|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 March 2008
doi: 10.1242/dev.015123
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Psychiatry, and Department of Neurology and Neuroscience, Weill Medical College of Cornell University, 1300 York Avenue, Box 244, New York, NY 10021, USA.
* Author for correspondence (e-mail: SAA2007{at}med.cornell.edu)
Accepted 2 February 2008
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Cell fate determination, GABA, Medial ganglionic eminence, Nkx2.1, Parvalbumin, Somatostatin, Mouse
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Livesey and Cepko, 2001;
Shirasaki and Pfaff, 2002),
further advances have occurred. Despite these advances, and the tremendous
relevance to human neuropsychiatric illnesses, there has been relatively
little progress in cracking the `molecular codes' for specifying neuronal
subtypes of the mammalian forebrain
(Schuurmans et al., 2004;
Zhao et al., 2003).
Beyond the issues of functional pleiotropy and redundancy, a key reason for
this lag is the lengthy delay between the final cell cycle, when much of the
crucial specification-related signaling is likely to occur
(McConnell and Kaznowski,
1991; Xu et al.,
2005), and the appearance of the mature neuronal phenotype. This
delay dictates that the readout of any manipulation of cell fate in progenitor
cells may only be assessable weeks later, in the context of many potential
confounding influences of that manipulation on neuronal development. In this
paper we present a transfection/transplantation method for studying the
genetic control of neuronal fate determination in the developing mammalian
forebrain.
Recent evidence indicates that, at least in rodents and ferrets, the large
majority of cortical interneurons originate in the subcortical telencephalon
(for a review, see Wonders and Anderson,
2006). Despite advances in determining the origins, migratory
pathways and the regulation of interneuron migration, little is known about
the specification of distinct subgroups of cortical interneurons. Roughly 70%
of cortical interneurons can be divided into two practically non-overlapping
groups based on their expression of the calcium-binding proteins parvalbumin
(PV) or neuropeptide somatostatin (SST)
(Gonchar and Burkhalter, 1997;
Tamamaki et al., 2003). Both
of these subgroups appear to originate mainly within the medial ganglionic
eminence (MGE) (Butt et al.,
2005; Valcanis and Tan,
2003; Wichterle et al.,
2001; Xu et al.,
2004), where their fate determination depends on the transcription
factors NKX2.1 and LHX6 (Liodis et al.,
2007; Xu et al.,
2004). Expression of SST and PV matures postnatally, with PV
expression only beginning in rodent cortex during the second postnatal week
(Alcantara et al., 1996).
Nkx2.1 is expressed in the MGE and preoptic region of the pallidal
telencephalon (Sussel et al.,
1999) (see Fig. S1 in the supplementary material). Over 90% of
S-phase cells express Nkx2.1 in both the ventricular and
subventricular zones of the MGE (Xu et
al., 2005). These progenitors produce oligodendrocytes and
interneurons of the striatum and cerebral cortex
(Kessaris et al., 2006;
Marin and Rubenstein, 2001)
and projection neurons of the globus pallidus
(Xu et al., 2008). As cells
migrate out of the MGE, Nkx2.1 expression is downregulated in
cortical interneurons but is maintained in subgroups of striatal interneurons
postnatally (Marin et al.,
2000). As they exit the proliferative zone, most MGE-derived cells
begin to express LHX6 (Grigoriou et al.,
1998), a homeodomain-containing transcription factor that is not
detectable in the telencephalon of Nkx2.1-null embryos
(Sussel et al., 1999).
Lhx6 continues to be expressed in many interneurons, including most
of those that go on to express PV or SST, as they migrate to and then
differentiate within the cerebral cortex (see Fig. S1 in the supplementary
material) (Cobos et al., 2005;
Fogarty et al., 2007;
Gong et al., 2003;
Lavdas et al., 1999;
Liodis et al., 2007).
Here we use genetic gain- and loss-of-function manipulations in mouse embryonic slice cultures, followed by transplantation into cortical environments in vitro and in vivo, to further examine the role of Nkx2.1 in the specification of MGE-derived (PV- or SST-expressing) cortical interneuron subgroups. We demonstrate that the LIM-homeodomain transcription factor gene Lhx6 is activated by and appears to be a direct target of NKX2.1. Like Nkx2.1 itself, Lhx6 is sufficient to rescue both neurochemical and morphological aspects of Nkx2.1-/- MGE-derived interneurons. In addition, at least for the specification of the SST-expressing phenotype, Lhx6 is required around the time of cell cycle exit and not postnatally in mature interneurons. These results and the system presented lay important groundwork for further studies on the transcriptional regulation of interneuron fate in the mammalian forebrain.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) on a CD1 background
(Xu et al., 2004) and
non-transgenic CD1 strain mice were used. All animal procedures were
undertaken according to the guidelines of the Institutional Animal Care and
Use Committee at the Weill Cornell Medical College.
Gene constructs, slice electroporation and transplantation
Slice electroporation (EP) was conducted as described
(Stuhmer et al., 2002;
Xu et al., 2005) using vectors
concentrated with Endotoxin-free DNA Maxiprep Kits (Qiagen). Full-length cDNAs
for Nkx2.1 [from John Rubenstein (UCSF, San Francisco, CA) and Oscar
Marin (Universidad Miguel Hernández, Alicante, Spain)] and
Lhx6 (from Vassilis Pachnis, MRC, London, UK) were cloned into
pCAG-IRES-GFP (from Connie Cepko, Harvard Medical College, Boston, MA) and
their expression confirmed by immunofluorescence (see
Fig. 1 for NKX2.1). VP16-Nkx2.1
is a gift from Parvis Minoo (Li et al.,
2002). The Nkx2.1 homeodomain point mutant (Val45Phe)
(Krude et al., 2002) was
generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La
Jolla, CA) and subcloned into the pCAGGS vector to produce
pNkx2.1
HD.
To generate the Lhx6 RNAi vector, a sequence encoding a small
hairpin (sh) targeting the distal end of exon 2 (sense strand,
5'-GTCAGACGCAGAGGCCTTGGCCATGGCCAAGGCCTCTGCGTCTGACTTTTTT;
antisense strand,
5'-agcttAAAAAAGTCAGACGCAGAGGCCTTGGCCATGGCCAAGGCCTCTGCGTCTGACggcc;
lowercase letters indicate nucleotides used in cloning; underlined nucleotides
indicate loop region) was inserted into the ApaI and HindIII
sites in pSilencer 1.0 (a gift from Yang Shi)
(Sui et al., 2002). This
shRNAi species has previously been demonstrated to greatly reduce LHX6
abundance in MGE-derived cells and to reduce interneuron migration to the
cortex (Alifragis et al.,
2004). To enable visualization of the RNAi-transfected cells with
a single plasmid, the pU6-shLhx6 construct was then inserted into the
SpeI site in pCAG-IRES-GFP (shLhx6-GFP). The Scramble RNAi sequence
(Ambion) was also subcloned into the same site in the pCAG-IRES-GFP vector. To
ensure that nearly all Nkx2.1-transfected cells also received the
RNAi vector, 2 mg/ml of this vector and 1 mg/ml of pNkx2.1 were microinjected
into the slice for EP. This procedure results in over 90% co-labeling of
NKX2.1 and GFP in transplanted cells (data not shown) (see also
Stuhmer et al., 2002).
For transplantation studies, 12-16 hours after EP GFP epifluorescence was
imaged, then the regions of the MGE with the highest densities of GFP+ cells
were dissected out, mechanically dissociated, and counted on a hemocytometer
under epifluorescence to calculate the percentage of all cells that were GFP+
(usually 10-15%). In the case of slices from Nkx2.1-null embryos, in
which a morphologically identifiable MGE does not exist
(Sussel et al., 1999), tissue
was targeted for EP and dissection from the same approximate dorsal-ventral
level as the MGE of control slices, as described
(Xu et al., 2004).
For in vitro transplants, the feeder cells were prepared from neonatal
cortex as described (Xu et al.,
2004; Xu et al.,
2005) and the transfected cells were plated at a density of 1000
GFP+ cells per well of a 16-well glass chamber slide (36 mm2;
Lab-Tek). For in vivo transplants, cells were injected into S1 cortex 1 mm
below the pial surface of cold-anaesthetized neonatal pups (day of birth or
P1), using a microinjector (Nanoinject II, Drummond). Per injection site,
10,000-20,000 cells were placed per hemisphere to obtain at least 1000 GFP+
cells per transplant. At P30 the brains were removed, fixed with 4%
paraformaldehyde, and sectioned on a vibratome at 50 µm.
RT-PCR
Slices from Nkx2.1 nulls were electroporated with pNkx2.1-IRES-GFP
or pGFP control (n=3). After 12 hours the MGE-like regions were
dissociated and sorted by FACS (Vantage, Becton-Dickinson) producing a yield
of 3000-5000 cells. Total RNA was purified (RNeasy Kit, Qiagen) and subjected
to reverse transcription (Omniscript reverse transcriptase, Qiagen) and PCR
(HotStar Kit, Qiagen). Primers included Lhx6
(5'-TGATGGCCCAGCCAG and 5'-GTCCATCTTGCAGTAGATC; 422 bp product),
Nkx2.1 (5'-AACAGCGGCCATGCAGCAGCAC and 5'-CCATGTTCTTG CT
CACGTCC; 315 bp) and β-actin (5'-GAGCTGCCTGACGGCCAGGT and
5'-TACTCCTGCTTGCTGATCCA; 364 bp).
Immunodetection
Immunofluorescence labeling of cells in dissociated cultures was conducted
as described (Xu et al.,
2004), and labeling of antigens in postnatal brain sections was
conducted floating. Primary antibodies used included GFP (rabbit or chick;
Molecular Probes), GABA (rabbit; Sigma), LHX6 [rabbit, a gift from Vassilis
Pachnis (Lavdas et al.,
1999)], neuropeptide Y (rabbit; Immunostar), NKX2.1 (mouse; Lab
Vision), somatostatin (rat; Chemicon), parvalbumin (mouse; Chemicon),
calretinin (rabbit; Chemicon), Kv3.1 (rabbit, a gift from Bernardo Rudy, New
York University, NY) and PCNA (mouse IgG; Novocastra). Alexa line secondary
antibodies (Molecular Probes) were used.
Lhx6 promoter analyses
Phylogenetic sequence comparisons of the Lhx6 locus were performed
using the ECR browser
(http://www.dcode.org)
sequence alignment and visualization tool
(Ovcharenko et al., 2004b).
rVISTA
(http://rvista.dcode.org/)
(Loots and Ovcharenko, 2004;
Ovcharenko et al., 2004a) was
used to identify potential transcription factor binding sites
(http://zpicture.dcode.org/).
Chromatin immunoprecipitation was conducted on E12.5 MGE samples as per the manufacturer's instructions (Upstate, 17-295), using a mouse anti-NKX2.1 monoclonal antibody (Lab Vision). A 119 bp PCR fragment of the Lhx6 promoter that includes a consensus NKX2.1 binding sequence at position -240 bp relative to the putative translational start site was identified using primers 5'-AGTCCTAACTTTGTAGTG and 5'-TTTCCCCCTCAGAGGCTTG.
To generate Lhx6 reporter constructs, a 2.1 kb fragment of 5' Lhx6 genomic region (Fig. 5) was cloned from BAC RP23-2D16 by PCR [5'-ACTAGT(SpeI)CAGCCTTTAGAAGCTGGTGC and 5'-TCTAGA(XbaI)-CCCTGGCTGGGCCATC]. This fragment was inserted in place of the CAG promoter in pCAG-IRES-GFP to produce p5'-Lhx6-IRES-GFP. Site directed mutagenesis (using the oligo sequence 5'-CCCTCTCCCTGCACTTAACCCGTGATCGCTTAGTTCCTTTTGCAATCCAAGCC; QuikChange Site-directed Mutagenesis Kit, Stratagene) was then used to remove the putative NKX2.1 binding domain (GCTCTTGAAGTA) from -239 to -250 nt.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). To determine whether rescued expression of Nkx2.1
in the ventral telencephalon of slices from Nkx2.1-/-
mutants can rescue the PV or SST fate of these cells, telencephalic slices
were prepared from Nkx2.1-/- mouse embryos at embryonic
day (E) 12.5, and an expression vector, pNkx2.1-GFP, was introduced into the
MGE* by electroporation (Fig.
1 and see Fig. S2 in the supplementary material). After 1 day in
vitro (DIV), subregions of the MGE* with the highest proportion of
transfected cells were dissected, dissociated, plated over a feeder culture
made from neonatal cortex and maintained for 14-28DIV (see Fig. S2 in the
supplementary material). In other experiments, cells were transplanted
directly into the cortical plate of the somatosensory cortex of neonatal pups
and then examined in tissue sections after 30 days
(Fig. 1). After fixation, the
fates of cells with neuronal morphology (the vast majority of surviving cells
from donors at this age of E12.5+1DIV) were determined by immunofluorescence
for GFP and the given interneuron subgroup marker. Similar transplantations of
cells directly from the MGE of transgenic mice into neonatal cortex have been
shown to give rise to neurons with neurochemical and physiological
characteristics of inhibitory interneurons
(Alvarez-Dolado et al., 2006;
Cobos et al., 2005).
|
), Nkx2.1-/- cells transfected with
control vector almost never gave rise to PV+, SST+ or NPY+ interneurons
(Table 1). In marked contrast,
transfection with Nkx2.1 cDNA resulted in substantial rescue of PV or
SST expression (Table 1,
Fig. 1I-L). In addition,
neurons expressing NPY, a neuropeptide that shares about 50% co-labeling with
SST in mouse cortex, were also rescued
(Fig. 1M,N). Similar results
were obtained whether cells were plated onto a cortical feeder layer or
transplanted into the neonatal cortical plate in vivo
(Table 1,
Fig. 1 and see Fig. S2 in the
supplementary material).
|
;
Fogarty et al., 2007;
Gong et al., 2003;
Lavdas et al., 1999;
Liodis et al., 2007) (see Fig.
S1 in the supplementary material); LHX6 is not detectable in the
MGE* of Nkx2.1-null embryos
(Sussel et al., 1999). Indeed,
RT-PCR detected the induction of Lhx6 expression in the
MGE* of Nkx2.1-null embryos transfected with
Nkx2.1 (Fig. 2A).
To further confirm that Lhx6 can be induced in
Nkx2.1-/- MGE* progenitors after transfection
with pNkx2.1-GFP, rescue- and control-transfected neurons were assessed after
in vivo transplantation by immunofluorescence labeling with an LHX6-specific
polyclonal antibody (Lavdas et al.,
1999; Liodis et al.,
2007). LHX6 protein was detectable in more than half (54/93=58%,
n=3) of the Nkx2.1-/- cells transfected with the
Nkx2.1 cDNA. Nearly all of those rescued for expression of PV or SST
co-labeled with LHX6 (56/60=93%), whereas LHX6 was detectable in very few of
those that received the control vector (3/90).
|
). This
result has recently been confirmed and extended to the fate determination of
PV- and SST-expressing interneuron subgroups in cortex by loss-of-function
analysis (Liodis et al.,
2007). To determine whether the induction of Lhx6 is
required downstream of Nkx2.1 in the specification of PV- and
SST-expressing interneurons, we conducted loss-of-function studies using the
Nkx2.1 rescue/transplantation paradigm. The same pU6-shRNAi sequence
used by Alifragis and colleagues was cloned into a vector that also expresses
GFP (p-shLhx6-GFP). The effectiveness of this Lhx6 RNAi construct at
knocking down LHX6 expression was confirmed in primary cultures (see Fig. S3
in the supplementary material). To examine whether rescue of the Nkx2.1-/- interneuron phenotype by Nkx2.1 expression requires the induction of Lhx6, we co-electroporated shLhx6-GFP with pNkx2.1 into the MGE* of Nkx2.1-/- slices. As expected, Lhx6 shRNAi greatly reduced the induction of Lhx6 in Nkx2.1-/- MGE-like cells that were also transfected with pNkx2.1 (Fig. 2B). Remarkably, shLhx6 RNAi nearly eliminated the rescue of SST- and PV-expressing cells by pNkx2.1 (Fig. 2C; n=3, P<0.01 for SST and P<0.03 for PV).
Lhx6 expression also rescues the interneuron fate defect of the Nkx2.1-/- MGE*
The ability of Lhx6 shRNAi to block the Nkx2.1 rescue
experiment raises the possibility that Lhx6 functions downstream of
Nkx2.1 in the specification of cortical interneurons. To determine
whether Lhx6 itself can rescue the Nkx2.1-/-
interneuron defect, full-length Lhx6 cDNA was cloned into the
pCAG-IRES-GFP vector. When expressed within the MGE* of
Nkx2.1-/- slices, pLhx6-GFP also lead to a substantial
rescue of PV-, SST- and NPY-expressing cells
(Fig. 3,
Table 1). In those cells
expressing PV, roughly 95% also express the potassium channel Kv3.1 (also
known as KCNC1 - Mouse Genome Informatics)
(Fig. 3A-D) that is closely
associated with PV expression in cortical interneurons
(Weiser et al., 1995). Like
PV, Kv3.1 was very rarely expressed by control-transfected
Nkx2.1-/- cells from the MGE* (1/57=1.8%, from
three transplantations).
To determine whether, in addition to these neurochemical makers, morphological aspects of interneuron differentiation were rescued in this paradigm, Nkx2.1-/- progenitors from the MGE* that were transfected with Lhx6 or control vector were examined for the presence of dendritic spines. Since cortical interneurons are generally smooth or sparsely spiny, the frequency of heavily spiny versus aspiny or sparsely spiny neurons can provide a measure of whether morphological as well as neurochemical characteristics of Nkx2.1-/- MGE*-derived interneurons are rescued by Lhx6. Indeed, Nkx2.1-/- progenitors from the MGE* that were transfected with Lhx6 had a significantly lower likelihood than control-transfected cells of being heavily spiny (42% of GFP+ cells in control transfections, 25% in Lhx6 transfections, P<0.03; Fig. 3I-K). Of Lhx6-transfected Nkx2.1-/- cells that expressed PV or SST, nearly all (70/72 examined) had a non- or sparsely spiny morphology.
The large majority of Lhx6-transfected Nkx2.1-/- cells also
expressed detectable levels of GABA (data not shown), but the interpretation
of this result is complicated by the fact that GABA is also expressed by most
subcortical projection neurons and is not reduced in the pallidum of
Nkx2.1 mutants (Sussel et al.,
1999), in pallidal cells transfected by RNAi for Lhx6
(Alifragis et al., 2004), or in
the cortex of Lhx6-null mutants
(Liodis et al., 2007). In
summary, these results suggest that Lhx6 directs both neurochemical
and morphological aspects of MGE-derived interneuron fate, independently of
the expression of GABA.
|
), and the
induction of Lhx6 in the Nkx2.1 rescue experiment
(Fig. 2), raise the question of
whether NKX2.1 directly activates Lhx6 expression. Whereas NKX2.2
regulates neuronal fate in the ventral spinal cord by transcriptional
repression (Muhr et al.,
2001), NKX2.1 is known to directly activate the transcription of
target genes in the lung and thyroid (Li
et al., 2000; Mizuno et al.,
1991; Tell et al.,
1998). To examine this issue we first compared the mouse, human,
chicken, fugu and frog sequences over approximately 10 kb of genomic DNA
5' to the predicted Lhx6 start site. There are multiple regions
of high homology, particularly within 500 bp of the putative translational
start site (Fig. 4A). One of
these regions includes a consensus NK2 family binding sequence [T(T/C)AAGT
(A/G)(G/C)TT] (Watada et al.,
2000) located at -240 bp (Fig.
4B). To determine whether NKX2.1 binds this region, chromatin
immunoprecipitation was conducted on lysates of MGE from E12.5 embryos. PCR on
the DNA pulled down using an anti-NKX2.1 monoclonal antibody (see Materials
and methods) indicated that a 119 bp fragment including the above sequence
appears to bind NKX2.1 in vivo (Fig.
4C). To determine whether this sequence promotes the transcription of Lhx6 within the Nkx2.1 expression domain, an IRES-GFP construct was cloned into the 3' end of a 2.1 kb fragment of the Lhx6 promoter (p5'-Lhx6-GFP). Electroporation (EP) of this construct into the MGE of E13.5 slices resulted in robust expression of GFP (Fig. 5A-C; n=5). By contrast, little expression was apparent upon EP into either the dorsal midline of wild-type embryos (Fig. 5A-C; n=5), or into the lateral ganglionic eminence (LGE) or cortex (Fig. 6A-C). Consistent with the requirement for NKX2.1 to drive the expression of Lhx6, no GFP expression was seen after EP into the MGE-like region of Nkx2.1-/- slices (Fig. 5D-F; n=5). However, Co-EP of p5'-Lhx6-GFP together with an Nkx2.1 expression vector restored GFP expression in the MGE-like region of Nkx2.1-/- slices (Fig. 5G-I; n=5). Similarly, Co-EP of p5'-Lhx6-GFP together with an Nkx2.1 expression vector was able to drive p5'-Lhx6-GFP expression in the LGE and cortex of wild-type slices (Fig. 6D-F; n=5).
The above results suggest that expression of this Lhx6 promoter
fragment in the telencephalon requires the presence of Nkx2.1. To
determine whether the NKX2.1 binding sequence in the promoter fragment of
p5'-Lhx6-GFP is necessary for Lhx6 expression within the MGE,
this sequence was removed from the reporter construct, generating
p5'-Lhx6-GFP. EP of p5'-Lhx6-GFP into the MGE of
wild-type embryos resulted in very limited expression of GFP
(Fig. 5J-L; n=5).
Since ectopic expression of Nkx2.1 was able to drive expression of
pLhx6-GFP in the LGE and cortex (Fig.
6D-F), and this effect was nearly eliminated when the NKX2.1
consensus binding sequence is removed from the reporter construct
(Fig. 6J-L), we next tested
whether the DNA-binding region of NKX2.1 is required for this effect. A point
mutation that is associated with a hereditary movement disorder in humans
(Krude et al., 2002),
resulting in a Val45Phe alteration in the homeodomain, was introduced into the
Nkx2.1 expression vector (pNkx2.1HD). This mutation greatly
reduced the ability of NKX2.1 to bind to its consensus target sequence. Co-EP
of pNkx2.1HD together with pLhx6-GFP into the LGE resulted in minimal
activation of the reporter (Fig.
6, compare G-I with D-F). Finally, a vector containing the VP16
transcriptional activation sequence fused to Nkx2.1 was tested
(VP16Nkx2.1) (Li et al.,
2002). VP16Nkx2.1 strongly activated the pLhx6-GFP reporter,
suggesting that NKX2.1 does not indirectly activate Lhx6
transcription by repressing the expression of an intermediate gene.
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Nkx2.1-null mice fail to generate normal MGE tissue
(Sussel et al., 1999) and are
unable to generate cortical interneurons expressing PV or SST
(Xu et al., 2004), distinct
subgroups that are known to originate primarily from the MGE
(Wonders and Anderson, 2006).
By transfecting Nkx2.1 back into the MGE-like region of
Nkx2.1-/- slices, culturing the slice for 24 hours and
then transplanting the transfected cells into the cortex of neonatal pups,
both the PV and the SST phenotypes can be rescued in vivo
(Fig. 1,
Table 1). Parallel experiments
in which the Nkx2.1-transfected cells are cultured on a feeder layer
of dissociated neonatal cortex also show substantial rescue of these
neurochemical phenotypes, whereas the expression of these phenotypes in
Nkx2.1-null cells transfected with the control plasmid is almost
non-existent (Table 1; see Fig.
S2 in the supplementary material).
In addition to the neurochemical phenotype, two additional lines of
evidence suggest that the rescued cells are interneuron-like. First, they
display morphological features of interneurons, including curved terminals
characteristic of large PV+ and smaller SST+ basket cells, and aspiny or
sparsely spiny dendrites. Second, more than 90% of the
Nkx2.1-/- neurons rescued for the PV or SST phenotype are
immunopositive for LHX6, a transcription factor expressed in most MGE-derived
interneurons of the striatum and cortex from around the time that they exit
the cell cycle through maturity (Cobos et
al., 2005; Fogarty et al.,
2007; Gong et al.,
2003; Lavdas et al.,
1999; Liodis et al.,
2007) (see Fig. S1 in the supplementary material).
Lhx6 specifies interneuron fates downstream of Nkx2.1
The expression patterns of Nkx2.1 and Lhx6 (see Fig. S1
in the supplementary material), the loss of Lhx6 expression in
Nkx2.1 nulls (Sussel et al.,
1999), and the induction of Lhx6 by Nkx2.1 (Figs
2,
5,
6), raise the possibility that
Lhx6 functions directly downstream of Nkx2.1 in the
specification of PV and SST interneuron fate. Co-transfection of the
Nkx2.1-/- MGE-like region in slices with expression
vectors for both Nkx2.1 and pLhx6-shRNAi produces a dramatic
reduction in the frequency of PV+ and SST+ phenotypes
(Fig. 2). This result suggests
that Lhx6 expression is required for the acquisition of these
phenotypes, a notion that is strongly supported by the cortical interneuron
phenotype observed in Lhx6 nulls in which GABA expression in cortex
is grossly normal but the number of PV- or SST-expressing interneurons is very
dramatically reduced (Liodis et al.,
2007).
The loss-of-function evidence raises the question of whether Lhx6 is not only required for acquisition of the PV+ and SST+ phenotypes, but is also sufficient to restore this phenotype in the Nkx2.1-null context. Indeed, expression of Lhx6 cDNA within the MGE-like region of Nkx2.1 nulls also results in a substantial restoration of these phenotypes (Fig. 2, Table 1). The apparent rescue extends beyond PV and SST because most of the `rescued' PV-expressing cells also express the Kv3.1 potassium channel. In addition, in contrast to controls, Lhx6-rescued PV- and SST-expressing cells are nearly all aspiny or sparsely spiny, suggesting that Lhx6 promotes both morphological and neurochemical aspects of interneuron fate (Fig. 3). The control of multiple aspects of MGE-derived interneuron characteristics suggests that Lhx6 might function to drive multiple transcriptional cascades to direct the specification of several subgroups of this telencephalic neuronal subclass.
|
),
NKX2.1 directly activates target genes in the thyroid and lung
(Liu et al., 2002;
Mizuno et al., 1991;
Moya et al., 2006), although
these targets are not known to include LIM-homeodomain transcription factors.
Comparative genomic sequence and transcription factor binding site analyses
reveal a highly conserved consensus NKX2.1 binding sequence about 240 bp from
the Lhx6 translation initiation site
(Fig. 4), and this site is
present in a 119 bp fragment identified by chromatin immunoprecipitation. In
addition, a 2.1 kb fragment upstream of the translation initiation site drives
expression of GFP reporter specifically in Nkx2.1-expressing regions
of wild-type slices (Figs 5,
6). This expression is lost in
Nkx2.1-null slices, can be rescued by exogenous addition of
Nkx2.1 to the Nkx2.1-null slices, and is abolished when the
NKX2.1 binding sequence is removed from the reporter
(Fig. 5). Moreover, the ability
of ectopic Nkx2.1 to drive the Lhx6 reporter construct in
the LGE or cortex (Fig. 6) is
abolished by a point mutation in the homeodomain that has previously been
shown to greatly diminish the ability of NKX2.1 to bind its target DNA
sequence (Krude et al., 2002).
Although establishment of the definitive role played by the identified NKX2.1
binding sequence requires in vivo confirmation, taken together these results
suggest that NKX2.1 drives specification of the SST+ and PV+ phenotypes via
the direct activation of Lhx6.
Role of Lhx6 in cortical interneuron specification
Interestingly, ectopic expression of either Lhx6 or
Nkx2.1 in the ventral half of the E12.5 LGE, which normally gives
rise primarily to medium spiny neurons of the striatum
(Stenman et al., 2003), does
not produce PV+ or SST+ neurons (T.D. and S.A.A., unpublished). This result
suggests that, consistent with the residual expression of a truncated
Nkx2.1 transcript within the MGE-like region of Nkx2.1 nulls
(Sussel et al., 1999), the
MGE* is molecularly distinct from the LGE proper despite the
presence of ventricular zone, subventricular zone and mantle zone gene
expression that is normally restricted to the LGE
(Sussel et al., 1999). The
absence or presence of such a factor would supply competence to attain a PV+
or SST+ phenotype in response to Lhx6 expression despite the absence
of Nkx2.1.
|
), and
both genes are required for the specification of most cholinergic neurons of
the basal forebrain (Fragkouli et al.,
2005; Marin et al.,
2000; Sussel et al.,
1999; Zhao et al.,
2003). However, although the MGE or the underlying
preoptic/anterior endopeduncular region gives rise to cholinergic interneurons
of the striatum (Marin et al.,
2000), cholinergic phenotypes are not seen in transplants of these
regions into cortex (T.D. and S.A.A., unpublished results), such that a role
for Lhx6 in the specification of these cells was not tested in this
study. Interestingly, although essentially all cholinergic interneurons of the
striatum derive from Nkx2.1-expressing progenitors, a
bipolar-morphology Nkx2.1-lineage-negative cholinergic interneuron
has recently been described in mouse neocortex
(Xu et al., 2008).
Our previous work showed that sonic hedgehog signaling during the age range
of neurogenesis is required to maintain Nkx2.1 expression within, and
interneuron generation by, cycling progenitors of the MGE
(Xu et al., 2005). This paper
extends that work in suggesting that Nkx2.1 specifies PV+ or SST+
interneuron subgroups and other neurochemical, as well as morphological,
aspects of MGE-derived interneuron fates by directly activating Lhx6.
Several lines of evidence suggest that progenitors giving rise to these
subgroups might be partially segregated on the dorsal-ventral axis of the MGE
(Flames et al., 2007;
Fogarty et al., 2007;
Ghanem et al., 2007;
Wonders et al., 2008). As
Lhx6 itself does not appear to be differentially expressed along the
dorsal-ventral axis of the MGE, a key remaining question is how Lhx6
function is modified to differentially specify the MGE-derived interneuron
subgroups of the cerebral cortex.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/8/1559/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Alcantara, S., de Lecea, L., Del Rio, J. A., Ferrer, I. and Soriano, E. (1996). Transient colocalization of parvalbumin and calbindin D28k in the postnatal cerebral cortex: evidence for a phenotypic shift in developing nonpyramidal neurons. Eur. J. Neurosci. 8,1329 -1339.[CrossRef][Medline]
Alifragis, P., Liapi, A. and Parnavelas, J. G.
(2004). Lhx6 regulates the migration of cortical interneurons
from the ventral telencephalon but does not specify their GABA phenotype.
J. Neurosci. 24,5643
-5648.
Alvarez-Dolado, M., Calcagnotto, M. E., Karkar, K. M.,
Southwell, D. G., Jones-Davis, D. M., Estrada, R. C., Rubenstein, J. L.,
Alvarez-Buylla, A. and Baraban, S. C. (2006). Cortical
inhibition modified by embryonic neural precursors grafted into the postnatal
brain. J. Neurosci. 26,7380
-7389.
Butt, S. J., Fuccillo, M., Nery, S., Noctor, S., Kriegstein, A., Corbin, J. G. and Fishell, G. (2005). The temporal and spatial origins of cortical interneurons predict their physiological subtype. Neuron 48,591 -604.[CrossRef][Medline]
Cobos, I., Calcagnotto, M. E., Vilaythong, A. J., Thwin, M. T., Noebels, J. L., Baraban, S. C. and Rubenstein, J. L. (2005). Mice lacking Dlx1 show subtype-specific loss of interneurons, reduced inhibition and epilepsy. Nat. Neurosci. 8,1059 -1068.[CrossRef][Medline]
Dasen, J. S., Tice, B. C., Brenner-Morton, S. and Jessell, T. M. (2005). A Hox regulatory network establishes motor neuron pool identity and target-muscle connectivity. Cell 123,477 -491.[CrossRef][Medline]
Flames, N., Pla, R., Gelman, D. M., Rubenstein, J. L., Puelles,
L. and Marin, O. (2007). Delineation of multiple subpallial
progenitor domains by the combinatorial expression of transcriptional codes.
J. Neurosci. 27,9682
-9695.
Fogarty, M., Grist, M., Gelman, D., Marin, O., Pachnis, V. and
Kessaris, N. (2007). Spatial genetic patterning of the
embryonic neuroepithelium generates GABAergic interneuron diversity in the
adult cortex. J. Neurosci.
27,10935
-10946.
Fragkouli, A., Hearn, C., Errington, M., Cooke, S., Grigoriou, M., Bliss, T., Stylianopoulou, F. and Pachnis, V. (2005). Loss of forebrain cholinergic neurons and impairment in spatial learning and memory in LHX7-deficient mice. Eur. J. Neurosci. 21,2923 -2938.[CrossRef][Medline]
Ghanem, N., Yu, M., Long, J., Hatch, G., Rubenstein, J. L. and
Ekker, M. (2007). Distinct cis-regulatory elements from the
Dlx1/Dlx2 locus mark different progenitor cell populations in the ganglionic
eminences and different subtypes of adult cortical interneurons. J.
Neurosci. 27,5012
-5022.
Gonchar, Y. and Burkhalter, A. (1997). Three
distinct families of GABAergic neurons in rat visual cortex. Cereb.
Cortex 7,347
-358.
Gong, S., Zheng, C., Doughty, M. L., Losos, K., Didkovsky, N., Schambra, U. B., Nowak, N. J., Joyner, A., Leblanc, G., Hatten, M. E. et al. (2003). A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature 425,917 -925.[CrossRef][Medline]
Grigoriou, M., Tucker, A. S., Sharpe, P. T. and Pachnis, V. (1998). Expression and regulation of Lhx6 and Lhx7, a novel subfamily of LIM homeodomain encoding genes, suggests a role in mammalian head development. Development 125,2063 -2074.[Abstract]
Kessaris, N., Fogarty, M., Iannarelli, P., Grist, M., Wegner, M. and Richardson, W. D. (2006). Competing waves of oligodendrocytes in the forebrain and postnatal elimination of an embryonic lineage. Nat. Neurosci. 9, 173-179.[CrossRef][Medline]
Kimura, S., Hara, Y., Pineau, T., Fernandez-Salguero, P., Fox,
C. H., Ward, J. M. and Gonzalez, F. J. (1996). The T/ebp null
mouse: thyroid-specific enhancer-binding protein is essential for the
organogenesis of the thyroid, lung, ventral forebrain, and pituitary.
Genes Dev. 10,60
-69.
Krude, H., Schutz, B., Biebermann, H., von Moers, A., Schnabel, D., Neitzel, H., Tonnies, H., Weise, D., Lafferty, A., Schwarz, S. et al. (2002). Choreoathetosis, hypothyroidism, and pulmonary alterations due to human NKX2-1 haploinsufficiency. J. Clin. Invest. 109,475 -480.[CrossRef][Medline]
Lavdas, A. A., Grigoriou, M., Pachnis, V. and Parnavelas, J.
G. (1999). The medial ganglionic eminence gives rise to a
population of early neurons in the developing cerebral cortex. J.
Neurosci. 19,7881
-7888.
Li, C., Cai, J., Pan, Q. and Minoo, P. (2000). Two functionally distinct forms of NKX2.1 protein are expressed in the pulmonary epithelium. Biochem. Biophys. Res. Commun. 270,462 -468.[CrossRef][Medline]
Li, C., Zhu, N. L., Tan, R. C., Ballard, P. L., Derynck, R. and
Minoo, P. (2002). Transforming growth factor-beta inhibits
pulmonary surfactant protein B gene transcription through SMAD3 interactions
with NKX2.1 and HNF-3 transcription factors. J. Biol.
Chem. 277,38399
-38408.
Liodis, P., Denaxa, M., Grigoriou, M., Akufo-Addo, C., Yanagawa,
Y. and Pachnis, V. (2007). Lhx6 activity is required for the
normal migration and specification of cortical interneuron subtypes.
J. Neurosci. 27,3078
-3089.
Liu, C., Glasser, S. W., Wan, H. and Whitsett, J. A.
(2002). GATA-6 and thyroid transcription factor-1 directly
interact and regulate surfactant protein-C gene expression. J.
Biol. Chem. 277,4519
-4525.
Livesey, F. J. and Cepko, C. L. (2001). Vertebrate neural cell-fate determination: lessons from the retina. Nat. Rev. Neurosci. 2,109 -118.[CrossRef][Medline]
Loots, G. G. and Ovcharenko, I. (2004). rVISTA
2.0: evolutionary analysis of transcription factor binding sites.
Nucleic Acids Res. 32,W217
-W221.
Marin, O. and Rubenstein, J. L. (2001). A long, remarkable journey: Tangential migration in the telencephalon. Nat. Rev. Neurosci. 2,780 -790.[Medline]
Marin, O., Anderson, S. A. and Rubenstein, J. L.
(2000). Origin and molecular specification of striatal
interneurons. J. Neurosci.
20,6063
-6076.
McConnell, S. K. and Kaznowski, C. E. (1991).
Cell cycle dependence of laminar determination in developing neocortex.
Science 254,282
-285.
Mizuno, K., Gonzalez, F. J. and Kimura, S.
(1991). Thyroid-specific enhancer-binding protein (T/EBP): cDNA
cloning, functional characterization, and structural identity with thyroid
transcription factor TTF-1. Mol. Cell. Biol.
11,4927
-4933.
Moya, C. M., de Nanclares, G. P., Castano, L., Potau, N.,
Bilbao, J. R., Carrascosa, A., Bargada, M., Coya, R., Martul, P.,
Vicens-Calvet, E. et al. (2006). Functional study of a novel
single deletion in the Titf1/Nkx2.1 homeobox gene that produces congenital
hypothyroidism and benign chorea but not pulmonary distress. J.
Clin. Endocrinol. Metab. 91,1832
-1841.
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104,861 -873.[CrossRef][Medline]
Ovcharenko, I., Loots, G. G., Hardison, R. C., Miller, W. and
Stubbs, L. (2004a). zPicture: dynamic alignment and
visualization tool for analyzing conservation profiles. Genome
Res. 14,472
-477.
Ovcharenko, I., Nobrega, M. A., Loots, G. G. and Stubbs, L.
(2004b). ECR Browser: a tool for visualizing and accessing data
from comparisons of multiple vertebrate genomes. Nucleic Acids
Res. 32,W280
-W286.
Schuurmans, C., Armant, O., Nieto, M., Stenman, J. M., Britz, O., Klenin, N., Brown, C., Langevin, L. M., Seibt, J., Tang, H. et al. (2004). Sequential phases of cortical specification involve Neurogenin-dependent and -independent pathways. EMBO J. 23,2892 -2902.[CrossRef][Medline]
Shirasaki, R. and Pfaff, S. L. (2002). Transcriptional codes and the control of neuronal identity. Annu. Rev. Neurosci. 25,251 -281.[CrossRef][Medline]
Stenman, J., Toresson, H. and Campbell, K.
(2003). Identification of two distinct progenitor populations in
the lateral ganglionic eminence: implications for striatal and olfactory bulb
neurogenesis. J. Neurosci.
23,167
-174.
Stuhmer, T., Anderson, S. A., Ekker, M. and Rubenstein, J.
L. (2002). Ectopic expression of the Dlx genes induces
glutamic acid decarboxylase and Dlx expression.
Development 129,245
-252.
Sui, G., Soohoo, C., Affar, El B., Gay, F., Shi, Y., Forrester,
W. C. and Shi, Y. (2002). A DNA vector-based RNAi technology
to suppress gene expression in mammalian cells. Proc. Natl. Acad.
Sci. USA 99,5515
-5520.
Sussel, L., Marin, O., Kimura, S. and Rubenstein, J. L. (1999). Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum. Development 126,3359 -3370.[Abstract]
Tamamaki, N., Yanagawa, Y., Tomioka, R., Miyazaki, J., Obata, K. and Kaneko, T. (2003). Green fluorescent protein expression and colocalization with calretinin, parvalbumin, and somatostatin in the GAD67-GFP knock-in mouse. J. Comp. Neurol. 467, 60-79.[CrossRef][Medline]
Tell, G., Perrone, L., Fabbro, D., Pellizzari, L., Pucillo, C., De Felice, M., Acquaviva, R., Formisano, S. and Damante, G. (1998). Structural and functional properties of the N transcriptional activation domain of thyroid transcription factor-1: similarities with the acidic activation domains. Biochem. J. 329,395 -403.[Medline]
Valcanis, H. and Tan, S. S. (2003). Layer
specification of transplanted interneurons in developing mouse neocortex.
J. Neurosci. 23,5113
-5122.
Vallstedt, A., Muhr, J., Pattyn, A., Pierani, A., Mendelsohn, M., Sander, M., Jessell, T. M. and Ericson, J. (2001). Different levels of repressor activity assign redundant and specific roles to Nkx6 genes in motor neuron and interneuron specification. Neuron 31,743 -755.[CrossRef][Medline]
Watada, H., Mirmira, R. G., Kalamaras, J. and German, M. S.
(2000). Intramolecular control of transcriptional activity by the
NK2-specific domain in NK-2 homeodomain proteins. Proc. Natl. Acad.
Sci. USA 97,9443
-9448.
Weiser, M., Bueno, E., Sekirnjak, C., Martone, M. E., Baker, H., Hillman, D., Chen, S., Thornhill, W., Ellisman, M. and Rudy, B. (1995). The potassium channel subunit KV3.1b is localized to somatic and axonal membranes of specific populations of CNS neurons. J. Neurosci. 15,4298 -4314.[Abstract]
Wichterle, H., Turnbull, D. H., Nery, S., Fishell, G. and
Alvarez-Buylla, A. (2001). In utero fate mapping reveals
distinct migratory pathways and fates of neurons born in the mammalian basal
forebrain. Development
128,3759
-3771.
Wonders, C. P. and Anderson, S. A. (2006). The origin and specification of cortical interneurons. Nat. Rev. Neurosci. 7,687 -696.[CrossRef][Medline]
Wonders, C., Taylor, L., Welagan, J., Mbata, I., Xiang, J. and Anderson, S. (2008). A spatial bias for the origins of interneuron subgroups within the medial ganglionic eminence. Dev. Biol. 314,127 -136.[CrossRef][Medline]
Xu, Q., Cobos, I., De La Cruz, E., Rubenstein, J. L. and
Anderson, S. A. (2004). Origins of cortical interneuron
subtypes. J. Neurosci.
24,2612
-2622.
Xu, Q., Wonders, C. P. and Anderson, S. A.
(2005). Sonic hedgehog maintains the identity of cortical
interneuron progenitors in the ventral telencephalon.
Development 132,4987
-4998.
Xu, Q., Tam, M. and Anderson, S. A. (2008). Fate mapping Nkx2.1-lineage cells in the mouse telencephalon. J. Comp. Neurol. 506,16 -29.[CrossRef][Medline]
Zhao, Y., Marin, O., Hermesz, E., Powell, A., Flames, N.,
Palkovits, M., Rubenstein, J. L. and Westphal, H. (2003). The
LIM-homeobox gene Lhx8 is required for the development of many cholinergic
neurons in the mouse forebrain. Proc. Natl. Acad. Sci.
USA 100,9005
-9010.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  V. H. Sousa, G. Miyoshi, J. Hjerling-Leffler, T. Karayannis, and G. Fishell Characterization of Nkx6-2-Derived Neocortical Interneuron Lineages Cereb Cortex, July 1, 2009; 19(suppl_1): i1 - i10. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
