while unrescued mutants produced none. Such rescue proves
that the pxtf01000 phenotype is due to the loss of
pxt function, and that the RB isoform alone can provide substantial
gene function without being developmentally regulated. When pxt cDNA
was expressed using the c587 somatic cell driver, fertility was also restored
but to a lesser extent, 5.4 progeny per female in the same interval. Thus,
somatic expression of pxt is sufficient to rescue fertility but
expression in both germ cells and somatic cells driven by HS-GAL4 is more
efficacious. Fertility is also restored by precise excisions of either element
(data not shown).
PGs act downstream of Pxt
If Pxt acts as a Cox1 enzyme, then the effects of
pxtf01000 mutation on follicle development might largely
be due to reduced PG production. To test this possibility, we first examined
the ability of pxt mutant S10B follicles to develop in vitro.
Approximately 75% of pxtf01000 stage 10B follicles fail to
mature in culture, compared with
7% of wild-type controls
(Fig. 3B,C). (This differs
slightly from our previous measurement of 93% with arrested dumping in vivo
because only completely normal-looking S10B follicles were selected for in
vitro development.) Addition of either 10 µM PGH2 or 10 nM
Fluprostenol (Flu), the stabilized analog of PGF2
, greatly
improves development (Fig. 3B).
In the presence of these PGs,
70% of the follicles undergo nurse cell
dumping (Fig. 3D). Therefore,
Pxt functions in a process required for egg chamber maturation that can be
rescued by exogenous PGs, strongly supporting the idea that Pxt acts as a
Drosophila COX enzyme to synthesize PGs.
|
Actin fiber formation is decreased in pxt mutants
We examined the actin cytoskeleton of S10B pxt egg chambers to investigate
how loss of pxt and PG production interferes with nurse cell dumping.
At the onset of nurse cell dumping, the regulated formation of non-contractile
actin bundles in S10 nurse cells tethers the nurse cell nuclei and prevents
them from plugging up the oocyte ring canals
(Robinson and Cooley, 1997
).
Moreover, non-muscle myosin II-mediated contraction of nurse cell subcortical
actin provides the contractile force behind dumping and egg chamber elongation
(Wheatley et al., 1995
;
Edwards and Kiehart, 1996
).
pxtf01000 mutant follicles contained significantly fewer
actin bundles in the nurse cell cytoplasm during S10 compared with wild type
(Fig. 4B,B', compare with
4A,A'). We did not
observe nurse cell nuclei in the ring canals of mutant follicles, suggesting
that pxt mutation disrupts the actin-based contraction that generates
the force for dumping. In support of this, subcortical actin levels are
strongly decreased in the mutant follicles
(Fig. 4E,E', compare with
4D,D'). The loss of both
subcortical actin and cytoplasmic actin bundles in pxt mutants is
likely to be the underlying cause of the nurse cell dumping defects in the
mutant.
The actin defects observed in pxtf01000 females are almost completely suppressed by MCOX1 expression (Fig. 4A,C). Robust actin bundles (Fig. 4C,C') and subcortical actin (Fig, 4F,F') form in S10B nurse cells in the rescued mutants. The ability of mouse Cox1 to efficiently substitute for Pxt during oogenesis strongly argues that production of PGs or other Cox1 products are essential for actin-based contraction and actin bundle formation during nurse cell dumping. However, the mechanism(s) by which, either directly or indirectly, COX activity is required remains to be determined.
|
pxt mutants impair membrane stability and border cell migration
We also used pxt mutants to look for possible roles of PGs during
the earlier stages of oogenesis. Drosophila ovarioles normally
contain 6-7 egg chambers that regularly increase in developmental age
(Fig. 5A). By contrast,
ovarioles from pxt mutant females typically contain only 3-5 egg
chambers (Fig. 5B), and are
deficient in maturing follicles (pxtf01000 contain 80%
fewer S10s/ovariole; see Fig. S4 in the supplementary material). This is
probably due to follicle instability because 25% of
pxtf01000 ovarioles contain a fusion of two adjacent egg
chambers and in 58% of ovarioles there is at least one degenerating follicle
(see Fig. S5 in the supplementary material). pxtf01000
nurse cell plasma membranes are unstable and frequently break down to produce
multinucleate nurse cells (Fig.
5C, nuclei are outlined in white, compare with S8 in
Fig. 5A), in which an
actin-rich aggregate containing ring canal remnants remains (arrows in
Fig. 5C). The multinucleate
cells are probably caused by membrane breakdown and not cytokinesis defects,
because this phenotype is not seen in the early stages and begins to arise
around S8. The membrane breakdown, fusion and degeneration defects increase
with age, because in 25-day-old pxt females, the ovarioles are
reduced to a single fused structure (Fig.
5D).
Another striking defect was observed during border cell migration, a
process requiring dynamic cytoskeletal and adhesion changes
(Montell, 2003
). In both
homozygotes and transheterozygotes of pxtEY03052 and
pxtf01000, more than 50% of S9-10 border cell clusters to
not complete migration normally. Some mutant cells reach the oocyte, whereas
others form a trail of lagging cells along the migration path (outlined in
Fig. 5E, compare with
Fig. 5A, outlined and labeled
BC).
Intriguingly, pxt mutant phenotypes within an egg chamber usually decrease in severity along the anteroposterior (AP) axis. Membrane breakdown preferentially occur in anterior nurse cells (outlined in yellow in Fig. 5F). Conversely, posterior S10B nurse cells tend to retain more normal actin structures, including membrane and filaments (outlined in white in Fig. 5F). Interestingly, these observations suggest the possibility that a posterior to anterior gradient of PGs, or a downstream target of PGs, influences factors that regulate nurse cell dumping, membrane stability, and cell migration within the ovarian follicle.
| DISCUSSION |
|---|
|
|
|---|
. Thus, follicle maturation
provides a phenotypic focus for further genetics studies of PG action in
Drosophila.
|
Although Drosophila COX and mammalian COX enzymes appear to have
diverged over time, they are likely to have the same basic three-dimensional
structure within the conserved domain
(Garavito and Mulichak, 2003
;
Picot et al., 1994
). The
critical residues (Gln203, His207, His388) for heme coordination necessary for
the peroxidase activity are conserved in Pxt (Gln396, His402, His590). The
conservation is too weak to predict the existence of the hydrophobic
substrate-binding channel within the cyclooxygenase active site and the
substrate binding residues Arg120 and Tyr355 are not clearly conserved.
However, Pxt does contain a candidate Tyr385 (Pxt Tyr564), the residue at the
active site that acquires an activating electron from the peroxidase part of
the enzyme and is required for the cyclooxygenase activity. This suggests that
there may be substantial differences in the structure of Pxt and Cox1, despite
the ability of Cox1 to substitute functionally for Pxt.
The limited previous studies of Pxt structure and expression have suggested
alternative functions for the protein. Distant homologies exist with
peroxinectin (17-31% identity), a crayfish cell-adhesion peroxidase
(Altschul et al., 1997
;
Vazquez et al., 2002
). Pxt has
also been suggested, by homology to a putative Aedes aegypti chorion
peroxidase, to be the peroxidase responsible for eggshell hardening, a process
caused by the formation of dityrosine crosslinks
(Li et al., 2004
;
Petri et al., 1976
). Although
our more detailed expression data and the phenotypes of pxt mutants
indicate that Pxt functions as a COX enzyme and is required during oogenesis
prior to eggshell formation, we cannot rule out additional functions for the
protein. Studies of purified Pxt will be required to address its full range of
biochemical and enzymatic properties.
PGs appear to play a conserved role in follicle maturation and ovulation
Both pharmacological and genetic studies show that PGs are required for
mammalian follicles to mature normally and undergo ovulation. Cox2 knockout
mice are defective in both follicle maturation and ovulation
(Loftin et al., 2002
). In
rats, inhibition of PG synthesis results in mistargeted and incomplete
follicle rupture. The small percentage of follicles that do ovulate fail to be
fertilized, most probably owing to impaired oocyte maturation
(Lim et al., 1997
). COX
inhibitors, such as NSAIDs, cause reversible female infertility and may act in
a similar manner (Akil et al.,
1996
; Pall et al.,
2001
; Smith et al.,
1996
). Like many mammals, Drosophila females also ovulate
only one mature oocyte at a time, most probably by inducing contraction of the
muscles surrounding just one of the more than 30 ovarioles that make up the
two ovaries. In addition to their defects in follicle maturation, pxt
mutants ovulate only rarely (see Fig. S4 in the supplementary material; T.L.T.
and A.C.S., unpublished). Thus, the roles of PGs during follicle development
and ovulation may be conserved between Drosophila and mammals.
Each cycle, the single mammalian follicle that will be ovulated, the
dominant follicle, accumulates high levels of smooth muscle myosin and actin
which contributes to the contractile force needed for ovulation
(Gougeon, 1996
). These changes
in actin organization are hypothesized to be downstream of PG signaling.
PGF2
, the PG that had the most effect on Drosophila
IVEM, is intimately associated with muscle contractions in mammals
(Funk, 2001
;
Langenbach et al., 1999
).
Consequently, our finding that Pxt and PGs affect some oogenic processes that
are modulated by actin and myosin, including border cell migration and nurse
cell dumping, represents a potential parallel between the role of PGs in
Drosophila and mammalian oogenesis.
Even the induction of PG-dependent maturation may occur in a similar
manner. In mammals, PG synthesis is hormonally upregulated during the 10 hours
preceding ovulation (Duffy and Stouffer,
2001
; Murdoch et al.,
1993
; Sirois et al.,
1992
), and thereafter mediates the terminal differentiation of
follicles (El-Nefiawy et al.,
2005
). Similarly, we find that pxt levels are upregulated
during stages 9-10, and that COX activity, Pxt and PGs are subsequently
required to complete the last 10-15 hours of Drosophila follicular
development. Interestingly, the steroid hormone ecdysone is known to regulate
the S8 oogenic checkpoint, which commits egg chambers to finish developing
into mature follicles (Buszczak et al.,
1999
). Drosophila pxt expression and PG synthesis may be
upregulated by ecdysone at the onset of S8 as part of the maturation
program.
Pxt and PGs likely affect multiple pathways
Many PGs serve as short-range hormones that act as ligands for G
protein-coupled receptors (GPCRs). In mammals there are eight receptors with
distinct specificities for the active PGs, and each receptor favors the
initiation of a specific signaling cascade
(Bos et al., 2004
). Such GPCR
signaling can secondarily modulate additional signaling pathways. We have
found that PGF2
mediates Drosophila egg maturation
in vitro. Mammalian PGF2
acts as a ligand not only for the F
receptor (FP), but also for two E receptors (EP1 and
EP3), thereby increasing the possible signaling outcomes. One known
downstream target is protein kinase A (PKA), which can then activate multiple
MAPKs (Bos et al., 2004
). It
should be possible in the future to discern which effects of Pxt are exerted
autonomously, and which are downstream of intercellular signals.
Despite a possible plethora of mechanisms, PGs have been frequently found
ultimately to affect muscle contraction and ovulation, or to modulate the
actin cytoskeleton in mammals. Within many cultured mammalian cell types, PGs
cause changes in the organization, stability and polymerization of actin that
influence membrane permeability and cell motility
(Banan et al., 2000
;
Sheng et al., 2001
). PG action
appears to be rapid, suggesting that sophisticated feedback circuits may be
involved. For example, reduction in the level of actin microfilaments has been
reported to stimulate PG synthesis and release
(Wang and Hatton, 2006
). Thus,
PGs may facilitate fine-tuning of the actin cytoskeleton in a rapid time
frame.
Our studies show that Pxt and PGs can affect the actin cytoskeleton in
Drosophila. Actin filaments are greatly reduced in pxt
mutant stage 10B follicles, which phenotypically resemble follicles lacking
major components of the actin cytoskeleton
(Robinson and Cooley, 1997
).
PG-mediated regulation of actin dynamics is currently not well understood,
particularly when intercellular interactions are involved. Drosophila
oogenesis provides an attractive system to elucidate how PGs modulate actin in
the context of developing tissues.
A PG signaling gradient?
Our data suggests that disruption of PG signaling has a graded effect
within the developing follicle. The actin-related defects in pxt
mutants are more prevalent at the anterior of the egg chamber, including nurse
cell membrane loss and accumulation of actin puncta. Conversely, actin bundles
are more likely to form in a normal fashion in the nurse cells closest to the
oocyte. A PG signaling gradient might be relevant to many incompletely
understood biological differences that exist along the AP follicle axis, such
as the gradient of nurse cell ploidy, the temporal gradient of vitelline
membrane formation within the oocyte, the directional migration signal for
border cells and the programmed reorganization of the oocyte cytoskeleton in
mid-oogenesis that underlies patterning. Ultimately, by using
Drosophila genetics, it may be possible to better understand how PGs
act, providing new insights and therapeutic targets for the widely conserved
biological processes they influence.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/5/839/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akil, M., Amos, R. S. and Stewart, P. (1996).
Infertility may sometimes be associated with NSAID consumption. Br.
J. Rheumatol. 35,76
-78.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST
and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Banan, A., Smith, G. S., Kokoska, E. R. and Miller, T. A.
(2000). Role of actin cytoskeleton in prostaglandin-induced
protection against ethanol in an intestinal epithelial cell line.
J. Surg. Res. 88,104
-113.[CrossRef][Medline]
Bellen, H. J., Levis, R. W., Liao, G., He, Y., Carlson, J. W.,
Tsang, G., Evans-Holm, M., Hiesinger, P. R., Schulze, K. L., Rubin, G. M. et
al. (2004). The BDGP gene disruption project: single
transposon insertions associated with 40% of Drosophila genes.
Genetics 167,761
-781.
Bos, C. L., Richel, D. J., Ritsema, T., Peppelenbosch, M. P. and
Versteeg, H. H. (2004). Prostanoids and prostanoid receptors
in signal transduction. Int. J. Biochem. Cell Biol.
36,1187
-1205.[CrossRef][Medline]
Buszczak, M., Freeman, M. R., Carlson, J. R., Bender, M.,
Cooley, L. and Segraves, W. A. (1999). Ecdysone response
genes govern egg chamber development during mid-oogenesis in Drosophila.
Development 126,4581
-4589.[Abstract]
Buyukguzel, K., Tunaz, H., Putnam, S. M. and Stanley, D.
(2002). Prostaglandin biosynthesis by midgut tissue isolated from
the tobacco hornworm, Manduca sexta. Insect Biochem. Mol.
Biol. 32,435
-443.[CrossRef][Medline]
Cox, R. T. and Spradling, A. C. (2003). A
Balbiani body and the fusome mediate mitochondrial inheritance during
Drosophila oogenesis. Development
130,1579
-1590.
Duffy, D. M. and Stouffer, R. L. (2001). The
ovulatory gonadotrophin surge stimulates cyclooxygenase expression and
prostaglandin production by the monkey follicle. Mol. Hum.
Reprod. 7,731
-739.
Edwards, K. A. and Kiehart, D. P. (1996).
Drosophila nonmuscle myosin II has multiple essential roles in imaginal disc
and egg chamber morphogenesis. Development
122,1499
-1511.[Abstract]
El-Nefiawy, N., Abdel-Hakim, K. and Kanayama, N.
(2005). The selective prostaglandin EP4 agonist, APS-999 Na,
induces follicular growth and maturation in the rat ovary. Eur. J.
Endocrinol. 152,315
-323.
Funk, C. D. (2001). Prostaglandins and
leukotrienes: advances in eicosanoid biology. Science
294,1871
-1875.
Garavito, R. M. and Mulichak, A. M. (2003). The
structure of mammalian cyclooxygenases. Annu. Rev. Biophys. Biomol.
Struct. 32,183
-206.[CrossRef][Medline]
Gilmour, R. S. and Mitchell, M. D. (2001).
Nuclear lipid signaling: novel role of eicosanoids. Exp. Biol. Med.
Maywood 226,1
-4.
Gougeon, A. (1996). Regulation of ovarian
follicular development in primates: facts and hypotheses. Endocr.
Rev. 17,121
-155.
Hulo, N., Bairoch, A., Bulliard, V., Cerutti, L., De Castro, E.,
Langendijk-Genevaux, P. S., Pagni, M. and Sigrist, C. J.
(2006). The PROSITE database. Nucleic Acids
Res. 34,D227
-D230.
Langenbach, R., Loftin, C., Lee, C. and Tiano, H.
(1999). Cyclooxygenase knockout mice: models for elucidating
isoform-specific functions. Biochem. Pharmacol.
58,1237
-1246.[CrossRef][Medline]
Lecuyer, E., Parthasarathy, N. and Krause, H. M.
(2008). Fluorescent in situ hybridization protocols in Drosophila
embryos and tissues. In Drosophila: Methods and
Protocols (ed. C. Dahmann). Totowa, NJ: Humana Press (in
press).
Li, J., Kim, S. R. and Li, J. (2004). Molecular
characterization of a novel peroxidase involved in Aedes aegypti chorion
protein crosslinking. Insect Biochem. Mol. Biol.
34,1195
-1203.[CrossRef][Medline]
Lim, H., Paria, B. C., Das, S. K., Dinchuk, J. E., Langenbach,
R., Trzaskos, J. M. and Dey, S. K. (1997). Multiple female
reproductive failures in cyclooxygenase 2-deficient mice.
Cell 91,197
-208.[CrossRef][Medline]
Loftin, C. D., Tiano, H. F. and Langenbach, R.
(2002). Phenotypes of the COX-deficient mice indicate
physiological and pathophysiological roles for COX-1 and COX-2.
Prostaglandins Other Lipid Mediat.
68-69,177
-185.[CrossRef][Medline]
Montell, D. J. (2003). Border-cell migration:
the race is on. Nat. Rev. Mol. Cell Biol.
4, 13-24.[CrossRef][Medline]
Murdoch, W. J., Hansen, T. R. and McPherson, L. A.
(1993). A review - role of eicosanoids in vertebrate ovulation.
Prostaglandins 46,85
-115.[CrossRef][Medline]
Otto, J. C., DeWitt, D. L. and Smith, W. L.
(1993). N-glycosylation of prostaglandin endoperoxide synthases-1
and -2 and their orientations in the endoplasmic reticulum. J.
Biol. Chem. 268,18234
-18242.
Pages, M., Rosello, J., Casas, J., Gelpi, E., Gualde, N. and
Rigaud, M. (1986). Cyclooxygenase and lipoxygenase-like
activity in Drosophila melanogaster. Prostaglandins
32,729
-740.[CrossRef][Medline]
Pall, M., Friden, B. E. and Brannstrom, M.
(2001). Induction of delayed follicular rupture in the human by
the selective COX-2 inhibitor rofecoxib: a randomized double-blind study.
Hum. Reprod. 16,1323
-1328.
Petri, W. H., Wyman, A. R. and Kafatos, F. C.
(1976). Specific protein synthesis in cellular differentiation.
III. The eggshell proteins of Drosophila melanogaster and their program of
synthesis. Dev. Biol.
49,185
-199.[CrossRef][Medline]
Picot, D., Loll, P. J. and Garavito, R. M.
(1994). The X-ray crystal structure of the membrane protein
prostaglandin H2 synthase-1. Nature
367,243
-249.[CrossRef][Medline]
Robinson, D. N. and Cooley, L. (1997). Genetic
analysis of the actin cytoskeleton in the Drosophila ovary. Annu.
Rev. Cell Dev. Biol. 13,147
-170.[CrossRef][Medline]
Sheng, H., Shao, J., Washington, M. K. and DuBois, R. N.
(2001). Prostaglandin E2 increases growth and motility of
colorectal carcinoma cells. J. Biol. Chem.
276,18075
-18081.
Sirois, J., Simmons, D. L. and Richards, J. S.
(1992). Hormonal regulation of messenger ribonucleic acid
encoding a novel isoform of prostaglandin endoperoxide H synthase in rat
preovulatory follicles. Induction in vivo and in vitro. J. Biol.
Chem. 267,11586
-11592.
Smith, G., Roberts, R., Hall, C. and Nuki, G.
(1996). Reversible ovulatory failure associated with the
development of luteinized unruptured follicles in women with inflammatory
arthritis taking non-steroidal anti-inflammatory drugs. Br. J.
Rheumatol. 35,458
-462.
Spradling, A. C. (1993). Developmental genetics
of oogenesis. In The Development of Drosophila
melanogaster (ed. B. Martinez-Arias), pp.1
-70. Cold Spring Harbor: Cold Spring Harbor
Laboratory Press.
Stanley, D. W. (2000). Eicosanoids
in Invertebrate Signal Transduction Systems. Princeton: Princeton
University Press.
Stanley, D. (2006). Prostaglandins and other
eicosanoids in insects: biological significance. Annu. Rev.
Entomol. 51,25
-44.[CrossRef][Medline]
Stanley-Samuelson, D. W. and Ogg, C. L. (1994).
Prostaglandin biosynthesis by fat body from the tobacco hornworm, Manduca
sexta. Insect Biochem. Mol. Biol.
24,481
-491.[CrossRef][Medline]
Stanley-Samuelson, D. W. and Pedibhotla, V. K.
(1996). What can we learn from prostaglandins and related
eicosanoids in insects? Insect Biochem. Mol. Biol.
26,223
-234.[CrossRef][Medline]
Taketo, M. M. (1998). Cyclooxygenase-2
inhibitors in tumorigenesis (part I). J. Natl. Cancer
Inst. 90,1529
-1536.
Thibault, S. T., Singer, M. A., Miyazaki, W. Y., Milash, B.,
Dompe, N. A., Singh, C. M., Buchholz, R., Demsky, M., Fawcett, R.,
Francis-Lang, H. L. et al. (2004). A complementary transposon
tool kit for Drosophila melanogaster using P and piggyBac. Nat.
Genet. 36,283
-287.[CrossRef][Medline]
Vazquez, M., Rodriguez, R. and Zurita, M.
(2002). A new peroxinectin-like gene preferentially expressed
during oogenesis and early embryogenesis in Drosophila melanogaster.
Dev. Genes Evol. 212,526
-529.[CrossRef][Medline]
Wang, Y. F. and Hatton, G. I. (2006).
Mechanisms underlying oxytocin-induced excitation of supraoptic neurons:
prostaglandin mediation of actin polymerization. J.
Neurophysiol. 95,3933
-3947.
Wheatley, S., Kulkarni, S. and Karess, R.
(1995). Drosophila nonmuscle myosin II is required for rapid
cytoplasmic transport during oogenesis and for axial nuclear migration in
early embryos. Development
121,1937
-1946.[Abstract]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. J. Boyle and C. A. Berg Control in time and space: Tramtrack69 cooperates with Notch and Ecdysone to repress ectopic fate and shape changes during Drosophila egg chamber maturation Development, December 15, 2009; 136(24): 4187 - 4197. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wang, V. V. Patel, E. Ricciotti, R. Zhou, M. D. Levin, E. Gao, Z. Yu, V. A. Ferrari, M. M. Lu, J. Xu, et al. Cardiomyocyte cyclooxygenase-2 influences cardiac rhythm and function PNAS, May 5, 2009; 106(18): 7548 - 7552. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.C. Spradling, T. Nystul, D. Lighthouse, L. Morris, D. Fox, R. Cox, T. Tootle, R. Frederick, and A. Skora Stem Cells and Their Niches: Integrated Units That Maintain Drosophila Tissues Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.023v1. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||