|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 February 2008
doi: 10.1242/dev.014563
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



1 Department of Developmental Biology, URA 2578 CNRS, Pasteur Institute, 25 rue
du Docteur Roux, 75724 Paris, France.
2 Division of Basic Medical Sciences, St George's, University of London, London,
UK.
Author for correspondence (e-mail:
margab{at}pasteur.fr)
Accepted 2 January 2008
| SUMMARY |
|---|
|
|
|---|
Key words: DiI labelling, Atrial myocardium, Explants, Mouse embryo, Pitx2c, Second heart field
| INTRODUCTION |
|---|
|
|
|---|
Cell-lineage analysis of myocardial progenitors in the chick embryo points
to differences between the location of cells in the primitive streak that
contribute to arterial pole myocardium as opposed to more-posterior parts of
the heart tube (Garcia-Martinez and
Schoenwolf, 1993
). In avian embryos, atrial markers are already
detectable in the caudal part of the cardiac primordia and then in the caudal
heart tube (Yutzey et al.,
1994
; Patwardhan et al.,
2000
), where progenitor cells adjacent to the sinus venosus have
been shown to contribute to the growth of the tube
(Arguello et al., 1975
). In the
mouse embryo, the cardiac crescent, where differentiating cardiomyocytes are
first present, does not express atrial markers and atrial identity is only
distinguishable later; atrial markers such as the atrial myosin light chain
Mlc2a (Myl7 - Mouse Genome Informatics) are present throughout the tube at the
5- to 7-somite stage (Kubalak et al.,
1994
), whereas Mlc2v (Myl7 - Mouse Genome Informatics) is already
restricted to ventricular myocardium
(O'Brien et al., 1993
),
indicative of early transcriptional differences. Subsequently, the chicken
ovalbumin upstream promoter-transcription factor II (COUP-TFII)
(Pereira et al., 1999
) and the
atrial natriuretic factor ANF (also known as Nr2f2 and Nppa, respectively -
Mouse Genome Informatics) (Christoffels et
al., 2000
), mark the atria. A retrospective clonal analysis in the
mouse embryo has shown that myocardial cells in the heart tube, as it begins
to loop at E8.5, derive from two distinct lineages that segregate before the
first myocardial cells appear. The first lineage contributes left ventricular
myocardium and to other parts of the heart with the exception of the outflow
tract, whereas the second lineage shows a complementary contribution
(Meilhac et al., 2004a
). The
myocardium of the atria is therefore formed by both lineages. This clonal
analysis, which reveals the atrial contribution of the second lineage, can be
correlated with observations on the SHF, which probably also contributes to
the atria at the venous pole of the heart as well as to arterial pole
myocardium. We have used similar approaches to those that we had employed for
the AHF, namely explant experiments and DiI labelling, to examine this
contribution more closely. We now demonstrate that atrial progenitors are
located more caudally, in the posterior SHF (pSHF).
Left-right signalling affects cardiogenesis, as evidenced by mutant
phenotypes (Logan et al.,
1998
; Lin et al.,
1999
) including right atrial isomerism
(Liu et al., 2001
). This is
mediated in the myocardium by the Pitx2c isoform
(Campione et al., 2001
), which
is probably also expressed in progenitor cells of the SHF
(Ai et al., 2006
;
Nowotschin et al., 2006
). We
therefore investigated the role of Pitx2c in myocardial progenitor cells that
contribute to the right and left atria. In order to carry out these
experiments, we utilised Mlc3f-nlacZ-2E mice in which the transgene
preferentially marks right atrial myocardium from an early stage
(Kelly et al., 1995
;
Franco et al., 1997
). We show
that left-right differences, as evidenced by the myocardial potential of
explants, are already present in the pSHF from the time when Pitx2c
is first expressed in the left part of the field. Manipulation of Pitx2c
expression in gain-of-function experiments, complemented by observations on
Pitx2c-/- mutants, confirms its role in repressing
transgene expression in explants from the left pSHF. The right side of the
sinus venosus is more proliferative than the left, whereas in
Pitx2c-/- mutant embryos the left sinus venosus is now
more proliferative than the right. This effect is also seen in cultured
explants from the SHF and is again consistent with repression by Pitx2c.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mice were maintained on an inverted light-dark cycle to facilitate collection of embryos at the required developmental stages for explant analysis. The animals used were mainly produced in the Pasteur Institute Animal Facility, with provision of standard stocks from Janvier (Le Genest St Isle, France); the remaining animals were produced in the St George's Biological Research Facility. The care and use of laboratory animals followed the guidelines of the French Ministry of Agriculture or the UK Home Office.
X-Gal staining and whole-mount in situ hybridisation
Embryos were dissected in PBS and treated as described
(Tajbakhsh and Houzelstein,
1995
). Specific RNA probes used: Islet1
(Cai et al., 2003
);
Pitx2 (Campione et al.,
1999
).
Embryonic explant cultures
Explant culture conditions were as described
(Zaffran et al., 2004
). To
make explants, the embryos were flattened and the number of somites counted.
The cardiac crescent and the somites were used as morphological guides under
the microscope. The explanted regions were lateral to the second/third somite.
Explant experiments were repeated at least ten times for each transgenic line.
After usually 12 or 72 hours of culture, explants were fixed in 4%
paraformaldehyde, washed three times with PBS and stained with Hoechst 33258.
Sections (10 µm) were prepared from frozen embryos. Treatment for
fluorescent immunohistochemistry was as described
(Daubas et al., 2000
). The
following antibodies were used, all at 1:200 dilution: polyclonal
anti-β-gal (Sigma), monoclonal anti-myosin heavy chain (MF20,
Developmental Studies Hybridoma Bank), monoclonal anti-phosphohistone H3
antibody (Cell Signalling) and anti-Islet1 (39.4D5, Developmental Studies
Hybridoma Bank).
RT-PCR and qRT-PCR
RNA from five or ten explants at different times was extracted using the
RNeasy Micro Kit (Qiagen, Cergy Pontoise, France) and cDNA was
reverse-transcribed using the ThermoScript RT-PCR system (Invitrogen). The
extractions and reverse transcriptions were repeated twice in independent
experiments.
PCR was performed using a tenth of the reverse-transcription reaction
volume, with the following program: an initial 5 minutes at 94°C; followed
by 30 cycles of 45 seconds at 94°C, 45 seconds at 58-60°C (depending
on the melting temperature of the primers) and 1 minute at 72°C; with a
final 5 minutes at 72°C. Primers were as follows (5'-3'):
Mlc2a fw, CAGACCTGAAGGAGACCT and Mlc2a rev,
GTCAGCGTAAACAGTTGC (fragment generated of 286 bp); Mlc2v fw,
GCCAAGAAGCGGATAGAAGG and Mlc2v rev, CTGTGGTTCAGGGCTCAGTC (499 bp)
(Kubalak et al., 1994
);
COUP-TFII fw, CGCTTTTATGGACCACATACG and COUP-TFII rev,
GTTTCGATGGGGGTTTTACC (322 bp); Pitx2c fw, ACTGCATGAAAGGCCCGCTG and
Pitx2c rev, CTTCAGGGCTGGAAGTATCG (195 bp); β-actin fw,
GATGACCCAGATCATGTTTGAG and β-actin rev, GGAGCAATGATCT TGATCTTC (643
bp).
Quantitative (q) RT-PCR was performed as previously described
(Hadchouel et al., 2000
),
except that PCR reactions on cDNA were performed with SYBR Green PCR Master
Mix (Applied Biosystems, Courtaboeuf, France) and the quantity of each mRNA
was expressed as a percentage with respect to Gapdh transcripts.
Extractions and reverse transcriptions were repeated three times in
independent experiments. Primers used were (5'-3'): lacZ
fw, GCAGCCTGAATGGCGAAT and lacZ rev, CGCATCGTA ACCGT GCATC
(Hadchouel et al., 2000
);
GFP fw, AAGTTCATCTGCACCACCG and GFP rev,
TCCTTGAAGAAGATGGTGCG; Mlc2a rt fw, GTCAGCGTAAACAGTTGC and
Mlc2a rt rev, GTCCGTCCCATTGAGCTTCT;Gapdh fw,
AACGACCCCTTCATTGAC and Gapdh rev, TCCACGACATACTCAGCAC
(Simpson et al., 2000
).
Adenovirus generation
Adenoviruses were produced as described
(He et al., 1998
). Infection
of the explants was performed after 12 hours of culture with approximately the
same titre for all the viruses (108 plaque-forming units). This
concentration was determined empirically by serial dilution on explants as the
one that permitted high infection without induction of cell death. For the
Pitx2c adenovirus, a fragment of Pitx2c cDNA of 956 bp
(nucleotides 228 to 1184) was used.
DiI labelling
Embryos ranging from the 4- to 6-somite stages were collected, transferred
to Hank's solution and injected with DiI as described
(Franco et al., 2001
). Embryos
at the 7-somite stage were injected with DiI on one side and with DiR on the
other side of the pSHF. Labelled embryos were photographed under a Leica MZ16F
stereomicroscope using a Nikon Coolpix 995 digital camera. Embryos were then
cultured for 40 hours in vitro (20-25 somites) in 75% rat serum, 25% T6 medium
(Whittingham, 1971
) with 5%
CO2, 20% O2 and 75% N2 in rolling bottles.
After culture, DiI-labelled embryos were washed in PBS and fixed in 4%
paraformaldehyde in PBS overnight. Labelled embryos were analysed with a Zeiss
LSM 510 laser-scanning confocal microscope and the captured images were
processed with the CS2 version of Adobe Photoshop. At 4- to 6-somites, ten
embryos were injected in the left and ten in the right pSHF. At 7 somites, ten
embryos were injected on both sides.
| RESULTS |
|---|
|
|
|---|
|
Myocardial potential of Islet1-expressing cells
We had previously shown that explants of the β-gal-positive region
from the Mlc1v-nlacZ-24 transgenic line, in which transgene
expression marks the Fgf10-positive rostral domain of the SHF, the
AHF, will give rise to differentiated cardiomyocytes after culture
(Zaffran et al., 2004
). We now
took explants from the caudal domain where Islet1, but not
Mlc1v-nlacZ-24, is expressed, as indicated by rectangles in
Fig. 1.
|
To check whether myocardial progenitors, present in the explants after 72
hours, gave rise to atrial or ventricular myocardial cells, we used RT-PCR to
detect transcripts of atrial myosin light chain 2 (Mlc2a) or
ventricular myosin light chain 2 (Mlc2v). In E8 embryos (6- to
7-somite stage), Mlc2a marks all myocardial cells, becoming restricted to the
atria later, whereas Mlc2v is an early ventricular marker
(Kubalak et al., 1994
;
O'Brien et al., 1993
) and
continues to be expressed only in the ventricles and temporally in the outflow
tract throughout cardiac morphogenesis. Both right and left explants taken at
the 4- to 6-somite stage, after 72 hours of culture, were positive for
Mlc2a but not for Mlc2v
(Fig. 2G), excluding the
presence of ventricular-type progenitors in the explants. As another early
atrial marker, we looked at transcripts of COUP-TFII
(Nr2f2), which is upregulated during expansion of the common atrium
by E9.0 (Pereira et al., 1999
)
and was also expressed in the cultured explants. We took the same posterior
region from Mlc1v-nlacZ-24 embryos at the 4- to 6-somite stage.
Initially, these explants were β-gal-negative (results not shown). After
72 hours, pSHF explants from Mlc1v-nlacZ-24 mice were positive for
myosin heavy chain (Fig. 2I)
but not for β-gal (Fig.
2J), confirming that myocardial progenitors, present in the
explants, did not come from the AHF where this transgene is expressed, as the
stable β-gal protein continues to mark the myocardial derivatives that
had expressed Mlc1v-nlacZ-24
(Kelly et al., 2001
).
DiI injection in the pSHF of embryos at the 4- to 6-somite stage shows labelling of the common atrium
We next investigated the contribution of the pSHF by DiI injection in vivo,
followed by embryo culture. DiI was injected into the left or right pSHF of
embryos between the 4- and 6-somite stages. After 40 hours of culture (to the
20- to 25-somite stage), we analysed the embryos and found the labelling to be
in the common atrium. After injection into the right pSHF, we found the
labelling in the right common atrium (Fig.
3A,A'), and after injection into the left pSHF, the
labelling was in the left common atrium
(Fig. 3B,B'). Injections
shown in Fig. 3A,B were at the
4-somite stage. A similar result was seen for 7-somite-stage embryos
(Fig. 3C,C'). We never
found labelling of the right or the left ventricle after dye injection in the
pSHF and conclude that cells in this part of the SHF contribute to the atria
and that this contribution from each side of the pSHF is apparently restricted
to the corresponding side of the common atrium.
At the 4-somite stage, explants from both right and left pSHF show the same atrial myocardial potential
In Mlc3f-nlacZ-2E transgenic mice, β-gal is expressed mainly
in the right atrium and left ventricle, with only a few β-gal-positive
cells also present in the left atrium
(Kelly et al., 1995
). Thus,
transgene expression is a marker for cardiac asymmetry in these transgenic
mice. We took explants from the pSHF of Mlc3f-nlacZ-2E embryos at the
4-somite stage and cultured them for 72 hours, followed by analysis of
expression of β-gal and myosin heavy chain. Based on RT-PCR analysis,
there were no ventricular progenitors in the explants, so that lacZ-
and myosin-positive cells represent atrial cardiomyocytes (see
Fig. 2G). At the 4-somite
stage, explants from both left and right pSHF gave rise to β-gal and
myosin double-positive cells (Fig.
4A-H). A quantitative analysis of atrial myocardial cells was
performed both by counting β-gal and myosin double-positive cells
(Fig. 4I) and by measuring the
relative percentage of lacZ and Mlc2a transcripts with
respect to glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
transcripts in right and left explants
(Fig. 4J).
|
Identification of left-right asymmetry in pSHF explants at the 6-somite stage
When explants from Mlc3f-nlacZ-2E embryos were taken at the
6-somite stage and cultured for 72 hours, we found a left-right difference in
the number of β-gal and myosin double-positive cells, in contrast to the
explants at the 4-somite stage. In left explants, the number of
double-positive cells was less than in the right explants (compare
Fig. 5B-D with
Fig. 5F-H). In left explants,
the percentage of double-positive cells was about 10%, whereas in the right
explants it was about 30% (Fig.
5Q). This difference was confirmed by the relative abundance of
lacZ and Mlc2a transcripts with respect to control
Gapdh transcripts (Fig.
5R).
Similar experiments were performed with explants from the pSHF of
Mlc3f-nlacZ-9 embryos (Franco et
al., 1997
) (Fig.
5I-P). In these mice, the myocardial compartments of the heart are
marked by β-gal, without any asymmetry. By double immunofluorescence
(β-gal and myosin heavy chain) on explants after 72 hours of culture, we
did not find any difference in the number of β-gal and myosin
double-positive cells, providing a control for the asymmetry seen with the
Mlc3f-nlacZ-2E mouse line (Fig.
5Q). We conclude from these experiments that the potential for
expression of the Mlc3f-nlacZ-2E transgene, which marks the right
atrium, is acquired by myocardial progenitor cells in the pSHF at the 5- to
6-somite stage.
The effect of Pitx2c adenoviral infection on left-right asymmetry in Mlc3f-nlacZ-2E explants
With the aim of manipulating left-right asymmetry in the explants, we
examined the effect of ectopic Pitx2c expression because this isoform of
Pitx2 has been implicated in asymmetric development of the heart
(Liu et al., 2001
). Asymmetric
expression of Pitx2, which is due to the Pitx2c isoform
(Schweickert et al., 2000
), is
seen in the left SHF, including the caudal region at the 6-somite stage (see
Fig. S1 in the supplementary material).
We used an adenoviral vector expressing Pitx2c and GFP (Fig. 6I-P), with an adenoviral vector expressing GFP alone as a control (Fig. 6A-H), to infect left and right explants from Mlc3f-nlacZ-2E embryos at the 5-somite stage. We chose to make explants from 5-somite embryos because this is the critical stage when Pitx2c is being activated. In these explants, transcripts were not detectable initially, as in vivo, but were present in left explants after 72 hours of culture (see Fig. S2 in the supplementary material). Whereas infection with the GFP-expressing adenovirus did not alter the left-right difference in the number of β-gal-positive cells (compare Fig. 6D with 6H), after infection with the Pitx2c/GFP adenovirus we found only a few β-gal-positive cells in explants from both sides (Fig. 6L,P), suggesting that Pitx2c represses the expression of the transgene. A quantitative analysis, counting the percentage of β-gal-positive cells in the total cell population, showed that there is a reduction (by about 50% in left and by about 80% in right explants) in the number of transgene-expressing cells (Fig. 6Q). By qRT-PCR for lacZ transcripts, we observed a similar decrease in the amount of lacZ mRNA in right explants infected with Pitx2c/GFP adenovirus, whereas infection with the GFP control adenovirus did not produce this effect (Fig. 6R, compare the columns indicated by the arrowheads). Reduction of the number of β-gal-positive cells could not be explained by a toxic effect of the adenovirus, because all the explants were `beating' after 3 days of infection, and myosin expression, as detected by immunofluorescence, was comparable to controls (data not shown). Moreover, the relative abundance of Mlc2a transcripts was maintained, suggesting that the adenovirus effect was related to asymmetric transgene expression. The GFP infection level was measured by qRT-PCR and it was comparable (60-70%) both after infection with GFP (control) and Pitx2c/GFP (Fig. 6R). Ectopic Pitx2c therefore exerts a repressive effect on the expression of the transgene in explants from the right-hand side of the pSHF, indicating that endogenous Pitx2c in left explants reduces Mlc3f-nlacZ-2E transcription. In keeping with this, explants from the left and right pSHF of Pitx2c-/- mutant embryos, at the 6-somite stage, showed an increased proportion of β-gal and myosin double-positive cells in the left explants after culture, demonstrating the loss of left-right asymmetry in Mlc3f-nlacZ-2E transgene expression in the absence of Pitx2c (see Fig. S3 in the supplementary material).
|
| DISCUSSION |
|---|
|
|
|---|
DiI labelling and explant experiments now demonstrate that the pSHF
contains atrial and not ventricular myocardial progenitors. Indeed, we had
previously shown that left ventricular cells are already present when the
early heart tube fuses, indicating that they arise from the cardiac crescent,
described as the first heart field
(Buckingham et al., 2005
), and
that the AHF gives rise to right ventricular myocardium and outflow tract
(Zaffran et al., 2004
). Our
retrospective clonal analysis had indicated a first- and second-lineage
contribution to both the right ventricle and atria
(Meilhac et al., 2004a
). It is
not clear to what extent the first lineage is represented by the cardiac
crescent and the early heart tube. However, the rostral-most part of the early
heart tube has right ventricular identity
(Zaffran et al., 2004
) and the
caudal-most tube/crescent might similarly contribute to the atria although,
unlike in the chick embryo (Yutzey et al.,
1994
; Patwardhan et al.,
2000
), atrial-specific markers are only detected later. The atrial
contribution of the Islet1-positive region of the SHF is consistent with the
fate of Islet1-expressing cells, which have been demonstrated to contribute to
the venous as well as the arterial pole of the heart in
Islet1-Cre/Rosa26 tracing experiments
(Cai et al., 2003
). The absence
of Fgf10 expression in cells with atrial potential is consistent with
observations of β-gal labelling of myocardium by the
Mlc3f-nlacZ-2E transgene, which is under Fgf10 control and
does not label the venous pole (Kelly et
al., 2001
). It is striking that not only myocardium, but also
differentiated cells with specific chamber identity, are formed in cultured
explants from different regions of the SHF. In the experiments described here,
atrial identity was indicated by the expression of endogenous genes as well as
of the Mlc3f-nlacZ-2E transgene, which is not expressed in right
ventricular and outflow tract myocardium that also derive from the SHF
(Zaffran et al., 2004
). The
formation of myocardium requires signalling molecules derived from endoderm
(Harvey, 1999
), present in the
explants. However, whereas signals required to induce myocardial
differentiation, such as Bmp4 and Fgfs, have been identified, it is not clear
what signals promote atrial versus ventricular myocardium. In the SHF, genes
are not uniformly expressed and atrial specification probably depends on
combinations of regulatory factors peculiar to the pSHF
(Buckingham et al., 2005
). An
example of regionalised transcriptional specificity is provided by the
Tbx18-positive cells, which are mainly Islet1- and Nkx2.5-negative, unlike
most of the SHF. These cells contribute to the myocardium of the sinus horns,
which form the base of the venous inlet of the heart at later developmental
stages, after the atria have formed
(Christoffels et al.,
2006
).
|
In our study, left-right atrial identity was followed with the
Mlc3f-nlacZ-2E transgene, which preferentially marks the right and
not the left atrium and begins to show asymmetric expression in the right
sinus venosus from about E8.5 (Franco et
al., 2001
). From the 6-somite-stage, explants of left or right
pSHF show asymmetric expression of the transgene in myosin-positive cells
after culture. This acquisition of right versus left atrial identity
correlates with the appearance of Pitx2c transcripts in the left
pSHF. Pitx2c transcripts are not detectable in these explants at the
4-somite stage, whereas they are present in left explants by the 6- to
7-somite stage. In the intervening period, 5-somite explants are initially
Pitx2c-negative, but during the culture period Pitx2c
transcripts become detectable in left explants, indicating that nodal
signalling from left lateral mesoderm
(Raya and Belmonte, 2006
) has
implemented activation of the gene.
|
Pitx2 isoforms have been associated with inhibiting
(Wei and Adelstein, 2002
) or
promoting cell proliferation depending on the cell type
(Kioussi et al., 2002
). In the
heart, Pitx2 mutants showed reduced proliferation in the proximal
outflow tract (Ai et al., 2006
)
and a proliferative role for Tbx1 through activation of Pitx2c has
been suggested in the SHF (Nowotschin et
al., 2006
). Labelling by PHH3 marks cells in mitosis and the high
percentage of positive cells (
27%) that we observed is consistent with
very high proliferative rates in the pSHF and caudal region of the heart tube
(Soufan et al., 2006
). We did
not detect a significant difference in mitotic cells between right and left
sides of the SHF at the 6-somite stage when Pitx2c is expressed. The absence
of an effect on progenitor cell proliferation is also suggested by the fact
that Islet1 expression is unchanged in the Pitx2 mutant
(Ai et al., 2006
). However, we
observed 30% more mitotic cells in the right than left sinus venosus. This is
consistent with the larger size of explants from this part of the posterior
heart tube. Moreover, in the Pitx2c-/- mutant, we observed
a higher number of mitotic cells in the left sinus venosus. Therefore, a
negative effect of Pitx2c on early myocardial cell proliferation might be
responsible for the smaller size of the left atrium as compared with the right
atrium, where pectinate trabeculation is more pronounced in the presence of
Pitx2c (Liu et al., 2001
).
This is also indicated by findings in the chick embryo, in which the left
lateral free wall of the common atrium showed a lower rate of proliferation
than the right side (Thompson et al.,
1990
).
|
The number of mitotic cells in the left sinus venosus or in cultured left
pSHF explants from Pitx2c-/- embryos exceeds that on the
right side. This is in keeping with preliminary observations on the left
cardiac crescent before Pitx2c is expressed, where more dividing cells are
present (D. Bellomo and N.A.B., unpublished). It is possible that a second
left-right signalling pathway is operating to antagonise that mediated by
Pitx2c and this is revealed when Pitx2c is absent. Indeed, the directionality
of cardiac looping cannot be explained by the action of the Pitx2c pathway
(Liu et al., 2001
).
It is important to note that effects on the number of cardiomyocytes expressing the Mlc3f-nlacZ-2E transgene, which normally marks right atrial myocardium, are not due to differences in cell number because the results are expressed relative to the number of cells, or to Gapdh transcripts in the explants in the case of the gain-of-function experiments. Pitx2c therefore modulates the acquisition of atrial identity, exerting a repressive effect on the right `default' pathway in progenitor cells from the left side of the pSHF. In addition, lower proliferation in the left sinus venosus and in cultured explants is due to Pitx2c expression, showing that it has an additional repressive effect on left atrial growth.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/6/1157/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Developmental Biology Institute of Marseilles-Luminy, UMR
6216 CNRS, Campus de Luminy Case 907, 13288 Marseilles, France ![]()
Present address: Royal Danish Ministry of Foreign Affairs, Trade Commission
of Denmark 1010, Sherbrooke Street West, Suite 2211 Montreal, Quebec, H3A 2R7,
Canada ![]()
| REFERENCES |
|---|
|
|
|---|
Ai, D., Liu, W., Ma, L., Dong, F., Lu, M. F., Wang, D., Verzi,
M. P., Cai, C., Gage, P. J., Evans, S. et al. (2006). Pitx2
regulates cardiac left-right asymmetry by patterning second cardiac
lineage-derived myocardium. Dev. Biol.
296,437
-449.[CrossRef][Medline]
Arguello, C., de la Cruz, M. V. and Gomez, C. S.
(1975). Experimental study of the formation of the heart tube in
the chick embryo. J. Embryol. Exp. Morphol.
33, 1-11.[Medline]
Bajolle, F., Zaffran, S., Meilhac, S. M., Dandonneau, M., Chang,
T., Kelly, R. G. and Buckingham, M. E. (2008). Myocardium at
the base of the aorta and pulmonary trunk is prefigured in the outflow tract
of the heart and in subdomains of the second heart field. Dev.
Biol. 313,25
-34.[CrossRef][Medline]
Black, B. L. (2007). Transcriptional pathways
in second heart field development. Semin. Cell Dev.
Biol. 18,67
-76.[CrossRef][Medline]
Buckingham, M., Meilhac, S. and Zaffran, S.
(2005). Building the mammalian heart from two sources of
myocardial cells. Nat. Rev. Genet.
6, 826-835.[CrossRef][Medline]
Cai, C. L., Liang, X., Shi, Y., Chu, P. H., Pfaff, S. L., Chen,
J. and Evans, S. (2003). Isl1 identifies a cardiac progenitor
population that proliferates prior to differentiation and contributes a
majority of cells to the heart. Dev. Cell
5, 877-889.[CrossRef][Medline]
Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K.,
van Bebber, F., Lowe, L. A., Nowotschin, S., Viebahn, C., Haffter, P., Kuehn,
M. R. et al. (1999). The homeobox gene Pitx2: mediator of
asymmetric left-right signaling in vertebrate heart and gut looping.
Development 126,1225
-1234.[Abstract]
Campione, M., Ros, M. A., Icardo, J. M., Piedra, E.,
Christoffels, V. M., Schweickert, A., Blum, M., Franco, D. and Moorman, A.
F. (2001). Pitx2 expression defines a left cardiac lineage of
cells: evidence for atrial and ventricular molecular isomerism in the iv/iv
mice. Dev. Biol. 231,252
-264.[CrossRef][Medline]
Christoffels, V. M., Habets, P. E., Franco, D., Campione, M., de
Jong, F., Lamers, W. H., Bao, Z. Z., Palmer, S., Biben, C., Harvey, R. P. and
Moorman, A. F. (2000). Chamber formation and morphogenesis in
the developing mammalian heart. Dev. Biol.
223,266
-278.[CrossRef][Medline]Erratum in Dev. Biol. (2000)
225, 266.[CrossRef]
Christoffels, V. M., Mommersteeg, M. T., Trowe, M. O., Prall, O.
W., de Gier-de Vries, C., Soufan, A. T., Bussen, M., Schuster-Gossler, K.,
Harvey, R. P., Moorman, A. F. et al. (2006). Formation of the
venous pole of the heart from an Nkx2-5-negative precursor population requires
Tbx18. Circ. Res. 98,155
5-1563.
Cimini, D., Mattiuzzo, M., Torosantucci, L. and Degrassi, F.
(2003). Histone hyperacetylation in mitosis prevents sister
chromatid separation and produces chromosome segregation defects.
Mol. Biol. Cell 14,3821
-3833.
Daubas, P., Tajbakhsh, S., Hadchouel, J., Primig, M. and
Buckingham, M. (2000). Myf5 is a novel early axonal marker in
the mouse brain and is subjected to post-transcriptional regulation in
neurons. Development
127,319
-331.[Abstract]
Franco, D., Kelly, R., Lamers, W. H., Buckingham, M. and
Moorman, A. F. (1997). Regionalized transcriptional domains
of myosin light chain 3f transgenes in the embryonic mouse heart:
morphogenetic implications. Dev. Biol.
188, 17-33.[CrossRef][Medline]
Franco, D., Kelly, R., Moorman, A. F., Lamers, W. H.,
Buckingham, M. and Brown, N. A. (2001). MLC3F transgene
expression in iv mutant mice reveals the importance of left-right signalling
pathways for the acquisition of left and right atrial but not ventricular
compartment identity. Dev. Dyn.
221,206
-215.[CrossRef][Medline]
Ganga, M., Espinoza, H. M., Cox, C. J., Morton, L., Hjalt, T.
A., Lee, Y. and Amendt, B. A. (2003). PITX2 isoform-specific
regulation of atrial natriuretic factor expression: synergism and repression
with Nkx2.5. J. Biol. Chem.
278,224
37-22445.
Garcia-Martinez, V. and Schoenwolf, G. C.
(1993). Primitive-streak origin of the cardiovascular system in
avian embryos. Dev. Biol.
159,706
-719.[CrossRef][Medline]
Hadchouel, J., Tajbakhsh, S., Primig, M., Chang, T. H., Daubas,
P., Rocancourt, D. and Buckingham, M. (2000). Modular
long-range regulation of Myf5 reveals unexpected heterogeneity between
skeletal muscles in the mouse embryo. Development
127,4455
-4467.[Abstract]
Harvey, R. P. (1999). Seeking a regulatory
roadmap for heart morphogenesis. Semin. Cell Dev.
Biol. 10,99
-107.[CrossRef][Medline]
He, T. C, Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W. and
Vogelstein, B. (1998). A simplified system for generating
recombinant adenoviruses. Proc. Natl. Acad. Sci. USA
95,2509
-2514.
Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y. P., Jiao, K.,
Schwartz, R. J., Klingensmith, J. and Meyers, E. N. (2006).
Fgf8 is required for anterior heart field development.
Development 133,2435
-2445.
Kelly, R., Alonso, S., Tajbakhsh, S., Cossu, G. and Buckingham,
M. (1995). Myosin light chain 3F regulatory sequences confer
regionalized cardiac and skeletal muscle expression in transgenic mice.
J. Cell Biol. 129,383
-396.
Kelly, R. G., Zammit, P. S., Mouly, V., Butler-Browne, G. and
Buckingham, M. E. (1998). Dynamic left/right regionalisation
of endogenous myosin light chain 3F transcripts in the developing mouse heart.
J. Mol. Cell. Cardiol.
30,106
7-1081.
Kelly, R. G., Brown, N. A. and Buckingham, M. E.
(2001). The arterial pole of the mouse heart forms from
Fgf10-expressing cells in pharyngeal mesoderm. Dev.
Cell 1,435
-440.[CrossRef][Medline]
Kioussi, C., Briata, P., Baek, S. H., Rose, D. W., Hamblet, N.
S., Herman, T., Ohgi, K. A., Lin, C., Gleiberman, A., Wang, J. et al.
(2002). Identification of a Wnt/Dvl/beta-Catenin
Pitx2
pathway mediating cell-type-specific proliferation during development.
Cell 111,673
-685.[CrossRef][Medline]
Kirby, M. L. (2007). Chamber specification and
ventricular septation. In Cardiac Development, pp.103
-117. New York: Oxford University
Press.
Kubalak, S. W., Miller-Hance, W. C., O'Brien, T. X., Dyson, E.
and Chien, K. R. (1994). Chamber specification of atrial
myosin light chain-2 expression precedes septation during murine
cardiogenesis. J. Biol. Chem.
269,16961
-16970.
Li, S., Zhou, D., Lu, M. M. and Morrisey, E. E.
(2004). Advanced cardiac morphogenesis does not require heart
tube fusion. Science
305,1619
-1622.
Lin, C. R., Kioussi, C., O'Connell, S., Briata, P., Szeto, D.,
Liu, F., Izpisua-Belmonte, J. C. and Rosenfeld, M. G. (1999).
Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth
morphogenesis. Nature
401,279
-282.[CrossRef][Medline]
Liu, C., Liu, W., Lu, M. F., Brown, N. A. and Martin, J. F.
(2001). Regulation of left-right asymmetry by thresholds of
Pitx2c activity. Development
128,2039
-2048.
Logan, M., Pagan-Westphal, S. M., Smith, D. M., Paganessi, L.
and Tabin, C. J. (1998). The transcription factor Pitx2
mediates situs-specific morphogenesis in response to left-right asymmetric
signals. Cell 94,307
-317.[CrossRef][Medline]
Meilhac, S. M., Esner, M., Kelly, R. G., Nicolas, J. F. and
Buckingham, M. E. (2004a). The clonal origin of myocardial
cells in different regions of the embryonic mouse heart. Dev.
Cell 6,685
-698.[CrossRef][Medline]
Meilhac, S. M., Esner, M., Kerszberg, M., Moss, J. E. and
Buckingham, M. E. (2004b). Oriented clonal cell growth in the
developing mouse myocardium underlies cardiac morphogenesis. J.
Cell Biol. 164,97
-109.
Mommersteeg, M. T., Hoogaars, W. M., Prall, O. W., de Gier-de
Vries, C., Wiese, C., Clout, D. E., Papaioannou, V. E., Brown, N. A., Harvey,
R. P., Moorman, A. F. et al. (2007). Molecular pathway for
the localized formation of the sinoatrial node. Circ.
Res. 100,354
-362.
Nowotschin, S., Liao, J., Gage, P. J., Epstein, J. A., Campione,
M. and Morrow, B. E. (2006). Tbx1 affects asymmetric cardiac
morphogenesis by regulating Pitx2 in the secondary heart field.
Development 133,1565
-1573.
O'Brien, T. X., Lee, K. J. and Chien, K. R.
(1993). Positional specification of ventricular myosin light
chain 2 expression in the primitive murine heart tube. Proc. Natl.
Acad. Sci. USA 90,515
7-5161.
Park, E. J., Ogden, L. A., Talbot, A., Evans, S., Cai, C. L.,
Black, B. L., Frank, D. U. and Moon, A. M. (2006). Required,
tissue-specific roles for Fgf8 in outflow tract formation and remodeling.
Development 133,2419
-2433.
Patwardhan, V., Fernandez, S., Montgomery, M. and Litvin, J.
(2000). The rostro-caudal position of cardiac myocytes affect
their fate. Dev. Dyn.
218,123
-135.[CrossRef][Medline]
Pereira, F. A., Qiu, Y., Zhou, G., Tsai, M. J. and Tsai, S.
Y. (1999). The orphan nuclear receptor COUP-TFII is required
for angiogenesis and heart development. Genes Dev.
13,103
7-1049.
Pfaff, S. L., Mendelsohn, M., Stewart, C. L., Edlund, T. and
Jessell, T. M. (1996). Requirement for LIM homeobox gene Isl1
in motor neuron generation reveals a motor neuron-dependent step in
interneuron differentiation. Cell
84,309
-320.[CrossRef][Medline]
Raya, A. and Belmonte, J. C. (2006). Left-right
asymmetry in the vertebrate embryo: from early information to higher-level
integration. Nat. Rev. Genet.
7, 283-293.[CrossRef][Medline]
Schweickert, A., Campione, M., Steinbeisser, H. and Blum, M.
(2000). Pitx2 isoforms: involvement of Pitx2c but not Pitx2a or
Pitx2b in vertebrate left-right asymmetry. Mech. Dev.
90, 41-51.[CrossRef][Medline]
Simpson, D. A., Feeney, S., Boyle, C. and Stitt, A. W.
(2000). Retinal VEGF mRNA measured by SYBR green I fluorescence:
A versatile approach to quantitative PCR. Mol. Vis.
6, 78-83.
Soufan, A. T., van den Berg, G., Ruijter, J. M., de Boer, P. A.,
van den Hoff, M. J. and Moorman, A. F. (2006). Regionalized
sequence of myocardial cell growth and proliferation characterizes early
chamber formation. Circ. Res.
99,545
-552.
Tajbakhsh, S. and Houzelstein, D. (1995). In
situ hybridization and beta-galactosidase: a powerful combination for
analysing transgenic mice. Trends Genet.
11, 42.[CrossRef][Medline]
Thompson, R. P., Lindroth, J. R. and Wong, Y. M. M.
(1990). Regional differences in DNA-synthetic activity in the
preseptation myocardium of the chick. In Developmental Cardiology:
Morphogenesis and Function (ed. E. B. Clark and A. Takao), pp.219
-234. Mount Kisco, NY: Futura.
Wei, Q. and Adelstein, R. S. (2002). Pitx2a
expression alters actin-myosin cytoskeleton and migration of HeLa cells
through Rho GTPase signaling. Mol. Biol. Cell
13,683
-697.
Whittingham, D. G. (1971). Culture of mouse
ova. J. Reprod. Fertil. Suppl.
14, 7-21.[Medline]
Yutzey, K. E., Rhee, J. T. and Bader, D.
(1994). Expression of the atrial-specific myosin heavy chain
AMHC1 and the establishment of anteroposterior polarity in the developing
chicken heart. Development
120,871
-883.[Abstract]
Zaffran, S., Kelly, R. G., Meilhac, S. M., Buckingham, M. E. and
Brown, N. A. (2004). Right ventricular myocardium derives
from the anterior heart field. Circ. Res.
95,261
-268.
This article has been cited by other articles:
![]() |
A. Nakano, H. Nakano, and K.R. Chien Multipotent Islet-1 Cardiovascular Progenitors in Development and Disease Cold Spring Harb Symp Quant Biol, February 9, 2009; (2009) sqb.2008.73.055v1. [Abstract] [PDF] |
||||
![]() |
J. Zhang, Y. Lin, Y. Zhang, Y. Lan, C. Lin, A. M. Moon, R. J. Schwartz, J. F. Martin, and F. Wang Frs2{alpha}-deficiency in cardiac progenitors disrupts a subset of FGF signals required for outflow tract morphogenesis Development, November 1, 2008; 135(21): 3611 - 3622. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Poelmann, M. R.M. Jongbloed, and A. C. Gittenberger-de Groot Pitx2: A Challenging Teenager Circ. Res., April 11, 2008; 102(7): 749 - 751. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||