|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 February 2008
doi: 10.1242/dev.018150
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Anatomy and Developmental Biology, UCL, Gower Street, London
WC1E 6BT, UK.
2 Institute of Toxicology and Genetics, Forschungszentrum Karlsruhe, Postfach
3640, Karlsruhe, D-76021, Germany.
3 Section of Structural Biology, The Institute of Cancer Research, Chester
Beatty Laboratories, 237 Fulham Road, London, SW3 6JB, UK.
4 Department of Physiology, UCL, Gower Street, London WC1E 6BT, UK.
5 Department of Developmental Biology, Stanford University School of Medicine,
Beckman Center B315, 279 Campus Drive, Stanford, CA 94305-5329, USA.
Author for correspondence (e-mail:
s.wilson{at}ucl.ac.uk)
Accepted 10 January 2008
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
Key words: Chaperones, Myofibrillogenesis, Zebrafish
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
;
Sellers, 2004), how muscle
fibres are triggered to contract and how the sarcomere transduces force
(Cooke, 2004;
Rossi and Dirksen, 2006).
However, despite this depth of knowledge of the structure and biophysics of
the sarcomere and its constituents, our grasp of myofibrillogenesis, the
process by which it takes form, remains surprisingly obscure.
During myofibrillogenesis, the first true sarcomeric components to appear
are Actin filaments (Ehler et al.,
1999; Van der Ven et al.,
1999), which assemble into I-Z-I bodies/brushes, structures
consisting of Z-discs flanked on both sides by Actin filaments
(Schultheiss et al., 1990).
The giant sarcomeric protein Titin integrates onto the nascent sarcomere
around the stage that Z-disc and I-band epitopes are first present
(Fürst et al., 1989). It
is thought that thick filaments are subsequently assembled onto this
scaffold.
The mechanisms by which thick filaments incorporate are controversial and
three models have emerged. The first proposes that thick filaments form
independently from I-Z-I brushes and these two separate sarcomeric components
are integrated to form striated myofibrils
(Holtzer et al., 1997;
Schultheiss et al., 1990). The
second holds that pre-myofibrils are first constructed from non-muscle Myosin,
which is later replaced by muscle Myosin to form functional sarcomeres
(LoRusso et al., 1997;
Rhee et al., 1994;
Sanger et al., 2002). The
third theory proposes that Titin is a scaffold upon which other sarcomeric
components are assembled (Ehler et al.,
1999; Gregorio et al.,
1999; Trinick and
Tskhovrebova, 1999; Van der
Ven et al., 1999). The idea is that the N-terminal portion of
Titin first associates with the Z-disc and I-band (forming I-Z-I brushes).
These complexes are then brought into register, either by the unfolding of the
Titin filament or further translation, and by the association of M-line
components (Fulton and Alftine,
1997; Fulton and L'Ecuyer,
1993). Upon this scaffold, Myosin is then integrated to form the
thick filaments. In support of this model, the M-line region of Titin is
important for myofibrillogenesis
(Gotthardt et al., 2003;
Musa et al., 2006). The
current models of myofibrillogenesis have arisen from studies of cultured
cardiomyocytes and in vivo studies have, to date, added little to help resolve
between them.
The initial formation of I-Z-I brushes is common between the myofibrillogenesis models and the controversy concerns the assembly and alignment of arrays of I-Z-I brushes and the integration of thick filaments into the nascent sarcomeres. Thick filaments are elaborate structures comprising hundreds of Myosin hexamers in precise alignment with each other and other sarcomeric components. Given this inherent complexity, it is perhaps unsurprising that thick filament assembly is not well understood.
Here we describe the cloning of the slothu45 (slou45) mutation and its phenotypic consequences. Zebrafish slou45 embryos show no morphological defects and have a normal heartbeat but lack movement of skeletal muscles. Various analyses reveal that the contractility phenotype is due to a lack of assembly of thick filaments in the nascent sarcomeres of skeletal muscle fibres. Much to our initial surprise, we found that three slo alleles all contain mutations in the hsp90a (hsp90a.1 - ZFIN) gene.
Heat-shock proteins (Hsps) are a group of proteins with transcription that
is induced in response to heat or other cellular stresses. They are molecular
chaperones for huge numbers of proteins and Hsp90 alone may be able to
interact with more than 400 different proteins
(Zhao et al., 2005). Despite
extensive research on Hsps, there has been little work addressing their
developmental roles during vertebrate embryogenesis. Work from C.
elegans has suggested a role for molecular chaperones during thick
filament assembly and integration. The Unc45-/Cro1p-/She4p-related (UCS)
protein Unc45 functions during assembly of thick filaments
(Barral et al., 1998;
Barral et al., 2002;
Etard et al., 2007) and UNC-45
binds stoichiometrically with Hsp90 (Barral
et al., 2002). Our findings extend these studies and show that a
single, developmentally regulated hsp90 gene is necessary for thick
filament assembly and for the construction of functional sarcomeres in
skeletal myofibrils. Our data reveal unexpected specificity in the
developmental role of Hsp90 and raise the possibility that other Hsp genes
might play similarly cell-type-specific roles during vertebrate
embryogenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
), which
recognises all forms of sarcomeric MHC (`pan'-MHC antibody); F59, which is
specific to slow-muscle Myosin isoforms (slow-MHC); anti-Titin (T11; Sigma),
which marks an epitope in the I-band region of Titin
(Fürst et al., 1988).
AlexaFluor-conjugated phalloidin or bungarotoxin (Invitrogen) were applied
after secondary antibodies. For in situ, DIG-labelled antisense riboprobes
were prepared using standard methods from EST constructs (GenBank:
hspa8l, BI710554; hsp90a, CN330912; unc45b,
CN318309;
www.imagenes-bio.de)
or from constructs made in-house.
SDS-PAGE and western blotting
Protein was extracted by homogenisation of deyolked embryos and 10 µg of
protein was separated using 6% polyacrylamide gels, followed by transfer onto
PVDF membrane (Amersham). Myosin antibodies were the same as for
immunohistochemistry; rat anti-Hsp90 (16F1, Abcam) was used for Hsp90; mouse
anti-
-Tubulin (Sigma) was the loading control. Peroxidase activity from
HRP-conjugated secondary antibodies (Sigma) was detected using an ECL
Detection Kit (Amersham).
Electron microscopy
Embryos were fixed in 2% paraformaldehyde, 2% gluteraldehyde in 0.1 M
sodium cacodylate buffer (pH 7.3) with 2-5% CaCl2. Tissue was
post-fixed in cacodylate-buffered 1% (w/v) osmium tetraoxide, en bloc stained
in 2% (w/v) uranyl acetate and embedded in Agar 100 resin (Agar Scientific).
Ultrathin sections (80-100 nm) contrasted with saturated uranyl acetate
solution and lead citrate were examined and photographed using a JEOL1010
electron microscope.
BAC, DNA rescue and morpholino (Mo) injection
One-cell embryos were injected using capillary needles and Picospritzer II
(General Valve) with 10 nl of BAC DNA (RZPD/CHORI; see Table S2 in the
supplementary material) made using a BAC Kit (PSI Clone). Full-length u45
mutant and wild-type hsp90a were amplified by RT-PCR, cloned into the
TOPO vector (Invitrogen) and subcloned by PCR into pCS2myc+. One hundred to
two hundred pg of SacII-linearised constructs were injected. Mo
sequences were (5'-3'): hsp90a,
CCGACTTCTCAGGCATCTTGCTGTG; hsp90a2, TCGAGTGGTTTATTCTGAGAGTTTC
(produced secondary phenotypes) or CTGCTGCTCGTGAGCCTCAGGCATC (GeneTools).
2±0.5 pmoles was injected per embryo.
Microarray analysis
Total RNA was extracted using TRIzol (Invitrogen) from pooled
slou45 and wild-type embryos. RNA and microarray
processing was carried out at the ICH Gene Microarray Centre (Institute of
Child Health, London) according to standard methods. The MAS5 algorithm
(Affymetrix) was used to compare wild type and slou45
mutants. Genes designated as showing no change in expression or where
expression was designated as absent in both wild type and mutant were
eliminated. The data were then split into two groups: genes with a
slo versus wild-type signal log ratio of between 0.6 and 1 or between
-0.6 and -1 (1.5- to 2-fold up- or downregulated) and genes showing a signal
log ratio greater than +1 or -1 (greater than 2-fold up- or downregulation).
These groups were further sorted into genes absent in wild type or
slo mutants and those increased and decreased in slo mutants
(see Table S3 in the supplementary material).
Quantitative PCR (qPCR)
The following cDNA-specific primers (5'-3') were used for qPCR:
hsp90a forward (F), CCACCTTAAAGAGGATCAGTCT and reverse (R),
TCTTCCTCTTATTCTTGCCAT; hsp90a2 F, GCGGCGGATCAAAGAGATC and R,
CACTTATCGCCATGATCGTG. cDNA was produced using Superscript II reverse
transcriptase (Invitrogen) and 1 µg of quality-checked total RNA extracted
using TRIzol from pools of ten mutants and ten wild-type siblings. Triplicate
qPCR reactions were carried out with blank controls and five standards. Copy
number was determined by reference to standards normalised to a standard curve
(ten triplicate 4-fold dilutions); copy number values were normalised to 1
µg of total RNA and significance determined by Student's
t-test.
Isothermal titration calorimetry, Kd determinations and Hsp90 ATPase assay
The heat of interaction was measured on a MSC System (Microcal), with a
cell volume of 1.458 ml, in 20 mM Tris (pH 7.5), 1 mM EDTA, 5 mM NaCl, 7 mM
MgCl2 at 30°C. Twenty 14.5 µl aliquots of 1 mM AMPNP were
injected into 50 µM yeast Hsp90, human HSP90
or mutant protein. The
heat of dilution was determined in a separate experiment by diluting protein
into buffer, and the corrected data fitted using a non-linear least square
curve-fitting algorithm (Microcal Origin) with three floating variables:
stoichiometry, binding constant and change in enthalpy of interaction. ATPase
activity of purified mutated and normal yeast and human Hsp90 protein was
measured as described previously
(Panaretou et al., 1998).
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
) and we
therefore renamed the novel mutation slou45.slo mutants
lack spontaneous or stimulus-evoked skeletal muscle contractility but have a
normal heartbeat. There is some variability in phenotype between alleles and
although no movement is observed in the trunk of homozygous
slou45 embryos, the fins of a minority of
slou45 mutants show very slight twitching from 4 dpf. By
contrast, around 30% of slotu44c and
slotm201 mutants show limited trunk movements at 24 hours
post-fertilisation (hpf) that disappear by 48 hpf; by 4 dpf there is
substantial, though still compromised, fin movement. Transheterozygotes
(slou45/tu44c, slou45/tm201 or
slotu44c/tm201) resemble the slotu44c
and slotm201 phenotype, showing some trunk movement at 24
hpf and more vigorous fin twitching later (compared with
slou45). These results suggest that u45, tu44c and tm201
are mutations in the same gene and that u45 is the most severe allele. The two most likely causes of the slo phenotype are defective innervation of muscle fibres and/or a defective contractile response of the muscle fibres to innervation. Examination of muscle innervation and calcium transients within muscle fibres revealed only minor differences between slou45 mutants and wild types (see Fig. S1 and Table S1 in the supplementary material). The absence of neuronal or excitation-coupling problems suggested a defect intrinsic to the muscle fibres. This was corroborated by polarised microscopy, mosaic labelling and cell transplantation experiments which showed that slou45 mutants had abnormally wavy muscle fibres that totally lacked birefringence (see Fig. S1 in the supplementary material). This strongly suggested a defect intrinsic to the contractile apparatus of the muscle fibres.
|
-Actinin, capping proteins and other molecules. Double staining for
Z-discs and Actin filaments in siblings revealed evenly spaced Z-discs in
register between neighbouring fibrils and even between adjacent fibres
(Fig. 1C).
slou45 myofibrils lacked such regimented organisation
(Fig. 1D). Much of the
anti-Actinin staining was dispersed in the cytoplasm, although small
structures resembling Z-discs surrounded by Actin were present. However, these
mutant `Z-discs' were neither appropriately spaced nor in register. The
sarcomeric organisation of Titin evident in siblings was absent in
slou45 mutants (Fig.
1E,F), and although some Titin-positive puncta were present in the
slou45 mutants, they showed little evidence of
organisation. Anti-MHC immunoreactivity was considerably reduced in slou45 mutants. Unlike in siblings, the muscle of slou45 mutants lacked strong anti-MHC labelling, with no signs of striations in register between neighbouring fibres (Fig. 1G-J). Consistent with its less severe movement phenotype, MHC immunohistochemistry in the tu44c allele revealed short lengths of striation (see Fig. S2A,B in the supplementary material).
Western blots showed that MHC was almost completely absent from lysates of slo mutants at 30 hpf, when myofibrils are initially forming. By 48 hpf, when the majority of muscle fibres contain mature fibrils, Myosin levels had increased slightly in slo mutants although not near to levels in sibling lysates (F59, Fig. 1K; A4.1025, data not shown). These results suggest that either thick filaments are not formed because of a lack of Myosin, or that Myosin is degraded because thick filaments do not form correctly.
|
In less mature caudal myotomes of wild-type 24 hpf embryos, myofibrils were rare and those present were very immature. Z-discs were small in diameter and poorly aligned, thick and thin filaments were present but were few in number and were not yet organised into A and I bands (Fig. 2A). Structures resembling myofibrils were essentially absent from slou45 mutants (Fig. 2B). Where a presumptive nascent sarcomere could be found, it comprised small aggregations of thin filaments sometimes associated with densities (putative Z-discs).
|
By 48 hpf, wild-type myofibres contained multiple highly organised
myofibrils with Z-discs in register, whereas slou45
myofibres contained only disorganised I-Z-I brushes
(Fig. 2E,F). These were often
found in groups with the Z-discs only partially in register with their
neighbours and the distance between consecutive I-Z-I brushes was also highly
variable. Thick filaments were absent from slou45
myofibrils. Either side of the Z-disc was an electron-dense area, 100-200 nm
wide, within which the bundle of I-band thin filaments retained the same
height as the Z-disc. Beyond this region, the bundles of thin filaments were
slightly striated and narrower than the diameter of the Z-disc
(Fig. 2G,H). The periodicity of
the striations was approximately 30 nm, suggesting that they could be Troponin
complexes that would normally interact with Myosin heads
(Chun and Falkenthal,
1988).
The ultrastructural appearance of slotu44c muscle was broadly similar to slou45 mutants, with I-Z-I brushes lacking thick filaments. However, the I-Z-I brushes were more regularly spaced and aligned with short disorganised fibrous aggregations of electron-dense material between I-Z-I brushes (see Fig. S2 in the supplementary material). It is probable that these aggregates correspond to the striations seen with MHC immunohistochemistry.
The heart of slou45 mutants functions normally and, unsurprisingly, the ultrastructure of the heart muscle was indistinguishable between slou45 mutants and siblings (see Fig. S3 in the supplementary material).
These ultrastructural observations (summarised in Fig. 2I) reveal that the cause of the slo phenotype is a failure to assemble and integrate thick filaments into the nascent sarcomeres of myofibrils. Actin (thin) filaments and Z-lines (containing Actinin) are present, as is the excitation-coupling apparatus of T-tubules and sarcoplasmic reticulum. However, I-Z-I brushes fail to align and they lack regular spacing. The lack of aligned thick filaments underlies the birefringence deficiency and lack of organisation observed in the Myosin immunohistochemistry. Therefore, the Slo protein is not required to form a Z-disc and to assemble Actin fibres, Actinin and probably other sarcomeric proteins, but is required for assembly and integration of thick filaments.
slo mutations are in the hsp90a gene
Genetic mapping using SSLP markers placed the slo locus on LG20
(see Fig. S4 in the supplementary material). Bespoke SNP markers for genes in
this region showed tight linkage to hsp90a, which is immediately
adjacent to hsp90a2 (hsp90a.2 - ZFIN). Sequencing of these
genes from the three mutant slo alleles revealed mutations in
hsp90a (Fig. 3A and
see Fig. S4 in the supplementary material). A guanine to adenine point
mutation is present in exon 3 in slou45 mutants, causing a
glycine to aspartic acid change in residue 94. In exon 9 of
slotu44c and exon 10 of slotm201,
there are point mutations that respectively change tyrosine 561 and tryptophan
599 to stop codons. No mutations were found in hsp90a2 coding
sequence in any slo allele.
The nonsense slotu44c and slotm201
mutations would result in truncated molecules missing the C-terminal domain,
which is important for both homo- and heterodimerisation
(Ali et al., 2006); such
truncations would have severe functional consequences for the molecule.
The molecular consequence of the slou45 missense
mutation was initially less obvious, but bioinformatic analysis and further
experiments demonstrated that it abrogates the ATPase function of the Hsp90a
protein. The N-terminal region of Hsp90 harbouring the mutation is required
for ATP hydrolysis (Panaretou et al.,
1998), and a ClustalW alignment of available Hsp90a sequences
demonstrated the glycine mutated in slou45 to be
universally conserved (see Fig. S5 in the supplementary material). To predict
the functional consequences of the Gly to Asp change, we assessed its probable
consequence on the protein structure of yeast Hsp90, for which the
crystallographic structure was available
(Ali et al., 2006)
(Fig. 3B). The C- atom
of Gly83 sits in a confined space that is 3.4 Å from the hydroxyl of
Ser138, 3.8 Å from the main-chain carbonyl of Lys139, 3.9 Å from
the main-chain carbonyl of Gly170, and 4.4 and 4.8 Å from the main-chain
amides of Gly170 and Lys139, respectively
(Fig. 3B). The large side-chain
of an aspartic acid residue would not be easily accommodated and would disrupt
the local folding of the protein. As the glycine is involved in critical
interactions with bound ATP/ADP, it is highly likely that the side-chain
change would severely affect the ability of mutant Hsp90 to bind
nucleotide.
To test directly whether a Gly to Asp mutation at this site affects ATPase
function, we recapitulated the mutation in yeast and human forms and tested
their ATPase and ATP-binding properties in vitro. The mutations completely
abrogated the ability of these molecules to hydrolyse ATP
(Fig. 3C). Binding between the
ATP analogue AMPPNP and mutant yeast and human Hsp90 was also negligible (see
Fig. S6 in the supplementary material). Functional ATPase activity is
essential for chaperoning by Hsp90
(Panaretou et al., 1998;
Pearl and Prodromou, 2006).
The slou45 mutation is therefore catastrophic for the
function of zebrafish Hsp90a as a chaperone.
The slo phenotype is rescued by exogenous Hsp90a
To confirm that the mutations identified above were indeed the cause of the
muscle defects in slo mutants, we attempted to rescue the phenotype.
Several BACs that covered the genomic region (see Fig. S4, and also Table S2
for clone names, in the supplementary material) were injected into batches of
embryos from crosses of slou45 or
slotu44c heterozygotes. At 3 dpf, injected embryos showed
normal movement, partial movement or paralysis
(Table 1 and see Movie 2 in the
supplementary material). Examination of muscles from partially moving embryos
with polarised light revealed a mosaic pattern of birefringence in the
myotomes (see Fig. S4 in the supplementary material), indicating that some
cells, most likely those containing mosaically inherited BAC DNA, had
functional myofibrillar assemblies. Although hsp90a and
hsp90a2 are separated by only 2 kb, we found two BACs (8 and 9) with
ends in this 2 kb region facing in opposite directions, thus separating the
two genes. Injection of BAC 9 (hsp90a only) produced mosaically
rescued embryos, as expected. Surprisingly, BAC 8 (hsp90a2 only) also
rescued some embryos (Table 1),
albeit less efficiently, suggesting that exogenous Hsp90a2 can partially
compensate for loss of Hsp90a.
|
)]. The slou45 allele is a missense mutation and, despite our study of the yeast and human mutant proteins, we could not be certain (1) that it is an amorphic (or weakly antimorphic) mutation in the zebrafish and (2) that the mutation is responsible for the lack of thick filaments. Therefore, to determine if the mutant protein has any residual activity in myofibrillogenesis, we assayed whether exogenous mutant protein could rescue movement and thick filament generation. Constructs encoding N-terminal myc-tagged wild-type (myc:WThsp90a) and u45 mutant (myc:u45Hsp90a) Hsp90a were injected into slou45 mutants. Only the myc:WThsp90a construct rescued movement in slou45 mutants. Mosaically distributed myc:WTHsp90a-expressing muscle cells in slou45 mutants possessed apparently normal levels of organised Myosin and resembled wild-type muscle fibres transplanted into slou45 embryos (Fig. 4A-D and see Fig. S1K in the supplementary material), indicating a rescue of thick filament formation. Muscle cells in slou45 mutants expressing the myc:u45Hsp90a protein had neither higher levels of Myosin immunoreactivity nor organisation in the Myosin present at low level (Fig. 4F). Sibling muscle fibres expressing myc:u45hsp90a retained the ability to express Myosin in orderly myofibrils, suggesting that the u45 mutant Hsp90a does not have detectable antimorphic activity (Fig. 4E).
|
hsp90a and genes encoding proteins that may interact with Hsp90a to mediate sarcomere assembly are upregulated in slo mutants
Using Affymetrix arrays, we compared mRNA expression profiles of wild-type
and slou45 embryos (see Tables S3, S4 in the supplementary
material). Amongst the genes with lowered levels of expression were several
encoding sarcomeric proteins, including Myosin light chains, Titin and
Troponins. Notably, several genes encoding heat-shock proteins and factors
that interact with heat-shock proteins were upregulated. hspa8l and a
similar gene homologous to human HSPA1A/HSPA1B showed the
largest slou45 versus wild-type differences, with 150- to
160-fold upregulation in mutants. Both hsp90a and unc45b, a
gene proposed to interact with Hsp90 during myofibrillogenesis
(Barral et al., 2002;
Etard et al., 2007), were
4-fold upregulated in mutants. For selected genes, in situ hybridisation (ISH)
analysis corroborated the expression changes found using the microarray.
hspa8l was massively upregulated in the myotomes of both
slou45 and slotu44c mutants
(Fig. 5A-C), whereas both
unc45b and hsp90a showed more modest increases in ISH signal
in slou45 mutants (Fig.
5D-I). In surprising contrast to the upregulation of
hsp90a in slou45 embryos and hsp90a
morphants (see Fig. S8 in the supplementary material), hsp90a
transcript levels were reduced in slotu44c mutants (for
which no microarray analysis was carried out), despite upregulation of both
unc45b and hspa8l in the morphant and both mutant alleles
(Fig. 5C,F,I and see Fig. S8 in
the supplementary material). Complementing the changes at the mRNA level,
western blot analysis revealed that Hsp90 protein levels were increased in
slou45 mutants and decreased in
slotu44c mutants when compared with siblings
(Fig. 5J).
In summation, these results show that when Hsp90a function is compromised, as in slou45 mutants, levels of transcription of genes encoding certain sarcomeric proteins are reduced, whereas expression levels of genes that encode several chaperone and co-chaperone proteins (hspa8l, hsp90a, unc45b and others) are upregulated (with the allele-specific exception of hsp90a in slotu44c mutants).
Hsp90a2 has no role in myofibrillogenesis
Our data have revealed a requirement for hsp90a in
myofibrillogenesis, but not for its neighbouring hsp90a2 gene. The
reasons why hsp90a2 appears to have little or no role in muscle were
not clear and so we designed experiments to assess expression of
hsp90a2 and further explore its function (or lack of function). ISH
analysis suggests that, like hsp90a, hsp90a2 is expressed in muscle
tissue but expression levels are low (data not shown)
(Etard et al., 2007). However,
as expression was low and to strengthen these data, quantitative RT-PCR (qPCR)
was performed to examine the differences in levels of mRNA for hsp90a
and hsp90a2 in wild-type and slo embryos (u45 and tu44c
alleles).
hsp90a expression levels were significantly increased in
slou45 mutants compared with siblings
(Fig. 5K), whereas expression
levels of hsp90a2 were unaffected by either mutation
(Fig. 5L). This indicates that
although the genes are adjacent to each other, they are subject to
differential transcriptional regulation. This conclusion is supported by
analysis of the absolute levels of transcription of the two genes in wild-type
embryos, with hsp90a expression nearly eight times that of
hsp90a2 (Fig. 5K,L;
see Fig. S7 in the supplementary material). This offers a likely explanation
for why endogenous hsp90a2 does not compensate for mutations in
hsp90a. Presumably, the low expression level of hsp90a2 that
fails to be upregulated as a consequence of mutation in hsp90a means
that there is very little Hsp90a2 activity in developing muscle of either
wild-type or slo embryos. By contrast, the expression level of
hsp90a2 following BAC injection is presumably sufficiently high to
mediate partial rescue. Supporting the conclusion that hsp90a2 has no
role in muscle development, hsp90a2 morphants show normal
birefringence of muscle fibres and fail to upregulate hsp90a, unc45b
or hspa8l, and the phenotype of hsp90a/hsp90a2 double
morphants is no more severe than that of hsp90a and hsp90a2
single mutants/morphants [see Fig. S8 in the supplementary material and Etard
et al. (Etard et al.,
2007)].
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
).
Moreover, structural and functional analysis of the u45 mutation indicate that
it is the ATPase-dependent chaperoning activity of Hsp90 that is important for
thick filament formation and integration.
|
|
The developmental requirement for hsp90a is restricted to skeletal muscle cells |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
Two possible explanations for the specificity of the hsp90a mutant
phenotype are either that skeletal muscle is the only embryonic cell type to
require Hsp90 activity, or that other hsp90 genes function in other
developing cells. In favour of a specific requirement in skeletal muscle
cells, construction of the myofibrillar apparatus is an enormous challenge to
the machinery of the cell, and muscle cells probably have the greatest load of
any developing cell type in terms of protein folding and construction of
multimeric protein complexes. To build a sarcomere requires balancing of the
transcription, translation and folding of proteins and their incorporation
into reiterative sarcomeric units. In this context, the demands upon protein
chaperones will be high so Hsp90a might have been recruited for this specific
developmental role. Additionally, given the large numbers of Hsp genes, it is
almost certain that others will have developmental roles. With respect to
hsp90a genes, in zebrafish there are at least three - hsp90a,
hsp90a2 and hsp90ab1 (formerly hsp90b)
(Krone et al., 1997) - raising
the possibility that different paralogues function in different developmental
events.
Hsp90a may co-operate with Unc45 in the chaperoning of Myosin during myofibril assembly
Hsp90s are well-characterised molecular chaperones with diverse and
wide-ranging roles in cellular physiology
(Pearl and Prodromou, 2006).
The current hypothesis for the chaperoning role of the Hsp90 homodimer is that
the N-terminus ATPase domain flexes upon binding of ATP and this facilitates
the maturation of client proteins (Ali et
al., 2006; Pearl and
Prodromou, 2006).
Although this hypothesis suggests how Hsp90 chaperones, it does not explain
how client specificity is managed (Pearl
and Prodromou, 2006). Unlike many chaperones, Hsp90 shows much
specificity for the proteins it binds, although these client proteins are very
diverse and may number over 400 (Zhao et
al., 2005). With this specific, yet potentially wide-ranging
network of interactions, it is perhaps all the more surprising that
slo mutants only show defective skeletal thick filament formation. By
what mechanisms might Hsp90a specifically act to chaperone Myosin during thick
filament formation?
Substrate-specific binding sites in the middle domain of the Hsp90
molecule, in addition to recruitment of various co-chaperone molecules, may
contribute to the client specificity of the chaperoning activity
(Pearl and Prodromou, 2006).
Included among co-chaperones is the UCS-factor Unc45, identified through a
C. elegans screen as being required for muscle development
(Barral et al., 1998;
Venolia et al., 1999). These
studies led to the proposition that Unc45 acts in concert with Hsp90 to
chaperone Myosin. In a recent study Etard et al. demonstrated that the
steif zebrafish motility mutant is due to mutations in the
unc45b gene and that Steif/Unc45b binds Hsp90
(Etard et al., 2007). These
results point to a highly conserved mechanism whereby Unc45 provides
specificity with Hsp90 for chaperoning Myosin during myofibrillogenesis.
The regulation of hsp90a during skeletal muscle development is likely to be independent of the normal heat-shock response pathway
During the course of our studies, we made several observations regarding
the regulation of mRNAs and proteins in wild-type and slo muscles: we
find that hsp90a is strongly expressed in wild-type skeletal muscle;
that both hsp90a mRNA and Hsp90 protein and hspa8l and
unc45 mRNA levels are increased in slou45 mutants
whereas hsp90a2 is not; that hsp90a mRNA is not upregulated
and Hsp90 protein levels are lower in slotu44c mutants;
that Myosin protein levels are severely reduced in slou45
mutants; and that genes encoding several sarcomeric proteins are downregulated
in slou45 mutants. Do these observations make sense and
shed any light on the transcriptional and post-translational mechanisms that
operate during sarcomere assembly?
There are two obvious possibilities to explain the strong tissue-specific expression of hsp90a during normal skeletal muscle development. The first is that the stress levels that occur in developing myofibres induce the `heat-shock response', a well-established trigger for upregulation of hsp90 transcription. The second is that the high-level expression of hsp90a in skeletal muscle cells is developmentally regulated, independent of the heat-shock regulation of hsp90a transcription. We favour this second possibility as our data suggest that the heat-shock response is not triggered during normal muscle development, whereas it is triggered in slo mutant muscle cells.
A well-established signature for reduced Hsp90 function is the upregulation
of hsp90- and hsp70-related genes and the ubiquitination and
proteosome-mediated destruction of Hsp90 client proteins
(Proisy et al., 2006). In such
situations, it is thought that the depletion of Hsp90 (through
cellular-stress-induced client binding, mutations or for other reasons) frees
the transcription factor Hsf (Heat shock factor), which triggers the
heat-shock response through upregulation of various Hsp genes. Thus, the
upregulation of chaperone genes and depletion of client proteins (Myosin) in
slo mutants are entirely consistent with the muscle cells mounting a
stress response owing to loss of Hsp90a function.
In contrast to the situation in slo mutants, there is no
indication that the expression of hsp90a during normal development is
a direct consequence of the cell mounting a stress response. Perhaps most
notably, hspa8l expression is virtually undetectable in wild-type
developing muscle in contrast to slo mutant muscle. Thus, it seems
much more likely that an alternative, developmentally regulated
transcriptional mechanism leads to upregulation of hsp90a during
normal myogenesis. This would, in principle, not be difficult to achieve as
various muscle-specific transcription factors are active during the period of
myofibrillogenesis (Hinits and Hughes,
2007).
The reduction in Myosin protein levels in slou45 and
slotu44c mutants could be explained by the
well-established proteasome-mediated degradation of Hsp90 client proteins in
the absence of Hsp90 function (Blagg and
Kerr, 2006). We have no explanation for the reduced transcription
of other genes involved in myofibrillogenesis, although this suggests a
feedback mechanism balancing transcription levels with the translation and
further processing of sarcomeric proteins.
It is curious that slotu44c mutants show upregulation of unc45 and hspa8l, but not hsp90a itself. The fact that tu44c is a nonsense mutation might lead to nonsense-mediated mRNA decay and, if this happens, to a lowering of transcript and protein levels. However, it does not seem likely that mRNA decay would completely mask the strong constitutive expression that should be induced by the stress response. The milder phenotype of slotu44c and slou45/tu44c mutants suggests that some translation does occur and that the Slotu44c Hsp90a protein retains some function, presumably in its N-terminal portion. It might still retain the ability to sequester Hsf and hence a milder stress response may be mounted in the mutant muscle cells. However, this does not really explain why unc45 and hspa8l respond similarly in both mutant alleles. Finally, one should also consider that the truncated Hsp90tu44c protein might in some unknown way suppress the hsp90a transcriptional upregulation response.
It is also curious that despite being located adjacent to hsp90a, hsp90a2 is subject to different transcriptional regulation and has no obvious role in muscle formation. Given their proximity and similarity in sequence, it seems likely that the two genes arose through a tandem duplication event. hsp90a2 still encodes a functional protein and so it must retain a function in zebrafish, although this might not be evident during embryogenesis.
Implications for myofibrillogenesis models
How do our data impact upon the three current models of myofibrillogenesis
outlined in the introduction? The core of all three models is a sequential
deposition of the myofibrillar components from Z-line to M-line, with I-Z-I
brushes forming first, followed by the integration of thick filaments to
complete sarcomeric assembly. Our data support the notion that I-Z-I brushes
form first, but that these do not align or become properly spaced in
slo mutants leaving no well-structured scaffold onto which thick
filaments can integrate. Thus, our data suggest a more active role for the
assembly and integration of thick filaments in the linking together, alignment
and spacing of Z-discs during sarcomere maturation.
Both Sanger's model (Sanger et al.,
2002) and the `Titin' model
(Trinick and Tskhovrebova,
1999) of myofibrillogenesis suggest that a well-formed scaffold of
I-Z-I brushes is established prior to thick filament integration, with either
non-muscle Myosin or Titin fulfilling the role of linking the I-Z-I brushes.
In both cases, the lack of assembly and integration of thick filaments should
not significantly impact upon the construction of the sarcomeric scaffold. In
slou45 mutants, scaffold formation is compromised as I-Z-I
brushes do not properly align, are not correctly spaced and probably do not
correctly lace up with adjacent I-Z-I brushes. This suggests either that
Hsp90a has unsuspected roles in the assembly of non-muscle Myosin or Titin, or
that the models might need some revision. Indeed, Titin immunohistochemistry
in slou45 mutants suggests that the molecule is not even
correctly integrated into the I-Z-I brushes that are present, raising the
possibility that sarcomeric Titin integration might lie parallel to, or even
downstream of, thick filament assembly and integration. The third model of
myofibrillogenesis (Ehler et al.,
1999) holds that I-Z-I brushes are loaded with thick filaments at
specific cellular locations and subsequently assembled into full sarcomeres.
The slou45 phenotype is not inconsistent with this idea,
but neither does it provide strong support.
The mutants described in this and related papers enhance our understanding of myofibrillogenesis through study of the process in vivo. We are hopeful that further genetic studies of sarcomere formation will refine existing models and help build a more complete picture of myofibrillogenesis.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/6/1147/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: School of Biological and Chemical Sciences, Queen Mary
University of London, London E1 4NS, UK
Present address: National Human Genome Research Center, National Institutes
of Health, Building 50, Room 5537, 50 South Drive, Bethesda, MD 20892-8004,
USA
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONThe developmental requirement...REFERENCES |
|---|
Ali, M. M., Roe, S. M., Vaughan, C. K., Meyer, P., Panaretou, B., Piper, P. W., Prodromou, C. and Pearl, L. H. (2006). Crystal structure of an Hsp90-nucleotide-p23/Sba1 closed chaperone complex. Nature 440,1013 -1017.[CrossRef][Medline]
Barral, J. M., Bauer, C. C., Ortiz, I. and Epstein, H. F.
(1998). Unc-45 mutations in Caenorhabditis elegans implicate a
CRO1/She4p-like domain in myosin assembly. J. Cell
Biol. 143,1215
-1225.
Barral, J. M., Hutagalung, A. H., Brinker, A., Hartl, F. U. and
Epstein, H. F. (2002). Role of the myosin assembly protein
UNC-45 as a molecular chaperone for myosin. Science
295,669
-671.
Blagg, B. S. and Kerr, T. D. (2006). Hsp90 inhibitors: small molecules that transform the Hsp90 protein folding machinery into a catalyst for protein degradation. Med. Res. Rev. 26,310 -338.[CrossRef][Medline]
Chun, M. and Falkenthal, S. (1988). Ifm(2)2 is
a myosin heavy chain allele that disrupts myofibrillar assembly only in the
indirect flight muscle of Drosophila melanogaster. J. Cell
Biol. 107,2613
-2621.
Clark, K. A., McElhinny, A. S., Beckerle, M. C. and Gregorio, C. C. (2002). STRIATED MUSCLE CYTOARCHITECTURE: an intricate web of form and function. Annu. Rev. Cell Dev. Biol. 18,637 -706.[CrossRef][Medline]
Cooke, R. (2004). The sliding filament model:
1972-2004. J. Gen. Physiol.
123,643
-656.
Dan-Goor, M., Silberstein, L., Kessel, M. and Muhlrad, A. (1990). Localization of epitopes and functional effects of two novel monoclonal antibodies against skeletal muscle myosin. J. Muscle Res. Cell Motil. 11,216 -226.[CrossRef][Medline]
Ehler, E., Rothen, B. M., Hammerle, S. P., Komiyama, M. and Perriard, J. C. (1999). Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M-line and the thick filaments. J. Cell Sci. 112,1529 -1539.[Abstract]
Etard, C., Behra, M., Fischer, N., Hutcheson, D., Geisler, R. and Strahle, U. (2007). The UCS factor Steif/Unc-45b interacts with the heat shock protein Hsp90a during myofibrillogenesis. Dev. Biol. 308,133 -143.[CrossRef][Medline]
Fulton, A. B. and L'Ecuyer, T. (1993). Cotranslational assembly of some cytoskeletal proteins: implications and prospects. J. Cell Sci. 105,867 -871.[Medline]
Fulton, A. B. and Alftine, C. (1997). Organization of protein and mRNA for titin and other myofibril components during myofibrillogenesis in cultured chicken skeletal muscle. Cell Struct. Funct. 22,51 -58.[Medline]
Fürst, D. O., Osborn, M., Nave, R. and Weber, K. (1988). The organization of titin filaments in the half-sarcomere revealed by monoclonal antibodies in immunoelectron microscopy: a map of ten nonrepetitive epitopes starting at the Z line extends close to the M line. J. Cell Biol. 106,156 3-1572.
Fürst, D. O., Osborn, M. and Weber, K.
(1989). Myogenesis in the mouse embryo: differential onset of
expression of myogenic proteins and the involvement of titin in myofibril
assembly. J. Cell Biol.
109,517
-527.
Gotthardt, M., Hammer, R. E., Hubner, N., Monti, J., Witt, C.
C., McNabb, M., Richardson, J. A., Granzier, H., Labeit, S. and Herz, J.
(2003). Conditional expression of mutant M-line titins results in
cardiomyopathy with altered sarcomere structure. J. Biol.
Chem. 278,6059
-6065.
Granato, M., van Eeden, F. J., Schach, U., Trowe, T., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J. et al. (1996). Genes controlling and mediating locomotion behavior of the zebrafish embryo and larva. Development 123,399 -413.[Abstract]
Gregorio, C. C., Granzier, H., Sorimachi, H. and Labeit, S. (1999). Muscle assembly: a titanic achievement? Curr. Opin. Cell Biol. 11,18 -25.[CrossRef][Medline]
Hinits, Y. and Hughes, S. M. (2007). Mef2s are
required for thick filament formation in nascent muscle fibres.
Development 134,2511
-2519.
Holtzer, H., Hijikata, T., Lin, Z. X., Zhang, Z. Q., Holtzer, S., Protasi, F., Franzini-Armstrong, C. and Sweeney, H. L. (1997). Independent assembly of 1.6 microns long bipolar MHC filaments and I-Z-I bodies. Cell Struct. Funct. 22, 83-93.[Medline]
Krone, P. H., Lele, Z. and Sass, J. B. (1997). Heat shock genes and the heat shock response in zebrafish embryos. Biochem. Cell Biol. 75,487 -497.[CrossRef][Medline]
LoRusso, S. M., Rhee, D., Sanger, J. M. and Sanger, J. W. (1997). Premyofibrils in spreading adult cardiomyocytes in tissue culture: evidence for reexpression of the embryonic program for myofibrillogenesis in adult cells. Cell Motil. Cytoskeleton 37,183 -198.[CrossRef][Medline]
Musa, H., Meek, S., Gautel, M., Peddie, D., Smith, A. J. and
Peckham, M. (2006). Targeted homozygous deletion of M-band
titin in cardiomyocytes prevents sarcomere formation. J. Cell
Sci. 119,4322
-4331.
Panaretou, B., Prodromou, C., Roe, S. M., O'Brien, R., Ladbury, J. E., Piper, P. W. and Pearl, L. H. (1998). ATP binding and hydrolysis are essential to the function of the Hsp90 molecular chaperone in vivo. EMBO J. 17,4829 -4836.[CrossRef][Medline]
Pearl, L. H. and Prodromou, C. (2006). Structure and mechanism of the hsp90 molecular chaperone machinery. Annu. Rev. Biochem. 75,271 -294.[CrossRef][Medline]
Proisy, N., Sharp, S. Y., Boxall, K., Connelly, S., Roe, S. M., Prodromou, C., Slawin, A. M., Pearl, L. H., Workman, P. and Moody, C. J. (2006). Inhibition of hsp90 with synthetic macrolactones: synthesis and structural and biological evaluation of ring and conformational analogs of radicicol. Chem. Biol. 13,1203 -1215.[CrossRef][Medline]
Rhee, D., Sanger, J. M. and Sanger, J. W. (1994). The premyofibril: evidence for its role in myofibrillogenesis. Cell Motil. Cytoskeleton 28, 1-24.[Medline]
Rossi, A. E. and Dirksen, R. T. (2006). Sarcoplasmic reticulum: the dynamic calcium governor of muscle. Muscle Nerve 33,715 -731.[CrossRef][Medline]
Sanger, J. W., Chowrashi, P., Shaner, N. C., Spalthoff, S., Wang, J., Freeman, N. L. and Sanger, J. M. (2002). Myofibrillogenesis in skeletal muscle cells. Clin. Orthop. Relat. Res. 403,S153 -S162.[CrossRef][Medline]
Schultheiss, T., Lin, Z. X., Lu, M. H., Murray, J., Fischman, D.
A., Weber, K., Masaki, T., Imamura, M. and Holtzer, H.
(1990). Differential distribution of subsets of myofibrillar
proteins in cardiac nonstriated and striated myofibrils. J. Cell
Biol. 110,1159
-1172.
Sellers, J. R. (2004). Fifty years of contractility research post sliding filament hypothesis. J. Muscle Res. Cell Motil. 25,475 -482.[CrossRef][Medline]
Trinick, J. and Tskhovrebova, L. (1999). Titin: a molecular control freak. Trends Cell Biol. 9, 377-380.[CrossRef][Medline]
Van der Ven, P. F., Ehler, E., Perriard, J. C. and Furst, D. O. (1999). Thick filament assembly occurs after the formation of a cytoskeletal scaffold. J. Muscle Res. Cell Motil. 20,569 -579.[CrossRef][Medline]
Venolia, L., Ao, W., Kim, S., Kim, C. and Pilgrim, D. (1999). unc-45 gene of Caenorhabditis elegans encodes a muscle-specific tetratricopeptide repeat-containing protein. Cell Motil. Cytoskeleton 42,163 -177.[CrossRef][Medline]
Zhao, R., Davey, M., Hsu, Y. C., Kaplanek, P., Tong, A., Parsons, A. B., Krogan, N., Cagney, G., Mai, D., Greenblatt, J. et al. (2005). Navigating the chaperone network: an integrative map of physical and genetic interactions mediated by the hsp90 chaperone. Cell 120,715 -727.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Li, W. R. Randall, and S.-J. Du skNAC (skeletal Naca), a muscle-specific isoform of Naca (nascent polypeptide-associated complex alpha), is required for myofibril organization FASEB J, June 1, 2009; 23(6): 1988 - 2000. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Willis, J. C. Schisler, A. L. Portbury, and C. Patterson Build it up-Tear it down: protein quality control in the cardiac sarcomere Cardiovasc Res, February 15, 2009; 81(3): 439 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hinits, D. P. S. Osborn, and S. M. Hughes Differential requirements for myogenic regulatory factors distinguish medial and lateral somitic, cranial and fin muscle fibre populations Development, February 1, 2009; 136(3): 403 - 414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Liu, R. Srikakulam, and D. A. Winkelmann Unc45 Activates Hsp90-dependent Folding of the Myosin Motor Domain J. Biol. Chem., May 9, 2008; 283(19): 13185 - 13193. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
