|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 February 2008
doi: 10.1242/dev.015321
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ,
UK.
2 College of Life Sciences Biocentre, University of Dundee, Dundee DD1 5EH,
UK.
Author for correspondence (e-mail:
a.munsterberg{at}uea.ac.uk)
Accepted 24 December 2007
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Wnt signalling, Cell migration, Chemorepulsion, Cardiac progenitors, Chick
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
) and in the mid-primitive streak at Hamburger
Hamilton (HH) stage 3 (Garcia-Martinez and
Schoenwolf, 1993; Hamburger
and Hamilton, 1951;
Rosenquist, 1970). In the
chick, a simple, contractile heart tube forms by HH stage 10, which is after
approximately 48 hours of development.
The specification of prospective cardiac cells occurs concomitantly with
cell migration and morphogenetic movements during early embryogenesis
(Brand, 2003;
Yutzey and Kirby, 2002). How
these important processes are coordinated is, at present, not understood.
Multiple extracellular cues have been implicated in the specification of
cardiac cell fate and early heart formation, and studies in vertebrate embryos
have uncovered a crucial role for bone morphogenetic proteins (Bmps),
fibroblast growth factors (Fgfs) and Wnt signalling
(Eisenberg and Eisenberg, 1999;
Lickert et al., 2002;
Marvin et al., 2001;
Schneider and Mercola, 2001;
Schultheiss et al., 1997;
Tzahor and Lassar, 2001).
Migration routes of cells from the primitive streak towards the bilateral
heart fields have been inferred from mapping experiments
(Yutzey and Kirby, 2002) but
the molecular signals controlling cardiac progenitor cell movements are not
understood. Recently, it has become possible to observe cell movements in real
time in whole embryos. This has led to an increased understanding of cell
movement patterns, in particular during streak formation and gastrulation, and
the cellular and molecular mechanisms are beginning to be elucidated
(Chuai et al., 2006;
Cui et al., 2005;
Leslie et al., 2007;
Yang et al., 2002;
Zamir et al., 2006). Avian
embryos are particularly suited to these approaches, as they develop outside
the mother, they can be cultured (Chapman
et al., 2001), and they are accessible for the electroporation of
expression plasmids (Itasaki et al.,
1999; Momose et al.,
1999) and the analysis of explants
(Münsterberg et al.,
1995; Yang et al.,
2002).
We previously established long-term time-lapse video microscopy followed by
image analysis and showed that Fgf-mediated chemotaxis is involved in guiding
cell movements of prospective paraxial and lateral plate mesoderm cells during
gastrulation (Yang et al.,
2002). Here, we have used this approach to examine the cell
movement patterns of cardiac progenitors as they migrate from the primitive
streak at HH3. In particular, we investigated the effects of Wnt signalling
and found that prospective cardiac cells alter their movement pattern in
response to Wnt3a. Analysis of HH3 primitive streak cell explants showed that
cardiogenic cells are repelled by a source of Wnt3a and migrate away from it.
This behaviour was dependent on RhoA function and was abrogated by the
electroporation of dominant-negative forms of Wnt3a or RhoA. The perturbation
of cardiac progenitor cell movement patterns in vivo resulted in cardia
bifida, and the frequency of this phenotype was reduced significantly by the
electroporation of dominant-negative Wnt3a. We propose that, in addition to
its effects on cardiac cell-fate specification
(Marvin et al., 2001;
Schneider and Mercola, 2001),
Wnt3a acts as a chemorepellent signal to guide the movement of these cells,
and that this involves a non-canonical, RhoA-dependent pathway.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
) with their ventral side facing up. This was followed by
electroporation providing 10 pulses of 12 V for 50 mseconds. Embryos were
briefly incubated at 37°C (30 minutes to 2 hours) and were then incubated
at 28°C overnight. Small grafts of GFP-labelled primitive streak were
dissected from HH3 donor embryos and transferred to an unlabelled,
stage-matched host embryo cultured in a six-well dish. Alternatively,
primitive streak explants were cultured on the area opaca of an HH3 embryo as
described (Yang et al., 2002).
To generate cell pellets RatB1a fibroblasts were seeded on 3-cm bacterial
Petri dishes. Cells formed aggregates overnight, which were transferred to
host embryos using a Gilson pipette and implanted by pushing them into a small
slit created by fine tweezers. Most embryos had normal morphology after these
experimental manipulations and any abnormal embryos were excluded from the
analysis.
|
).
Expression constructs, probes and whole-mount in situ hybridisation
Plasmid constructs were engineered in the pCAβ vector containing the
chicken beta-actin promoter and an IRES-GFP
(Alvares et al., 2003). The
chicken genome sequence (Hillier et al.,
2004) was used to design primers for the amplification of complete
gene coding sequences. Forward and reverse primers included restriction sites,
and reverse primers contained sequences encoding an HA-tag. RhoA-V14 and
RhoA-N19 mutants (Ridley and Hall,
1992) were generated by site directed mutagenesis following
standard protocols. Primer sequences are as follows.
cWnt-11F+Xbal: TCTAGAATGAAGCCGAGCCCGCAATTTTTC;
cWnt-11R+NotI-HA: GCGGCCGCTCAAGCGTAATCTGGAACATCGTATGGGTATTTGCAGACGTATCTCTCGAC;
cWnt-3aF+Xbal: TCTAGAATGAAGTCGTTCTGCAGCGAAG;
cWnt-3aR+SmaI-HA: CCCGGGTCAAGCGTAATCTGGAACATCGTATGGGTATTTGCACGTGTGGACGTCGTAG;
DN-cWnt3aR+NotI-HA: GCGGCCGCTCAAGCGTAATCTGGAACATCGTATGGGTAGCAAAAGTTGGGTGAGTTC.
RhoA-V14: GTCATAGTGGGCGACGTTGCCTGCGGGAAGACC;
RhoA-V14R: GGTCTTCCCGCAGGCAACGTCGCCCACTATGAC;
RhoA-N19: GGTGCCTGCGGGAAGAACTGTCTGCTGATTGTG;
RhoA-N19R: CACAATCAGCAGACAGTTCTTCCCGCAGGCACC.
PCR products were purified, cloned into pGEM-T (Promega) and sub-cloned
into pCAβ. Prior to electroporation, all plasmids were transfected into
HEK293 cells and the expression of proteins was confirmed by western blot and
GFP fluorescence. The generation and functional characterisation of
-Fgfr1-YFP in pEYFP (Clontech) has been described before
(Yang et al., 2002).
For in situ hybridisation, embryos were harvested following imaging and
fixed in 4% paraformaldehyde (PFA) at room temperature. Some embryos were
allowed to develop until they reached HH10 before fixation. In situ
hybridisation was essentially as described before
(Schmidt et al., 2000)
following standard protocols. We amplified probes for Wnt3a, Wnt11 and RhoA by
PCR. Cheryll Tickle provided Fgf8
(Niswander et al., 1994) and
Thomas Schultheiss provided vMHC and Nkx2.5 probes
(Niswander et al., 1994;
Schultheiss et al., 1997).
Sections and immunohistochemistry
For wax and cryosections, embryos were fixed and embedded in OCT
(Tissuetek) or in paraffin, following standard protocols. After sectioning,
GFP was detected using a polyclonal anti-GFP antibody (Abcam, 1:500); myosin
heavy chain was detected using MF20 (1:1000, Developmental Studies Hybridoma
Bank). Secondary antibodies used were anti-rabbit-Alexa488 (green) and
anti-mouse-Alexa568 (red), both at 1:1000 (Molecular Probes).
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
)
(Fig. 1A,B). This enabled us to
follow the movement of individual cells emerging from the primitive streak.
Movement tracks were monitored from HH3 until embryos reached the 6-10 somite
stage (after 20-24 hours). GFP-positive cells were found in lateral plate
mesoderm at HH5 and in the bilateral heart-forming regions at HH7
(Fig. 1C,D), before
contributing to a single heart tube by HH10
(Brand, 2003;
Yutzey and Kirby, 2002)
(Fig. 1E,F).
|
Wnt3a-mediated chemorepulsion guides cardiac progenitor-cell movement
To investigate whether cell movement patterns are governed by signals from
the environment or whether cell behaviour is intrinsically/cell autonomously
regulated, we performed heterochronic grafts. GFP-labelled cells were isolated
from the anterior primitive streak of HH3 embryos and grafted into the
anterior streak of a HH4 host. Prospective cardiac cells grafted into the HH4
anterior primitive streak behaved appropriately for their new environment,
they displayed a narrow migration trajectory and gave rise to paraxial
mesoderm, as described previously (Yang et
al., 2002) (n=11/11). Conversely, HH4 paraxial mesoderm
progenitors grafted into the anterior streak of HH3 host embryos displayed
movement trajectories typical for cardiac progenitors and indistinguishable
from the HH3 homotypic grafts shown (Fig.
1C-F, Fig. 2A,B;
n=11/11, not shown). These experiments demonstrated that cell
movement patterns are established by extrinsic cues.
Wnt3a transcripts are highly expressed in the primitive streak of the chick
gastrula (Fig. 2F)
(Marvin et al., 2001). To
investigate the potential role of Wnt3a in guiding the movement of cells
emerging from the HH3 primitive streak, we implanted pellets of RatB1a
fibroblasts expressing Wnt3a
(Münsterberg et al.,
1995) into the migration path of cardiogenic cells
(Fig. 2H). This dramatically
changed their movement trajectories and, in the majority of embryos, cardiac
progenitors on both sides took a significantly wider path with initially more
pronounced lateral migration before moving towards the midline
(Fig. 2I; see also Movie 2 in
the supplementary material). Many of the GFP-labelled cells remained in
extraembryonic mesoderm or anterior lateral mesoderm and only a few
contributed to the heart (Fig.
2J). In many cases, the two heart fields failed to merge and
cardia bifida was observed at high frequency (75%,
Fig. 2K,L,N). Similar results
were obtained after the electroporation of an expression plasmid for Wnt3a
(pCAβ-Wnt3a-IRES-GFP; Fig.
2O, data not shown), suggesting that Wnt3a is directly
involved.
We previously showed that HH4 primitive streak cells are responsive to
Fgf8, and proposed a model whereby movement trajectories of prospective
paraxial and lateral plate mesoderm cells are governed by Fgf8-mediated
repulsion (Yang et al., 2002).
Fgf8 is expressed at high levels in HH3 primitive streak
(Fig. 2E). As Wnt3a pellets
affected the movement of cardiac progenitors bilaterally and at long range, we
investigated the possibility that Wnt3a caused a global re-patterning of
embryos and ectopic upregulation of Fgf8 transcripts; however, this was not
the case (Fig. 2P).
Next, we examined whether prospective cardiac cells respond directly to
Wnt3a. Small grafts from the anterior primitive streak of HH3 embryos were
cultured on the area opaca (Yang et al.,
2002) and exposed to different Wnt-expressing cells (Wnt1, Wnt3a,
Wnt5a, Wnt7, Wnt11) or to the parental RatB1a-LNCX fibroblasts
(Münsterberg et al.,
1995). In the presence of control cells, GFP-labelled prospective
cardiac cells were highly motile and migrated away from the graft in all
directions (Fig. 3B,C).
However, when challenged with Wnt3a-expressing cells, HH3 primitive streak
cells migrated away from the source of Wnt3a in a highly directed manner
(Fig. 3D, right explant; see
also Movie 3 in the supplementary material). Mesoderm progenitors from HH4
primitive streak did not respond to Wnt3a pellets
(Fig. 3E) but were repelled by
Fgf8, both in vivo and if cultured on the area opaca
(Yang et al., 2002). HH3
prospective cardiac cells were also able to respond to Fgf8 and were repelled
by it (Fig. 3F). We previously
showed that the response of HH4 primitive streak cells to Fgf8 is almost
completely inhibited by misexpressing a dominant-negative Fgf-receptor-EYFP
fusion protein, pFgfr1C-EYFP (Yang
et al., 2002). However, expression of pFgfr1C-EYFP in HH3
cardiac progenitors did not abrogate their response to Wnt3a on the area
opaca, indicating that Fgf receptor activity was not required
(Fig. 3D, left explant). By
contrast, HH3 primitive streak cells expressing a dominant-negative mutant of
Wnt3a (Hoppler et al., 1996),
DN-Wnt3a-IRES-GFP, no longer responded to Wnt3a-expressing cells
(Fig. 3G). However, they were
still motile, possibly due to other signals present within the explant, such
as Fgf8, and behaved like unchallenged controls migrating away from the graft
in all directions.
In addition to Wnt3a, Wnt11-expressing cells repelled prospective cardiac
cells in this ex vivo system (Fig.
3H). However, based on the embryonic expression patterns
of these ligands (Fig. 2F,G)
(Eisenberg et al., 1997;
Skromne and Stern, 2001) Wnt3a
is more likely to provide the endogenous guidance cue. Together, these
experiments raise the possibility that high levels of Wnt3a in the primitive
streak control the movement of cardiac progenitors.
|
).
Surprisingly, neighbouring RFP-labelled cells, not expressing
DN-Wnt3a-IRES-GFP, were only partially rescued
(Fig. 4C). These cells still
moved on a wider trajectory in the presence of ectopic Wnt3a and ended up in
more lateral positions than normal (Fig.
4A,C). This suggests that DN-Wnt3a acts cell-non-autonomously but
may have a limited range or activity. Embryos expressing DN-Wnt3a-IRES-GFP in
the primitive streak had a significantly reduced frequency of cardia bifida in
the presence of ectopic Wnt3a (40%) compared with GFP-expressing embryos in
the presence of ectopic Wnt3a (75%). However, when compared with unchallenged
controls (12.5%) or embryos with a control cell pellet (8.3%), the frequency
of cardia bifida was still increased, consistent with a partial rescue of
cardiac progenitor cell movements by DN-Wnt3a-IRES-GFP
(Fig. 2O).
|
), and
challenged in an ex vivo assay. These cells responded to Wnt3a and were
repelled by it (Fig. 5A). By
contrast, electroporation of a dominant-negative mutant form, RhoA-N19
(Ridley and Hall, 1992),
resulted in motile cells that were no longer able to respond to Wnt3a. These
cells moved away from the explants in all directions and ignored the Wnt3a
cell pellet (Fig. 5B). In vivo,
RhoA-N19-IRES-GFP-expressing cells migrated from the primitive streak and
displayed normal trajectories (data not shown); however, they moved more
slowly than controls and 60% of embryos developed cardia bifida
(Fig. 5D,E). Movement
trajectories of cardiac progenitors expressing RhoA-V14-IRES-GFP were
initially normal. However, during the later phase of migration a proportion of
the cells took a wider path, failed to migrate towards the midline and ended
up either in extra-embryonic regions or remained in the lateral mesoderm
(Fig. 5F,G). Many of these
embryos developed cardia bifida (Fig.
5E). |
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Wnt
signalling has been shown to be involved in axon guidance in the chick optic
tectum and spinal cord, and in Drosophila nervous system development
(Lyuksyutova et al., 2003;
Schmitt et al., 2006;
Yoshikawa et al., 2003).
However, this is the first report implicating Wnts in the chemotactic movement
of individual cells in vertebrate embryos.
We found that cardiogenic cells are repelled by an ectopic source of Wnt3a
in explants cultured on the area opaca
(Fig. 3D). In vivo, this
resulted in aberrant movement trajectories, which led to cardia bifida
(Fig. 2I-L). The response of
cells to Wnt3a was abrogated by the electroporation of DN-Wnt3a or RhoA-N19 in
explants (Fig. 3G,
Fig. 5B), suggesting that RhoA
is an important effector for directional cell movement in response to Wnt3a.
Wnt3a is typically thought to act through β-catenin-dependent mechanisms
to affect cell fate decisions and is implicated in inhibiting cardiogenesis
through this `canonical' pathway (Marvin
et al., 2001; Schneider and
Mercola, 2001; Tzahor and
Lassar, 2001), components of which are expressed in the primitive
streak (Schmidt et al., 2004).
However, our observations are consistent with a report looking at CHO cells in
culture, where it was shown that Wnt3a-dependent cell motility involves
non-canonical signalling through RhoA
(Endo et al., 2005). Moreover,
RhoA has been implicated in midline convergence of organ primordia in
zebrafish (Matsui et al.,
2005), and is upregulated during early heart development in chick
(Kaarbo et al., 2003;
Wei et al., 2001).
Electroporation of DN-Wnt3a restored the movement pattern of cardiac
progenitors in vivo, in the presence of an ectopic source of Wnt3a
(Fig. 4C), and significantly
reduced the incidence of cardia bifida
(Fig. 2O). Interestingly,
RhoA-V14, a constitutively active form of RhoA
(Ridley and Hall, 1992), did
not have a significant effect on the early phases of cardiac progenitor cell
migration, whereas at later stages some cells took a wider path
(Fig. 5F,G). We speculate that
this delayed effect may be due to the fact that at high levels of Wnt3a close
to the streak overexpression of an active form of RhoA had no discernable
effect. In contrast, at lower levels of the repulsive signal, RhoA-V14 caused
a more pronounced outward migration, possibly by sensitising the cells.
Alternatively, it is possible that RhoA-V14 interferes with the response to
another factor responsible for guiding cells back to the midline.
|
). Although we cannot detect any morphological changes of the
ventral foregut in histological sections
(Fig. 2D,L-N), it remains
possible that Wnt3a affects ventral endoderm cells, for example by inhibiting
the expression of a midline attractant. It will be interesting to investigate
this possibility and to characterise any molecular changes using the markers
that are now becoming available (Chapman et
al., 2002). Taken together, we suggest that the cardia bifida
phenotype is due to a more extensive lateral migration, combined with impaired
movement and/or convergence back towards the midline.
Interestingly, cardiac progenitors could also respond to Fgf8 in a manner
similar to paraxial mesoderm and lateral plate mesoderm progenitors that
emerge from the primitive streak at HH4
(Yang et al., 2002)
(Fig. 3F). By contrast, the
response to Wnt3a was specific to HH3 primitive streak cells and did not
require a functional Fgf receptor (Fig.
3D,E). This indicates a dynamically changing signalling
environment and responsiveness of cells, and suggests that Wnt and Fgf, and
possibly other pathways, act in parallel to control the correct movement
behaviour of prospective cardiac cells.
In conclusion, our data supports a model whereby high levels of Wnt3a cause
the repulsion of prospective cardiac cells from the streak resulting in
lateral migration. This is mediated by a pathway, which involves RhoA activity
necessary for directional migration. It will be particularly interesting to
unravel how the different activities of Wnt3a, in both activation
(Naito et al., 2006;
Nakamura et al., 2003;
Ueno et al., 2007;
Vijayaragavan and Bhatia,
2007) and inhibition of cardiogenesis
(Marvin et al., 2001;
Schneider and Mercola, 2001;
Tzahor and Lassar, 2001), as
well as cardiac progenitor cell movements, become integrated through various
downstream signalling effectors.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/6/1029/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: Division of Histology and Embryology, Jinan University
Medical College, Guangzhou, People's Republic of China
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Alvares, L. E., Schubert, F. R., Thorpe, C., Mootoosamy, R. C.,
Cheng, L., Parkyn, G., Lumsden, A. and Dietrich, S. (2003).
Intrinsic, Hox-dependent cues determine the fate of skeletal muscle
precursors. Dev. Cell 5,379
-390.[CrossRef][Medline]
Brand, T. (2003). Heart development: molecular
insights into cardiac specification and early morphogenesis. Dev.
Biol. 258,1
-19.[CrossRef][Medline]
Chapman, S. C., Collignon, J., Schoenwolf, G. C. and Lumsden,
A. (2001). Improved method for chick whole-embryo culture
using a filter paper carrier. Dev. Dyn.
220,284
-289.[CrossRef][Medline]
Chapman, S. C., Schubert, F. R., Schoenwolf, G. C. and Lumsden,
A. (2002). Analysis of spatial and temporal gene expression
patterns in blastula and gastrula stage chick embryos. Dev.
Biol. 245,187
-199.[CrossRef][Medline]
Chuai, M., Zeng, W., Yang, X., Boychenko, V., Glazier, J. A. and
Weijer, C. J. (2006). Cell movement during chick primitive
streak formation. Dev. Biol.
296,137
-149.[CrossRef][Medline]
Cui, C., Yang, X., Chuai, M., Glazier, J. A. and Weijer, C.
J. (2005). Analysis of tissue flow patterns during primitive
streak formation in the chick embryo. Dev. Biol.
284, 37-47.[CrossRef][Medline]
Dormann, D. and Weijer, C. J. (2003).
Chemotactic cell movement during development. Curr. Opin. Genet.
Dev. 13,358
-364.[CrossRef][Medline]
Eisenberg, C. A. and Eisenberg, L. M. (1999).
WNT11 promotes cardiac tissue formation of early mesoderm. Dev.
Dyn. 216,45
-58.[CrossRef][Medline]
Eisenberg, C. A., Gourdie, R. G. and Eisenberg, L. M.
(1997). Wnt-11 is expressed in early avian mesoderm and required
for the differentiation of the quail mesoderm cell line QCE-6.
Development 124,525
-536.[Abstract]
Endo, Y., Wolf, V., Muraiso, K., Kamijo, K., Soon, L., Uren, A.,
Barshishat-Kupper, M. and Rubin, J. S. (2005).
Wnt-3a-dependent cell motility involves RhoA activation and is specifically
regulated by dishevelled-2. J. Biol. Chem.
280,777
-786.
Garcia-Martinez, V. and Schoenwolf, G. C.
(1993). Primitive-streak origin of the cardiovascular system in
avian embryos. Dev. Biol.
159,706
-719.[CrossRef][Medline]
Hamburger, V. and Hamilton, H. L. (1951). A
series of normal stages in the development of the chick embryo. J.
Morphol. 88,49
-92.[CrossRef]
Hatada, Y. and Stern, C. D. (1994). A fate map
of the epiblast of the early chick embryo. Development
120,2879
-2889.[Abstract]
Hillier, L. W., Miller, W., Birney, E., Warren, W., Hardison, R.
C., Ponting, C. P., Bork, P., Burt, D. W., Groenen, M. A., Delany, M. E. et
al. (2004). Sequence and comparative analysis of the chicken
genome provide unique perspectives on vertebrate evolution.
Nature 432,695
-716.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expression of a dominant-negative Wnt blocks induction of
MyoD in Xenopus embryos. Genes Dev.
10,2805
-2817.
Itasaki, N., Bel-Vialar, S. and Krumlauf, R.
(1999). `Shocking' developments in chick embryology:
electroporation and in ovo gene expression. Nat. Cell
Biol. 1,E203
-E207.[CrossRef][Medline]
Kaarbo, M., Crane, D. I. and Murrell, W. G.
(2003). RhoA is highly up-regulated in the process of early heart
development of the chick and important for normal embryogenesis.
Dev. Dyn. 227,35
-47.[CrossRef][Medline]
Kirby, M. L., Lawson, A., Stadt, H. A., Kumiski, D. H., Wallis,
K. T., McCraney, E., Waldo, K. L., Li, Y. X. and Schoenwolf, G. C.
(2003). Hensen's node gives rise to the ventral midline of the
foregut: implications for organizing head and heart development.
Dev. Biol. 253,175
-188.[CrossRef][Medline]
Leslie, N. R., Yang, X., Downes, C. P. and Weijer, C. J.
(2007). PtdIns(3,4,5)P(3)-dependent and -independent roles for
PTEN in the control of cell migration. Curr. Biol.
17,115
-125.[CrossRef][Medline]
Lickert, H., Kutsch, S., Kanzler, B., Tamai, Y., Taketo, M. M.
and Kemler, R. (2002). Formation of multiple hearts in mice
following deletion of beta-catenin in the embryonic endoderm. Dev.
Cell 3,171
-181.[CrossRef][Medline]
Lyuksyutova, A. I., Lu, C. C., Milanesio, N., King, L. A., Guo,
N., Wang, Y., Nathans, J., Tessier-Lavigne, M. and Zou, Y.
(2003). Anterior-posterior guidance of commissural axons by
Wnt-frizzled signaling. Science
302,1984
-1988.
Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M. and
Lassar, A. B. (2001). Inhibition of Wnt activity induces
heart formation from posterior mesoderm. Genes Dev.
15,316
-327.
Matsui, T., Raya, A., Kawakami, Y., Callol-Massot, C.,
Capdevila, J., Rodriguez-Esteban, C. and Izpisua Belmonte, J. C.
(2005). Noncanonical Wnt signaling regulates midline convergence
of organ primordia during zebrafish development. Genes
Dev. 19,164
-175.
Momose, T., Tonegawa, A., Takeuchi, J., Ogawa, H., Umensono, K.
and Yasuda, K. (1999). Efficient targeting of gene expression
in chick embryos by microelectroporation. Dev. Growth
Differ. 41,335
-344.[CrossRef][Medline]
Münsterberg, A. E., Kitajewski, J., Bumcrot, D. A.,
McMahon, A. P. and Lassar, A. B. (1995). Combinatorial
signaling by Sonic hedgehog and Wnt family members induces myogenic bHLH gene
expression in the somite. Genes Dev.
9,2911
-2922.
Naito, A. T., Shiojima, I., Akazawa, H., Hidaka, K., Morisaki,
T., Kikuchi, A. and Komuro, I. (2006). Developmental
stage-specific biphasic roles of Wnt/beta-catenin signaling in
cardiomyogenesis and hematopoiesis. Proc. Natl. Acad. Sci.
USA 103,19812
-19817.
Nakamura, T., Sano, M., Songyang, Z. and Schneider, M. D.
(2003). A Wnt- and beta-catenin-dependent pathway for mammalian
cardiac myogenesis. Proc. Natl. Acad. Sci. USA
100,5834
-5839.
Niswander, L., Jeffrey, S., Martin, G. R. and Tickle, C.
(1994). A positive feedback loop coordinates growth and
patterning in the vertebrate limb. Nature
371,609
-612.[CrossRef][Medline]
Ridley, A. J. and Hall, A. (1992). The small
GTP-binding protein rho regulates the assembly of focal adhesions and actin
stress fibers in response to growth factors. Cell
70,389
-399.[CrossRef][Medline]
Rosenquist, G. C. (1970). Location and
movements of cardiogenic cells in the chick embryo: the heart-forming portion
of the primitive streak. Dev. Biol.
22,461
-475.[CrossRef][Medline]
Schmidt, M., Tanaka, M. and Munsterberg, A.
(2000). Expression of (beta)-catenin in the developing chick
myotome is regulated by myogenic signals. Development
127,4105
-4113.[Abstract]
Schmidt, M., Patterson, M., Farrell, E. and Münsterberg,
A. (2004). Dynamic expression of Lef/Tcf family members and
β-catenin during chick gastrulation, neurulation and early limb
development. Dev. Dyn.
229,703
-707.[CrossRef][Medline]
Schmitt, A. M., Shi, J., Wolf, A. M., Lu, C. C., King, L. A. and
Zou, Y. (2006). Wnt-Ryk signalling mediates medial-lateral
retinotectal topographic mapping. Nature
439, 31-37.[Medline]
Schneider, V. A. and Mercola, M. (2001). Wnt
antagonism initiates cardiogenesis in Xenopus laevis. Genes
Dev. 15,304
-315.
Schultheiss, T. M., Burch, J. B. and Lassar, A. B.
(1997). A role for bone morphogenetic proteins in the induction
of cardiac myogenesis. Genes Dev.
11,451
-462.
Skromne, I. and Stern, C. D. (2001).
Interactions between Wnt and Vg1 signalling pathways initiate primitive streak
formation in the chick embryo. Development
128,2915
-2927.
Stalsberg, H. and DeHaan, R. L. (1969). The
precardiac areas and formation of the tubular heart in the chick embryo.
Dev. Biol. 19,128
-159.[CrossRef][Medline]
Tzahor, E. and Lassar, A. B. (2001). Wnt
signals from the neural tube block ectopic cardiogenesis. Genes
Dev. 15,255
-260.
Ueno, S., Weidinger, G., Osugi, T., Kohn, A. D., Golob, J. L.,
Pabon, L., Reinecke, H., Moon, R. T. and Murry, C. E. (2007).
Biphasic role for Wnt/beta-catenin signaling in cardiac specification in
zebrafish and embryonic stem cells. Proc. Natl. Acad. Sci.
USA 104,9685
-9690.
Vijayaragavan, K. and Bhatia, M. (2007). Early
cardiac development: a Wnt beat away. Proc. Natl. Acad. Sci.
USA 104,9549
-9550.
Wei, L., Roberts, W., Wang, L., Yamada, M., Zhang, S., Zhao, Z.,
Rivkees, S. A., Schwartz, R. J. and Imanaka-Yoshida, K.
(2001). Rho kinases play an obligatory role in vertebrate
embryonic organogenesis. Development
128,2953
-2962.
Yang, X., Dormann, D., Munsterberg, A. E. and Weijer, C. J.
(2002). Cell movement patterns during gastrulation in the chick
are controlled by positive and negative chemotaxis mediated by FGF4 and FGF8.
Dev. Cell 3,425
-437.[CrossRef][Medline]
Yoshikawa, S., McKinnon, R. D., Kokel, M. and Thomas, J. B.
(2003). Wnt-mediated axon guidance via the Drosophila Derailed
receptor. Nature 422,583
-588.[CrossRef][Medline]
Yutzey, K. E. and Kirby, M. L. (2002).
Wherefore heart thou? Embryonic origins of cardiogenic mesoderm.
Dev. Dyn. 223,307
-320.[CrossRef][Medline]
Zamir, E. A., Czirok, A., Cui, C., Little, C. D. and Rongish, B.
J. (2006). Mesodermal cell displacements during avian
gastrulation are due to both individual cell-autonomous and convective tissue
movements. Proc. Natl. Acad. Sci. USA
103,19806
-19811.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  C. J. Weijer Collective cell migration in development J. Cell Sci., September 15, 2009; 122(18): 3215 - 3223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Schlessinger, A. Hall, and N. Tolwinski Wnt signaling pathways meet Rho GTPases Genes & Dev., February 1, 2009; 23(3): 265 - 277. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Yang, H. Chrisman, and C. J. Weijer PDGF signalling controls the migration of mesoderm cells during chick gastrulation by regulating N-cadherin expression Development, November 1, 2008; 135(21): 3521 - 3530. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
500 µm.