|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 20 February 2008
doi: 10.1242/dev.015073
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA.
* Author for correspondence (e-mail: idawid{at}nih.gov)
Accepted 29 January 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Fgf8, MAPK, Neural crest, Slug, Wnt3a, Xenopus laevis, Leucine-rich repeats protein, Animal cap, DNA microarray
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Huang and Saint-Jeannet, 2004;
Steventon et al., 2005;
Yanfeng et al., 2003). These
signals lead to the activation of multiple transcription factors such as
Msx1, Pax3 (Monsoro-Burq et al.,
2005), Zic1 (Sato et
al., 2005), Foxd3
(Kos et al., 2001;
Pohl and Knochel, 2001;
Sato et al., 2005),
Sox9 (Spokony et al.,
2002), Slug (Mayor et
al., 1995), Snail
(Essex et al., 1993;
Mayor et al., 1993),
Myc (Bellmeyer et al.,
2003) and Ap2 (Luo et
al., 2003). Gain- and loss-of-function experiments suggested
tentative regulatory networks containing many of these factors
(Monsoro-Burq et al., 2005;
Saint-Jeannet et al., 1997;
Sato et al., 2005).
In addition to NC formation, Fgf family members have crucial roles in at
least three steps in embryogenesis, neural specification
(Curran and Grainger, 2000;
Hongo et al., 1999;
Ribisi, Jr et al., 2000;
Streit et al., 2000),
posterior mesoderm formation (Amaya et al.,
1993; Umbhauer et al.,
1995) and cell migration
(Chung et al., 2007;
Yokota et al., 2003). Fgf
signaling involves binding to one of four Fgf receptors (FGFRs), inducing
activation of at least three downstream cascades: the PI3K-Akt,
Raf-MEK1/2-ERK1/2 and PLC
pathways
(Eswarakumar et al., 2005;
Schlessinger, 2004;
Tsang and Dawid, 2004), the
first two having been linked to mesoderm formation
(Carballada et al., 2001;
Umbhauer et al., 1995).
Inhibition of the Fgf signaling by dominant negative Fgfr1
(Amaya et al., 1993),
Sef (Tsang et al.,
2002) or Mkp3 (Tsang
et al., 2004) results in defects of axis formation. Knockdown of
Fgf8 by antisense morpholino (MO) impairs mesoderm and NC formation
(Fletcher et al., 2006;
Hong and Saint-Jeannet, 2007;
Monsoro-Burq et al., 2005). It
is notable that in NC formation, Fgf signaling is essential, but an excess of
Fgf signaling is inhibitory (Hong and
Saint-Jeannet, 2007).
The Wnt/β-catenin pathway has been implicated in NC formation by gain-
and loss-of-function studies in vivo and in explants
(Abu-Elmagd et al., 2006;
Garcia-Castro et al., 2002;
Monsoro-Burq et al., 2005;
Saint-Jeannet et al., 1997;
Sato et al., 2005). In NC
formation, Wnt signaling cooperates with other signal cascades, notably an
attenuated BMP signal, in the regulation of the specification and
differentiation process (LaBonne and
Bronner-Fraser, 1998;
Saint-Jeannet et al.,
1997).
In this paper, we report that Lrig3, a single-pass transmembrane protein,
is involved in NC formation by modulating FGF and Wnt signaling. We identified
Lrig3 as a gene preferentially expressed in dorsal marginal zone
explants from Xenopus gastrulae, using a DNA microarray approach.
Among three human Lrig family members, Lrig1 has been shown to function as an
EGF signaling inhibitor by enhancing EGFR ubiquitination
(Gur et al., 2004;
Laederich et al., 2004), and
has also been linked to HGF signaling as a negative regulator
(Shattuck et al., 2007).
However, little is known about the function of Lrig family proteins in
embryonic development. In this study, we determined that Lrig3 is required for
NC formation in the Xenopus embryo.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
), embryos were
staged according to Nieuwkoop and Faber
(Nieuwkoop and Faber, 1975).
Animal caps were dissected at stage 9 in 1xMMR, and cultured in L-15
medium [67% L-15, 7.5 mM Tris-HCl (pH 7.5), 1 mg/ml BSA]. For microarray
analysis, stage 10 Xenopus embryos were dissected into four explants.
The dorsal marginal zone, composed mostly of endomesoderm, ventral marginal
zone, animal cap and vegetal explant. To avoid possible cross contamination
that could blur the microarray data, the junction regions between the explants
were removed.
Microarray and data analysis
The dissected explants were homogenized in Stat 60 (TEL TEST), RNA was
treated with DNase I and purified using RNeasy kit (Qiagen). Biotinylated
probe was prepared from 100 ng total RNA using the OVATION RNA amplification
system (Nugen Technologies). Probes were hybridized to Xenopus genome
arrays (Affymetrix) according to the manufacture's instructions. Hybridized
arrays were processed by the GeneChip Fluidics system (Affymetrix), and
scanned in the GeneChip Scanner (Affymetrix). Gene expression profiles were
analyzed by the GCOS software (Affymetrix).
DNA constructs
The ORF of Lrig3 was cloned into pCS2+
(Turner and Weintraub, 1994)
or into pCS2flag, pCS2myc and pCS2GFP. The tags were located c-terminal to
Lrig3. Deletion mutants of Lrig3 were generated by PCR and subcloned into
pCS2myc.
Morpholino oligo
The splicing morpholino (Genetools) against Lrig3 (L3MO)
recognizes both pseudo-alleles is GGGTTTCTGAAAGATAAAAACAAGC, and the
Control-MO is CCTCTTACCTCAGTTACAATTTATA.
lacZ staining, whole-mount in situ hybridization, Alcian Blue staining
lacZ staining was performed as described
(Zhao et al., 2001).
Whole-mount in situ hybridization was performed as described
(Harland, 1991). The following
probes were used: Sox2 (Kishi et
al., 2000), Rx2a
(Yoshitake et al., 1999),
Krox20 (Bradley et al.,
1993), Slug (Snail2)
(Mayor et al., 1995),
Sox9 (Spokony et al.,
2002), Ap2a (Luo et
al., 2002), Inca (Luo
et al., 2007), Myc
(Bellmeyer et al., 2003),
Twist (Hopwood et al.,
1989) and Traf4 (this laboratory) were examined. Alcian
Blue cartilage staining was performed as described
(Pasqualetti et al.,
2000).
Cell culture and transfection
HEK293T and COS7 cells were transfected using Lipofectamine 2000
(Invitrogen) following the manufacturer's manual.
RT-PCR assay
Superscript III (Invitrogen) was used for cDNA synthesis. PCR primers are
listed in Table 1.
|
ERK phosphorylation
Animal caps were lysed in 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% NP-40, 1
mM EDTA and 5 mM sodium orthovanadate
(Bottcher et al., 2004). The
equivalent of 10 animal caps was blotted using monoclonal anti-diphospho-ERK
antibody (clone MAPK-YT, Sigma) at 1:1000, and monoclonal anti-pan-ERK (BD) at
1:4000.
Immunofluorescence
Cells were plated on chambered microslides (Nunc). The cells were washed by
cold 1x PBS, fixed by 2% PFA in 1x PBS, blocked with 20% serum in
1x PBS, and incubated with antibodies for 1 hour. Alexa Fluor 488- or
568-conjugated secondary antibodies were used. Slides were mounted in
VECTASHIELD (Vector Laboratories) and viewed using a Zeiss LSM510 confocal
microscope.
Luciferase assay
HEK293T cells were plated into 24-well plates for 1 day, a total of 0.8
µg/well of plasmid DNA including Topflash-luciferase (0.25 µg/well) and
Renilla luciferase pRL-CMV (0.025 µg/well) were added, using pCS2+ DNA to
adjust the total amount. After 1 day, mouse Wnt3a (100 ng/ml) or LiCl (30 mM)
was added. Luciferase activity was measured using the Dual luciferase system
(Promega) after 24 hours.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Lrig3 contains a putative signal peptide and transmembrane domain, and is thus predicted to be a transmembrane protein. To investigate the subcellular localization of Lrig3, we expressed epitope tagged protein in COS7 or CHO cells. A fraction of Lrig3-Flag was localized at the cell membrane, while a majority localized to the Golgi apparatus, as seen by colocalization with the cis Golgi marker GM130 (Fig. 1D). In addition, punctate distribution of Lrig3-Flag was observed in the cytosol. Only a small proportion of these puncta overlapped with the early endosome marker EEA1 (Fig. 1E). The nucleus was essentially devoid of Lrig3-Flag staining.
In the Xenopus embryo, Lrig3 is expressed around the dorsal blastopore lip, including the prospective neural ectoderm, involuting dorsal mesoderm and anterior dorsal endoderm (Fig. 1F,G). Dorsally restricted expression was verified by RT-PCR (Fig. 1A). As gastrulation progressed, the future neural plate, including the NC anlagen, was stained (Fig. 1H-K). In tailbud and tadpole stages, Lrig3 was highly expressed in the brain, branchial arches and paraxial mesoderm (Fig. 1L,M). RT-PCR indicated that Lrig3 is a maternal factor, increases by gastrulation and continues to be expressed through embryogenesis (Fig. 1N). This pattern is consistent with Lrig3 induction by Chordin or a truncated BMP receptor in animal caps (see Fig. S2 in the supplementary material).
The expression pattern of zebrafish lrig3 was investigated to ask whether the Xenopus pattern is conserved. Zebrafish lrig3 is present maternally, localizes to the shield at gastrula and later shows a complex pattern with strong expression in the branchial arches (Fig. 1O-R).
Lrig3 is required for neural crest differentiation
To study the function of Lrig3 in Xenopus development, we used a
splicing morpholino antisense oligonucleotide (hereafter L3MO) to reduce
expression of the endogenous protein. The effectiveness of L3MO was checked by
RT-PCR, showing that it greatly reduced the level of mature mRNA while leading
to the appearance of a 1 kb PCR product corresponding to unspliced RNA
(Fig. 2A). Injection of L3MO
allowed completion of gastrulation but led to repression of anterior
development and bent axis (Fig.
2B-D, Table 2).
These phenotypes could be rescued by co-injection with Lrig3 mRNA,
indicating that the effect of L3MO is specific
(Fig. 2E-G,
Table 3).
|
|
|
Next, we checked for the presence of differentiated NC derivatives at
swimming tadpole stages in Lrig3-depleted embryos. NC cells of the branchial
arches differentiate into the cartilages of the embryonic facial skeleton
(Le Douarin and Kalcheim,
1999). Cartilage formation in Lrig3 morphants, as visualized by
Alcian Blue staining, was strongly inhibited in the injected side, the
phenotype ranging from missing a single branchial arch to loss of the entire
cranial cartilage (Fig. 3K-M,
see legend for the percentage of affected embryos). As NC precursors also give
rise to ganglion cells of the peripheral nervous system
(Huang and Saint-Jeannet,
2004; Le Douarin and Kalcheim,
1999) we examined trigeminal nerve formation in Lrig3 morphants by
staining with Xenopus Synuclein , and found it to be strongly
reduced (see Fig. S5 in the supplementary material).
|
).
Animal caps were dissected from embryos injected with the indicated mRNAs with
or without L3MO, cultured to stage 16, and gene expression was examined by
RT-PCR. In agreement with previous findings, the neural makers Otx2, Ncam,
Sox3 and Sox2 were induced by the injection of Chordin,
but were suppressed by the co-injection of Wnt3a, while the NC
markers Slug, Sox9, Foxd3, Ap2, Twist and Snail were induced
by the combination of Wnt3a and Chordin
(Fig. 4A,A'). Induction
of Slug, Sox9, Foxd3 and Twist was decreased by co-injection
of L3MO, while Snail was affected to a lesser extent and Ap2
was unaffected. Ap2 is expressed in epidermis in addition to the NC
(Luo et al., 2003;
Luo et al., 2002), possibly
explaining the reduced effect. In contrast to NC markers, the neural genes
Sox3 and Sox2, but not Otx2 or Ncam, were
up-regulated moderately by the morpholino, suggesting that the neural fate
that had been suppressed by adding Wnt3a to Chordin-expressing animal caps was
partially recovered (Fig.
4A,A'). Overexpression of Lrig3 alone could not
induce neural or NC makers in animal caps, nor could addition of
Lrig3 increase the level of Slug, Sox9 and Foxd3
over that achieved by Wnt3a plus Chordin alone
(Fig. 4A). These experiments
also confirmed that Lrig3 itself is strongly induced by injection of
Chordin or a combination of Chordin and Wnt3a, and
that L3MO reduced the level of mature Lrig3 mRNA
(Fig. 4A'). Thus, Lrig3
is required for the induction of NC in explants as well as in whole
embryos.
The Zic1 and Pax3 genes play an important role in NC
specification by inducing NC markers such as Slug and Foxd3
in the presence of a Wnt signal
(Monsoro-Burq et al., 2005;
Sato et al., 2005) (for a
review, see Steventon et al.,
2005). L3MO did not block the expression of Zic1 and
Pax3 in animal caps injected with Chordin and Wnt3a
(Fig. 4A), suggesting that
Lrig3 functions between Pax3/Zic1 and
Slug/Foxd3 in the regulatory hierarchy of NC formation. To
address this possibility, we examined the L3MO effect on the NC inducing
activity of Pax3 plus Zic1. As reported, co-injection of
Pax3 and Zic1 induced NC markers Slug, Sox9 and
Twist (Hong and Saint-Jeannet,
2007; Monsoro-Burq et al.,
2005); this induction was inhibited by L3MO
(Fig. 4B). We therefore
conclude that Lrig3 functions downstream of Pax3 and
Zic1 in NC formation.
Lrig3 acts in NC specification in coordination with a Wnt signal
Lrig3 is required for NC formation in animal caps exposed to a Wnt signal
and BMP inhibition. We attempted to determine which of these two pathways
interacts with Lrig3. Induction of the Wnt target genes Xnr3 and
Siamois in animal caps was only slightly enhanced by co-injection of
Lrig3 (Fig. 5A), and
Lrig3 transfection stimulated Wnt-dependent Topflash reporter
activity in cultured cells to a modest but significant extent (see Fig. S6 in
the supplementary material). In addition to activating dorsal genes such as
Siamois, canonical Wnt signaling is also capable of inducing mesoderm
formation (Schohl and Fagotto,
2003). We found that the slight induction of Xbra by
Wnt3a was greatly enhanced by co-injection of Lrig3
(Fig. 5B). The combination of
Wnt3a and Lrig3 could also induce the NC markers Slug,
Foxd3 and Sox9, but to a lower level than that obtained after
injection of a combination of Wnt3a, Chordin and Lrig3
(Fig. 5B). These results
indicate that Lrig3 can enhance canonical Wnt signaling, with the strength of
the effect dependent on context.
The role of Wnt signaling in mesoderm formation is correlated with its
induction of Fgf3 (Schohl and
Fagotto, 2003). As Xbra is a direct target of Fgf
signaling (Smith et al.,
1991), we tested whether the enhanced Xbra expression
induced by Wnt and Lrig3 was accompanied by upregulation of
Fgf3, Fgf4 (also known as eFgf) or Fgf8, three
genes known to be expressed in early Xenopus embryos
(Fletcher et al., 2006;
Isaacs et al., 1995;
Lombardo et al., 1998;
Tannahill et al., 1992).
Injection of Lrig3 alone did not induce any of these genes. When
harvested at stage 10, animal caps co-injected with Lrig3 and
Wnt3a expressed Fgf8, while Wnt3a alone did not
induce any of the three Fgf genes (Fig.
5C). By stage 16, animal caps injected with Wnt3a induced
a low level of Fgf3, but co-injection of Wnt3a with
Lrig3 led to the clear increase in the induction of all three Fgf
genes tested, consistent with the induction of Xbra under the same
conditions (Fig. 5C). We
conclude that Lrig3 strongly enhances the ability of canonical Wnt signaling
to induce three Fgf genes in Xenopus embryonic tissues.
|
Lrig3 can modulate Fgf signaling in mesoderm and NC induction
We investigated the relationship of Lrig3 to the Fgf pathway for three
reasons. First, modulation of Wnt signaling in the context of NC induction in
explants results in enhanced expression of Fgf genes. Second, mammalian Lrig1
affects EGF signaling, which shares several signal transduction components
with the Fgf pathway. Third, Fgf signaling has been implicated in NC
formation. We first checked the effect of Lrig3 on Fgf-induced ERK (MAP
kinase) phosphorylation in animal caps harvested at an early stage where the
effects of Fgf have been well studied. Injection of active Ras or
Fgf4 mRNA into animal caps stimulates ERK phosphorylation
(Gupta and Mayer, 1998;
Suga et al., 2006;
Whitman and Melton, 1992), and
this could also be achieved by treatment with bFgf
(Fig. 6A). ERK phosphorylation
was inhibited by injection of Lrig3; similar inhibition was observed
with Sef or Mkp3, known inhibitors of Fgf signaling that
were used as controls (Kovalenko et al.,
2003; Tsang et al.,
2002; Tsang et al.,
2004) (Fig. 6A).
Using induction of Xbra by Fgf
(Smith et al., 1991) as an
assay for Fgf signaling also showed inhibition by injection of Lrig3
(Fig. 6B). This inhibition is
specific because Lrig3 could not inhibit Xbra induction by
activin, while Smad7, an inhibitor of activin/nodal signaling
(Bhushan et al., 1998), blocked
the activin effect (Fig. 6C).
Multiple Fgf ligands are expressed in the Xenopus embryo, and while
the signaling pathways downstream of these ligands are similar, varying
consequences of different Fgfs have been reported
(Fletcher et al., 2006;
Hardcastle et al., 2000).
Therefore, we checked the effect of Lrig3 on Fgf8-induced gene activation in
animal caps, injecting increasing doses of Fgf8a RNA with or without
a constant level of Lrig3 RNA. Induction of Xbra, Msx1 and
Wnt8 increased with the dose of Fgf8a, peaked at 100
pg/embryo, and decreased at higher doses. It has been shown previously that
overexpression of Fgf8a inhibits Xbra expression in the
whole embryo (Hardcastle et al.,
2000). Co-injection of Lrig3 with Fgf8a led to a
decrease of the expression of Xbra, Msx1 and Wnt8 at 100 pg
Fgf8a RNA, while at higher doses, Lrig3 had less effect
(Fig. 6D). Thus, the level of
Fgf at which peak induction is obtained shifted to higher values with the
addition of Lrig3. These results suggest that (1) induction of the three
mesodermal genes by Fgf8 is dose dependent with a discrete maximum; and (2)
Lrig3 attenuates the Fgf signal under these conditions.
|
;
Monsoro-Burq et al., 2005),
while injection of Fgf4 (LaBonne
and Bronner-Fraser, 1998) or Fgf8
(Monsoro-Burq et al., 2003)
RNA can induce NC markers in animal caps. Titration experiments in whole
embryos showed that Fgf8 has a dual role in this process as a modest increase
enhanced, but an excess of Fgf8 inhibited, NC formation
(Hong and Saint-Jeannet,
2007). To examine the role of Lrig3 in this system, we injected
different levels of Fgf8a with or without Lrig3 into animal
caps and tested for induction of NC genes
(Fig. 6E). At the lowest dose
used, Fgf8a RNA induced both Slug and Twist, and
addition of Lrig3 inhibited the induction. At higher doses, NC marker
induction by Fgf8a alone was reduced, but it was strongly enhanced by
co-injection of Lrig3. This is most obvious in the case of
Slug induction at 1 ng of Fgf8a, which changes from
undetectable to a robust induction upon addition of Lrig3. Even more
pronounced than in the case of mesodermal gene induction, addition of Lrig3
shifts the peak of NC gene induction to higher concentrations of Fgf. These
results are compatible with the conclusion that an optimal level of Fgf
signaling is required for NC induction, and that Lrig3 attenuates Fgf signal
transduction to bring the output into optimal range at the higher levels of
Fgf signaling.
Lrig3 interacts with Fgfr1 and decreases its level of expression
Lrig3 contains a signal peptide and a transmembrane domain, and a fraction
of Lrig3 is localized on the cell membrane
(Fig. 1). Lrig1 interacts with
all four ErbB receptors as well as Met receptors
(Gur et al., 2004;
Shattuck et al., 2007).
Therefore, we investigated the possible interaction of Lrig3 with Fgf
receptors. Lrig3 was co-immunoprecipitated with Xfgfr1 when both were
co-expressed in 293T cells, showing that these two membrane proteins can bind
each other (Fig. 7B; see Fig.
S7 in the supplementary material). To determine the Fgfr1-binding domains of
Lrig3, we constructed a series of deletion mutants, 
Cyto (deleting the
cytoplamic domain), LRR (deleting the LRR domains), IgC
(deleting the IG C2 domains), EC (deleting the extracellular portion
including LRR and IG C2 domains) and CytoTM (deleting the transmembrane
and cytoplasmic domains), and performed co-immunoprecipitation assays.
Interaction with Xfgfr1 was retained in constructs that contained all or even
a part of the ectodomains, but was lost when the entire ectodomain was deleted
(Fig. 7B). The intracellular
and transmembrane domains were not involved in the binding. We conclude that
the extracellular region of Lrig3 is responsible for binding of Fgfr1.
As Lrig1 negatively regulates the stabilities of EGFR and the Met receptor
(Gur et al., 2004;
Shattuck et al., 2007), we
next asked whether Lrig3 affects Fgf receptor metabolism. Xfgfr1 protein was
expressed at a much lower level in cells co-transfected with Lrig3 when
compared with controls (Fig.
7C). This result correlates with the reduced ERK phosphorylation
in the presence of Lrig3 that was seen in these cells
(Fig. 7C) and in animal caps
(Fig. 6A). These results
suggest a role for Lrig3 in the regulation of FGFR1 availability in the
cell.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
|
|
).
Inhibition of Wnt/β-catenin signaling by either Frizzled 7 MO
(Abu-Elmagd et al., 2006) or
Gsk3b (Saint-Jeannet et al.,
1997) blocks NC formation, while loss of Wnt1 and
Wnt3a in mice causes NC deficiencies
(Ikeya et al., 1997).
Furthermore, activation of Wnt signaling by overexpression of Lrp6
expands the expression of Slug in the embryo
(Tamai et al., 2000). In
Xenopus animal caps, canonical Wnt ligands, including Wnt1, Wnt3a,
Wnt7b and Wnt8, together with a BMP antagonist, such as Chordin or Noggin,
induce NC markers, but Wnt alone is ineffective
(Chang and Hemmati-Brivanlou,
1998; Deardorff et al.,
2001; Saint-Jeannet et al.,
1997). The importance of Wnt signaling is emphasized by the
presence of a TCF-binding site in the Slug promoter and its response
to Wnt signaling (Vallin et al.,
2001). Lrig3 is able to enhance Wnt signaling in animal caps, as
most clearly seen in the enhanced induction of several Fgf genes
(Fig. 5C). As Fgf signaling can
induce NC markers under certain conditions
(Fig. 6E), these observations
may account for the modest induction of NC genes in Wnt3a plus
Lrig3-injected animal caps (Fig.
5B).
A requirement for Lrig3 in NC formation was seen by knockdown of
Lrig3 using a splicing MO in whole embryos or animal caps
(Fig. 3B-E'',H-J'',
Fig. 4A-B). In animal caps we
find that the expression of Zic1 and Pax3 is not inhibited
by L3MO, while the expression of Slug, Foxd3 and Sox9 is. In
a proposed network of NC formation, Zic1 and Pax3 are
upstream of the other markers tested
(Monsoro-Burq et al., 2005;
Steventon et al., 2005), and
thus our results can be interpreted by placing Lrig3 function downstream of
Zic1 and Pax3. Indeed, L3MO prevented the expression of NC
markers induced by Zic1 and Pax3
(Fig. 4B). A Wnt signal is
required in combination with Zic1 and Pax3 in NC induction,
suggesting that Lrig3 has a role in modulating this signal at this position of
the regulatory hierarchy.
|
). Furthermore, knockdown of Fgf8 by MO inhibits NC
formation (Hong and Saint-Jeannet,
2007; Monsoro-Burq et al.,
2005), while Fgf8 is able to induce NC markers in animal cap
assays (Monsoro-Burq et al.,
2003). We showed in animal caps that Fgf8 was able to
induce NC markers at low but not at high doses, and addition of Lrig3
shifts peak induction to higher Fgf levels
(Fig. 6E). We suggest that
Lrig3 has a role in optimizing the Fgf signal during NC induction in
Xenopus.
Lrig3 as a modulator of different signaling cascades during embryonic development
The proposed role of Lrig3 in modulating the Fgf signal is compatible with
the observations that Lrig3 can inhibit Fgf-dependent ERK phosphorylation and
mesodermal gene induction in animal caps
(Fig. 6). As a transmembrane
protein containing leucine-rich repeats, Lrig3 might be expected to interact
with Fgf receptors, and we find that such an interaction can be observed after
expressing Lrig3 and Fgfr1 in cultured cells
(Fig. 7; see Fig. S7 in the
supplementary material). Lrig3 bears some resemblance to Xflrt3
(Bottcher et al., 2004), which
also contains leucine-rich repeats and interacts with Fgfr1, but functions as
a Fgf signaling enhancer. Human LRIG1 has been reported as an inhibitor of EGF
signaling (Gur et al., 2004),
and it is possible that Lrig3 also affects EGF signaling. EGF signaling and
the ErbB receptor family regulate mesoderm formation
(Nie and Chang, 2006) and
gastrulation movements (Nie and Chang,
2007) in Xenopus, although a role in NC formation has not
been identified. Human LRIG1 negatively regulates the stability of EGFR and
Met receptors through different mechanism. Lrig1 destabilizes EGFR by
enhancing its ubiquitination in a Cbl-dependant manner
(Gur et al., 2004), while it
destabilizes the Met receptor in a Cbl-independent manner
(Shattuck et al., 2007). Our
data suggest a negative influence of Lrig3 on Xfgfr1 expression levels,
expanding the range of apparent interactions between Lrig family members and
RTK receptors.
Although Lrig3 inhibited the function of Fgf in animal caps, it enhanced
the transcription of Fgf3, Fgf4 and Fgf8 induced by
Wnt3a. Wnt/β-catenin signaling has at least two distinct
functions in very early Xenopus development. First, maternal Wnt
signaling is involved in the establishment of the DV axis
(Kofron et al., 2007;
Tao et al., 2005). Second,
Wnt/β-catenin signaling is required for mesoderm induction through Fgf
and Nodal, and promotes ventral/lateral but restricts dorsal development
(Schohl and Fagotto, 2003)
(Christian and Moon, 1993;
Hoppler et al., 1996;
Hoppler and Kavanagh, 2007).
We observed an effect of Lrig3 on Wnt signaling mostly in the context of the
latter process. Induction of Siamois and Xnr3 by Wnt,
representing its role in axis formation, was only slightly affected by Lrig3,
and overexpression of Lrig3 in ventral blastomeres did not induce a
secondary axis (data not shown). However, induction of Xbra, and
notably of Fgf3, Fgf4 and Fgf8 by Wnt was stimulated by
Lrig3 (Fig. 5B), and Topflash
reporter activity was moderately enhanced by Lrig3 (see Fig. S6 in the
supplementary material). These observations suggest that Lrig3 can enhance
some but not all outcomes of the Wnt signal transduction pathway.
In this study, we show that Lrig3 is required for NC formation during early embryonic development by modulating Wnt and Fgf signaling, and we placed Lrig3 downstream of Zic1 and Pax3 in the NC regulatory network. As is well established, an attenuated BMP signal in concert with a canonical Wnt signal is crucial in NC formation. Lrig3 was induced in this context and stimulated some aspects of Wnt signaling. One of the outputs of the enhanced Wnt signal is the induction of Fgf genes, providing an additional signal required in NC specification. Similar to BMP, which is required in NC formation but must be kept at a low level, an optimum Fgf level must be maintained for effective NC induction. Lrig3, through its ability to attenuate Fgf signaling, may assure achievement of this optimal level. In this model, its ability to modulate different signaling cascades is the basis for the requirement for Lrig3 in NC induction in the embryo.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/7/1283/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Abu-Elmagd, M., Garcia-Morales, C. and Wheeler, G. N.
(2006). Frizzled7 mediates canonical Wnt signaling in neural
crest induction. Dev. Biol.
298,285
-298.[CrossRef][Medline]
Amaya, E., Stein, P. A., Musci, T. J. and Kirschner, M. W.
(1993). FGF signalling in the early specification of mesoderm in
Xenopus. Development
118,477
-487.[Abstract]
Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C.
(2003). The protooncogene c-myc is an essential regulator of
neural crest formation in xenopus. Dev. Cell
4, 827-839.[CrossRef][Medline]
Bhushan, A., Chen, Y. and Vale, W. (1998).
Smad7 inhibits mesoderm formation and promotes neural cell fate in Xenopus
embryos. Dev. Biol. 200,260
-268.[CrossRef][Medline]
Bottcher, R. T., Pollet, N., Delius, H. and Niehrs, C.
(2004). The transmembrane protein XFLRT3 forms a complex with FGF
receptors and promotes FGF signalling. Nat. Cell Biol.
6, 38-44.[CrossRef][Medline]
Bradley, L. C., Snape, A., Bhatt, S. and Wilkinson, D. G.
(1993). The structure and expression of the Xenopus Krox-20 gene:
conserved and divergent patterns of expression in rhombomeres and neural
crest. Mech. Dev. 40,73
-84.[CrossRef][Medline]
Carballada, R., Yasuo, H. and Lemaire, P.
(2001). Phosphatidylinositol-3 kinase acts in parallel to the ERK
MAP kinase in the FGF pathway during Xenopus mesoderm induction.
Development 128,35
-44.[Abstract]
Chang, C. and Hemmati-Brivanlou, A. (1998).
Neural crest induction by Xwnt7B in Xenopus. Dev.
Biol. 194,129
-134.[CrossRef][Medline]
Christian, J. L. and Moon, R. T. (1993).
Interactions between Xwnt-8 and Spemann organizer signaling pathways generate
dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes
Dev. 7,13
-28.
Chung, H. A., Yamamoto, T. S. and Ueno, N.
(2007). ANR5, an FGF target gene product, regulates gastrulation
in Xenopus. Curr. Biol.
17,932
-939.[CrossRef][Medline]
Cornell, R. A. and Eisen, J. S. (2005). Notch
in the pathway: the roles of Notch signaling in neural crest development.
Semin. Cell Dev. Biol.
16,663
-672.[CrossRef][Medline]
Curran, K. L. and Grainger, R. M. (2000).
Expression of activated MAP kinase in Xenopus laevis embryos: evaluating the
roles of FGF and other signaling pathways in early induction and patterning.
Dev. Biol. 228,41
-56.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P.
S. (2001). A role for frizzled 3 in neural crest development.
Development 128,3655
-3663.
Essex, L. J., Mayor, R. and Sargent, M. G.
(1993). Expression of Xenopus snail in mesoderm and prospective
neural fold ectoderm. Dev. Dyn.
198,108
-122.[Medline]
Eswarakumar, V. P., Lax, I. and Schlessinger, J.
(2005). Cellular signaling by fibroblast growth factor receptors.
Cytokine Growth Factor Rev.
16,139
-149.[CrossRef][Medline]
Fletcher, R. B., Baker, J. C. and Harland, R. M.
(2006). FGF8 spliceforms mediate early mesoderm and posterior
neural tissue formation in Xenopus. Development
133,1703
-1714.
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M.
(2002). Ectodermal Wnt function as a neural crest inducer.
Science 297,848
-851.
Gawantka, V., Delius, H., Hirschfeld, K., Blumenstock, C. and
Niehrs, C. (1995). Antagonizing the Spemann organizer: role
of the homeobox gene Xvent-1. EMBO J.
14,6268
-6279.[Medline]
Gupta, R. W. and Mayer, B. J. (1998).
Dominant-negative mutants of the SH2/SH3 adapters Nck and Grb2 inhibit MAP
kinase activation and mesoderm-specific gene induction by eFGF in Xenopus.
Oncogene 17,2155
-2165.[CrossRef][Medline]
Gur, G., Rubin, C., Katz, M., Amit, I., Citri, A., Nilsson, J.,
Amariglio, N., Henriksson, R., Rechavi, G., Hedman, H. et al.
(2004). LRIG1 restricts growth factor signaling by enhancing
receptor ubiquitylation and degradation. EMBO J.
23,3270
-3281.[CrossRef][Medline]
Hardcastle, Z., Chalmers, A. D. and Papalopulu, N.
(2000). FGF-8 stimulates neuronal differentiation through FGFR-4a
and interferes with mesoderm induction in Xenopus embryos. Curr.
Biol. 10,1511
-1514.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization:
an improved whole-mount method for Xenopus embryos. Methods Cell
Biol. 36,685
-695.[Medline]
Hong, C. S. and Saint-Jeannet, J. P. (2007).
The activity of pax3 and zic1 regulates three distinct cell fates at the
neural plate border. Mol. Biol. Cell
18,2192
-2202.
Hongo, I., Kengaku, M. and Okamoto, H. (1999).
FGF signaling and the anterior neural induction in Xenopus. Dev.
Biol. 216,561
-581.[CrossRef][Medline]
Hoppler, S. and Kavanagh, C. L. (2007). Wnt
signalling: variety at the core. J. Cell Sci.
120,385
-393.
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expression of a dominant-negative Wnt blocks induction of
MyoD in Xenopus embryos. Genes Dev.
10,2805
-2817.
Hopwood, N. D., Pluck, A. and Gurdon, J. B.
(1989). A Xenopus mRNA related to Drosophila twist is expressed
in response to induction in the mesoderm and the neural crest.
Cell 59,893
-903.[CrossRef][Medline]
Huang, X. and Saint-Jeannet, J. P. (2004).
Induction of the neural crest and the opportunities of life on the edge.
Dev. Biol. 275,1
-11.[CrossRef][Medline]
Ikeya, M., Lee, S. M., Johnson, J. E., McMahon, A. P. and
Takada, S. (1997). Wnt signalling required for expansion of
neural crest and CNS progenitors. Nature
389,966
-970.[CrossRef][Medline]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1995). eFGF is expressed in the dorsal midline of Xenopus
laevis. Int. J. Dev. Biol.
39,575
-579.[Medline]
Ishibashi, S. and Yasuda, K. (2001). Distinct
roles of maf genes during Xenopus lens development. Mech.
Dev. 101,155
-166.[CrossRef][Medline]
Kishi, M., Mizuseki, K., Sasai, N., Yamazaki, H., Shiota, K.,
Nakanishi, S. and Sasai, Y. (2000). Requirement of
Sox2-mediated signaling for differentiation of early Xenopus neuroectoderm.
Development 127,791
-800.[Abstract]
Kofron, M., Birsoy, B., Houston, D., Tao, Q., Wylie, C. and
Heasman, J. (2007). Wnt11/beta-catenin signaling in both
oocytes and early embryos acts through LRP6-mediated regulation of axin.
Development 134,503
-513.
Kos, R., Reedy, M. V., Johnson, R. L. and Erickson, C. A.
(2001). The winged-helix transcription factor FoxD3 is important
for establishing the neural crest lineage and repressing melanogenesis in
avian embryos. Development
128,1467
-1479.[Abstract]
Kovalenko, D., Yang, X., Nadeau, R. J., Harkins, L. K. and
Friesel, R. (2003). Sef inhibits fibroblast growth factor
signaling by inhibiting FGFR1 tyrosine phosphorylation and subsequent ERK
activation. J. Biol. Chem.
278,14087
-14091.
LaBonne, C. and Bronner-Fraser, M. (1998).
Neural crest induction in Xenopus: evidence for a two-signal model.
Development 125,2403
-2414.[Abstract]
Laederich, M. B., Funes-Duran, M., Yen, L., Ingalla, E., Wu, X.,
Carraway, K. L., 3rd and Sweeney, C. (2004). The leucine-rich
repeat protein LRIG1 is a negative regulator of ErbB family receptor tyrosine
kinases. J. Biol. Chem.
279,47050
-47056.
Le Douarin, N. and Kalcheim, C. (1999).
The Neural Crest. Cambridge: Cambridge University
Press.
Lombardo, A., Isaacs, H. V. and Slack, J. M.
(1998). Expression and functions of FGF-3 in Xenopus development.
Int. J. Dev. Biol. 42,1101
-1107.[Medline]
Luo, T., Matsuo-Takasaki, M., Thomas, M. L., Weeks, D. L. and
Sargent, T. D. (2002). Transcription factor AP-2 is an
essential and direct regulator of epidermal development in Xenopus.
Dev. Biol. 245,136
-144.[CrossRef][Medline]
Luo, T., Lee, Y. H., Saint-Jeannet, J. P. and Sargent, T. D.
(2003). Induction of neural crest in Xenopus by transcription
factor AP2alpha. Proc. Natl. Acad. Sci. USA
100,532
-537.
Luo, T., Xu, Y., Hoffman, T. L., Zhang, T., Schilling, T. and
Sargent, T. D. (2007). Inca: a novel p21-activated
kinase-associated protein required for cranial neural crest development.
Development 134,1279
-1289.
Mayor, R., Essex, L. J., Bennett, M. F. and Sargent, M. G.
(1993). Distinct elements of the xsna promoter are required for
mesodermal and ectodermal expression. Development
119,661
-671.
Mayor, R., Morgan, R. and Sargent, M. G.
(1995). Induction of the prospective neural crest of Xenopus.
Development 121,767
-777.[Abstract]
Monsoro-Burq, A. H., Fletcher, R. B. and Harland, R. M.
(2003). Neural crest induction by paraxial mesoderm in Xenopus
embryos requires FGF signals. Development
130,3111
-3124.
Monsoro-Burq, A. H., Wang, E. and Harland, R.
(2005). Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals
during Xenopus neural crest induction. Dev. Cell
8, 167-178.[CrossRef][Medline]
Nakata, K., Nagai, T., Aruga, J. and Mikoshiba, K.
(1998). Xenopus Zic family and its role in neural and neural
crest development. Mech. Dev.
75, 43-51.[CrossRef][Medline]
Nie, S. and Chang, C. (2006). Regulation of
early Xenopus development by ErbB signaling. Dev. Dyn.
235,301
-314.[CrossRef][Medline]
Nie, S. and Chang, C. (2007). Regulation of
Xenopus gastrulation by ErbB signaling. Dev. Biol.
303,93
-107.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1975).
Normal Table of Xenopus laevis (Daudin). Amsterdam:
North-Holland.
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M.
(2000). Ectopic Hoxa2 induction after neural crest migration
results in homeosis of jaw elements in Xenopus.
Development 127,5367
-5378.[Abstract]
Pohl, B. S. and Knochel, W. (2001).
Overexpression of the transcriptional repressor FoxD3 prevents neural crest
formation in Xenopus embryos. Mech. Dev.
103,93
-106.[CrossRef][Medline]
Ribisi, S., Jr, Mariani, F. V., Aamar, E., Lamb, T. M., Frank,
D. and Harland, R. M. (2000). Ras-mediated FGF signaling is
required for the formation of posterior but not anterior neural tissue in
Xenopus laevis. Dev. Biol.
227,183
-196.[CrossRef][Medline]
Saint-Jeannet, J. P., He, X., Varmus, H. E. and Dawid, I. B.
(1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and
Wnt-3a. Proc. Natl. Acad. Sci. USA
94,13713
-13718.
Sato, T., Sasai, N. and Sasai, Y. (2005).
Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus
ectoderm. Development
132,2355
-2363.
Schlessinger, J. (2004). Common and distinct
elements in cellular signaling via EGF and FGF receptors.
Science 306,1506
-1507.
Schohl, A. and Fagotto, F. (2003). A role for
maternal beta-catenin in early mesoderm induction in Xenopus. EMBO
J. 22,3303
-3313.[CrossRef][Medline]
Shattuck, D. L., Miller, J. K., Laederich, M., Funes, M.,
Petersen, H., Carraway, K. L., 3rd and Sweeney, C. (2007).
LRIG1 is a novel negative regulator of the Met receptor and opposes Met and
Her2 synergy. Mol. Cell. Biol.
27,1934
-1946.
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis: A
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and
Herrmann, B. G. (1991). Expression of a Xenopus homolog of
Brachyury (T) is an immediate-early response to mesoderm induction.
Cell 67,79
-87.[CrossRef][Medline]
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and
Saint-Jeannet, J. P. (2002). The transcription factor Sox9 is
required for cranial neural crest development in Xenopus.
Development 129,421
-432.[Medline]
Steventon, B., Carmona-Fontaine, C. and Mayor, R.
(2005). Genetic network during neural crest induction: from cell
specification to cell survival. Semin. Cell Dev. Biol.
16,647
-654.[CrossRef][Medline]
Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A. and
Stern, C. D. (2000). Initiation of neural induction by FGF
signalling before gastrulation. Nature
406, 74-78.[CrossRef][Medline]
Suga, A., Hikasa, H. and Taira, M. (2006).
Xenopus ADAMTS1 negatively modulates FGF signaling independent of its
metalloprotease activity. Dev. Biol.
295, 26-39.[CrossRef][Medline]
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C.,
Katsuyama, Y., Hess, F., Saint-Jeannet, J. P. and He, X.
(2000). LDL-receptor-related proteins in Wnt signal transduction.
Nature 407,530
-535.[CrossRef][Medline]
Tannahill, D., Isaacs, H. V., Close, M. J., Peters, G. and
Slack, J. M. (1992). Developmental expression of the Xenopus
int-2 (FGF-3) gene: activation by mesodermal and neural induction.
Development 115,695
-702.[Abstract]
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D.,
Asashima, M., Wylie, C. C., Lin, X. and Heasman, J. (2005).
Maternal wnt11 activates the canonical wnt signaling pathway required for axis
formation in Xenopus embryos. Cell
120,857
-871.[CrossRef][Medline]
Tsang, M. and Dawid, I. B. (2004). Promotion
and attenuation of FGF signaling through the Ras-MAPK pathway. Sci.
STKE 2004,pe17
.
Tsang, M., Friesel, R., Kudoh, T. and Dawid, I. B.
(2002). Identification of Sef, a novel modulator of FGF
signalling. Nat. Cell Biol.
4, 165-169.[CrossRef][Medline]
Tsang, M., Maegawa, S., Kiang, A., Habas, R., Weinberg, E. and
Dawid, I. B. (2004). A role for MKP3 in axial patterning of
the zebrafish embryo. Development
131,2769
-2779.
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Umbhauer, M., Marshall, C. J., Mason, C. S., Old, R. W. and
Smith, J. C. (1995). Mesoderm induction in Xenopus caused by
activation of MAP kinase. Nature
376, 58-62.[CrossRef][Medline]
Vallin, J., Thuret, R., Giacomello, E., Faraldo, M. M., Thiery,
J. P. and Broders, F. (2001). Cloning and characterization of
three Xenopus slug promoters reveal direct regulation by Lef/beta-catenin
signaling. J. Biol. Chem.
276,30350
-30358.
Whitman, M. and Melton, D. A. (1992).
Involvement of p21ras in Xenopus mesoderm induction.
Nature 357,252
-254.[CrossRef][Medline]
Yanfeng, W., Saint-Jeannet, J. P. and Klein, P. S.
(2003). Wnt-frizzled signaling in the induction and
differentiation of the neural crest. BioEssays
25,317
-325.[CrossRef][Medline]
Yokota, C., Kofron, M., Zuck, M., Houston, D. W., Isaacs, H.,
Asashima, M., Wylie, C. C. and Heasman, J. (2003). A novel
role for a nodal-related protein; Xnr3 regulates convergent extension
movements via the FGF receptor. Development
130,2199
-2212.
Yoshitake, Y., Howard, T. L., Christian, J. L. and Hollenberg,
S. M. (1999). Misexpression of Polycomb-group proteins in
Xenopus alters anterior neural development and represses neural target genes.
Dev. Biol. 215,375
-387.[CrossRef][Medline]
Zhao, H., Cao, Y. and Grunz, H. (2001).
Isolation and characterization of a Xenopus gene (XMLP) encoding a MARCKS-like
protein. Int. J. Dev. Biol.
45,817
-826.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  K. Tanegashima, H. Zhao, M. L. Rebbert, and I. B. Dawid Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo Development, November 1, 2009; 136(21): 3543 - 3548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Li, S. Kuriyama, M. Moreno, and R. Mayor The posteriorizing gene Gbx2 is a direct target of Wnt signalling and the earliest factor in neural crest induction Development, October 1, 2009; 136(19): 3267 - 3278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. B. Dawid Differential Gene Expression in Vertebrate Embryos J. Biol. Chem., May 15, 2009; 284(20): 13277 - 13283. [Full Text] [PDF]
|
|
|
|
|
|
V. E. Abraira, T. del Rio, A. F. Tucker, J. Slonimsky, H. L. Keirnes, and L. V. Goodrich Cross-repressive interactions between Lrig3 and netrin 1 shape the architecture of the inner ear Development, December 15, 2008; 135(24): 4091 - 4099. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
kb unspliced band, using intron-spanning primers for pseudoalleles
Lrig3A and Lrig3B. ODC was loading control. (B-D)
Phenotypes induced by L3MO. The morphants showed severe anterior defects,
delayed or failed neural fold closure, and shortened axis. (C,D) Embryos were
injected with 30 ng L3MO; uninjected control in B. (E-G) The phenotype
was rescued by co-injection of Lrig3 mRNA. (E) Uninjected control;
(F) L3MO (30 ng); (G) 30 ng of L3MO plus 20 pg Lrig3 mRNA.
