|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 26 November 2008
doi: 10.1242/dev.027698
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Developmental Biology Unit, European Molecular Biology Laboratory, Meyerhofstrasse 1, D-69117 Heidelberg, Germany.
¶ Author for correspondence (e-mail: ephrussi{at}embl-heidelberg.de)
Accepted 22 October 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Lasp, Oskar, Actin cytoskeleton, Drosophila
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Kim-Ha et al., 1991).
oskar mRNA is exclusively translated after its localization
(Kim-Ha et al., 1995;
Markussen et al., 1995;
Rongo et al., 1995), and thus
locally induces the assembly of the pole-plasm, the germ-plasm of
Drosophila, causing abdomen and germline formation in the embryo.
Oskar protein is both necessary and sufficient for abdomen induction and
germline formation (Ephrussi and Lehmann,
1992). Mislocalization of oskar mRNA to the anterior, as
occurs in BicD mutants (Ephrussi
et al., 1991), or ectopic expression of Oskar at the anterior pole
from an oskar-bicoid (osk-bcd) transgene
(Ephrussi and Lehmann, 1992),
causes strong embryonic patterning defects and, in the latter case, the
formation of primordial germ cells at the anterior of the embryo. It is
therefore essential that Oskar activity remains restricted to the posterior
pole of the oocyte and embryo.
oskar mRNA and protein remain tightly associated with the
posterior pole during oogenesis and early embryogenesis, in spite of the
strong cytoplasmic streaming that occurs after stage 10B of oogenesis
(Gutzeit and Koppa, 1982), and
experiments with the actin-severing drugs Cytochalasin D and Latrunculin A
suggest that oskar mRNA and protein are attached to the actin
cytoskeleton (Lantz et al.,
1999). In addition, and in contrast to Oskar, Bicoid protein
diffuses along the anteroposterior axis after its synthesis and is detected
down to 30% of the egg length, although its mRNA is restricted to the anterior
pole in the embryo [100-80% egg length
(Driever and Nusslein-Volhard,
1988)], which suggests that mRNA localization is not sufficient
for protein restriction. Posterior anchoring of Oskar requires the Oskar
protein itself (Ephrussi et al.,
1991; Kim-Ha et al.,
1991), and is a dynamic process involving both actin-dependent and
-independent processes (Babu et al.,
2004; Tanaka and Nakamura,
2008; Vanzo et al.,
2007). We performed an extensive yeast two-hybrid screen with
Short-Oskar (the isoform of Oskar that is required for pole cell formation) as
bait, to search for potential anchoring proteins, and found that the
Drosophila homolog of mammalian Lasp1
(Grunewald and Butt, 2008)
binds to Oskar and helps to anchor Oskar to actin at the posterior pole.
Furthermore, we found that efficient pole cell formation in vivo requires a
Lasp SH3 domain that is capable of interacting with Oskar.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Two-hybrid screen
The yeast two-hybrid screen was performed using a modified mating strategy
(Fromont-Racine et al., 1997).
In brief, frozen aliquots of the oligo-dT primed ovarian cDNA library
(Grosshans et al., 1999)
transformed into the yeast strain EGY48 were mated to RSY473 strains
previously transformed with both Short-Oskar fused to NLSLexA at the C
terminus and JK103 for 4 hours on YP-Gal plates to simultaneously induce prey
protein expression. Cells were washed with medium lacking leucine, tryptophan,
uracil and histidine, and plated onto S-Gal/Raf plates lacking leucine,
tryptophan, uracil and histidine. Mating efficiencies varied between 2% and
10%. Diploid cells (3.8x107) were screened, corresponding to
5.7x106 primary yeast transformants, and 480 positive clones
were analyzed. Table S1 shows a compilation of the screening results (see
supplementary material). Eighteen colonies of type 3.30 were further analyzed
for this report [3.30 corresponds to bases 2243 to 3240 of the sequence
submitted to GenBank (AJ294538)]. Isolated prey plasmids (in pJG4-5) were
retransformed into EGY48 and the specificity of the interaction tested by
mating to independent bait proteins.
cDNA cloning, sequencing and Q/RT-PCR
The insert of clone 3.30 was used as a probe to screen an oligo-dT primed
ovarian cDNA library in lambda ZAPII kindly provided by A. Spradling and the
Berkeley Drosophila Genome Project. Several of the longest cDNA
clones were characterized by restriction mapping and end-sequencing. Two
clones were chosen for sequencing. Templates were generated using the GPS-1
transposon system (NEB, Madison, WI, USA) and sequenced with
fluorescent-labeled primers on an Arakis sequencer (EMBL).
S-Lasp was amplified from EST AT23571 with Oligo3_BglII
(CGGCAGATCTATGAATAAAACCT) and Oligo2a_Not (GCGGCCGCTTATATAACC), and cloned
into pCRIITopo (Invitrogen, Carlsbad, CA, USA). RNA extraction from ovaries
and embryos was done as described previously
(Hachet and Ephrussi, 2004).
Expression of S-Lasp was confirmed by One-step RT-PCR (Invitrogen) using
primers LASP859U (GAGAACACCAAAATCCAGTCCAAC) and LASP1552L
(CTGTGGTGGCGGCATCTG). The accession numbers of the assembled cDNA sequences
are AJ294538 (L-Lasp) and AT23571 (S-Lasp).
The thermoscript RT-PCR System (Invitrogen) was used to synthesize cDNA for quantitative RT-PCR for oskar (see Fig. S3 in the supplementary material). Q-PCR reactions were run on an ABI 7000 Real-time PCR system with primers HJ46F (AACAAATCTTGCACCGCTGGGC) and HJ47R (GACTTGGCGTGGTGAGGCCTGA). RpS49 was used for normalization (rp49F, GCTAAGCTGTCGCACAAA; rp49R, TCCGGTGGGCAGCATGTG).
Interaction assays
The expression constructs for Gst-chicken Src, Gst-mouse NSrc and
pSGT_HA_SAM68 were kindly provided by G. Superti-Furga (Ce-M-M, Vienna,
Austria) (Lock et al., 1996).
Gst-fusion proteins were expressed and purified as described, except that
protein expression was induced at 30°C
(Breitwieser et al., 1996).
HA-tagged Short-Oskar and SAM68 were translated in vitro from pβTHShortHA
and pSGT_HA_SAM68 using the TNT-coupled transcription translation kit,
according to the manufacturer's instructions (Promega, Madison, WI, USA).
For Gst pull-down experiments, 10 µg of the appropriate Gst-fusion protein were incubated with 15 µl pre-equilibrated glutathione-Sepharose beads (Amersham-Pharmacia, Piscataway, NJ, USA) in 500 µl BP [50 mM Tris/HCl (pH 7.5), 150 mM KCl, 1% NP40, 5 mM EGTA, 5 mM EDTA and 1xEDTA free protease inhibitor cocktail (Roche, Basel, Switzerland)] for 30 minutes at 4°C on a rotating arm. The beads were then washed three times with 1 ml BP and incubated with 5 µl of an in vitro translation reaction in a total volume of 500 µl BP for 1 hour at 4°C. The beads were then washed three times with 1 ml BP and resuspended in 20 µl 2xconcentrated SDS sample buffer. Samples were then analyzed on a 12% SDS polyacrylamide gel, dried, exposed to Biomax film (Kodak) and quantified on a Molecular Dynamics phosphorimager.
For the Gst pull-down experiments shown in Fig. S1 (see supplementary material), 10 µg of the appropriate Gst-fusion protein were incubated for 50 minutes with ovary extracts (50 ovary pairs per sample) at 4°C and processed as above. Samples were analyzed on a 10% SDS polyacrylamide gel and processed for western blotting.
Actin-binding assays
The GN protein was expressed as described above, except that 1 mM DTT was
added to the dialysis buffer. Actin co-sedimentation assays were performed
following the protocol supplied by the manufacturer (Cytoskeleton, Denver, CO)
with several modifications: To pre-clear, the protein solutions were
centrifuged for 1 hour at 436,000 g in a TLA 100 rotor in a
Beckmann TL100 ultracentrifuge. G-actin (36 µg) was polymerized in the
presence of 30 µg GN or control proteins for 30 minutes at room
temperature. The samples were then centrifuged at 279,000 g
under the same conditions as above, for 30 minutes. Ten percent of the
resulting pellet was then loaded onto a 10% SDS polyacrylamide gel. All assays
were run in duplicate.
Antibody production
To generate an anti-Lasp antibody, the insert of two-hybrid clone 3.30 was
cloned as a EcoRI(blunt)/XhoI fragment into the
SmaI and SalI sites of pQE31 (Qiagen, Valencia, CA, USA) and
expressed as a His6-tagged fusion protein in E. coli
strain M15[pRep4] (Qiagen). Protein production was induced with IPTG at 1 mM
for 4 hours at 37°C and the protein purified under denaturing conditions
as indicated by the manufacturer, except that the protein was step-eluted in
buffer C containing 250 mM imidazole. Rabbit (#6528 and #6529) injections and
bleedings were carried out by Eurogentec (Belgium). Analogously, the
N-terminal BglII/PstI fragment of pSP72_L_Lasp was
subcloned, expressed and used for immunization (#7271). To generate the
anti-Oskar antibody, the EcoRV/SphI fragment of the Blue-osk
cDNA (Ephrussi et al., 1991)
was cloned into the BamHI(blunt)/SphI site of pQE32
(Qiagen). The His6-tagged fusion protein was expressed and purified
as above, except that the culture was grown at 30°C. The antibody was
produced in a rabbit (Anix) by EMBL Laboratory Animal Resources.
Whole-mount antibody staining and RNA in situ hybridizations were performed
as described previously (Riechmann and
Ephrussi, 2004; Riechmann et
al., 2002; Tomancak et al.,
2000). Anti-Lasp terminal-bleed serum (#6529), rat anti-Vasa and
pre-absorbed rat 56 anti-Oskar (Ephrussi
et al., 1991) antibodies were used at dilutions of 1:500-1:2000,
1:1000 and 1:2000, respectively. Fluoresceine-conjugated goat anti-rabbit and
rhodamine-conjugated goat anti-rat were used at a dilution of 1:500 (in PBT,
Amersham). Samples were analyzed on a Zeiss Axiovert 200 or a Leica TCS SP2
confocal microscope and quantified using ImageJ.
The preparation of ovarian extracts and western blotting were performed as
described previously (Markussen et al.,
1995). Rabbit anti-Oskar and anti-Lasp antibodies (#6528 and
#7271) were used at dilutions of 1:2000 and 1:4000, respectively. An anti
-tubulin monoclonal antibody DM 1A (1:2000, Sigma, St Louis, MO, USA)
was used for standardization.
Hobo excision
Directional hobo-mediated deletions were generated by remobilizing
the Hobo element of the
P{wHy}LaspDG14505 insertion (kindly
provided by W. Gelbart, Harvard University, USA) as described
(Huet et al., 2002). After
selecting for y- or w- chromosomes, 44
deletion events were analyzed for loss of the appropriate P-element flanking
sequence, by single fly genomic PCR using primers for pendout
(CGACGGGACCACCTTATGTT) and the insertion flanking lasp (5'
primer, ATAGCGAGTCGTACCATTACCATC; and 3' primer,
GGAAGACCACAAAGCCAATTTATA). The extent of the Hobo-mediated deletion was then
mapped by inverse PCR as described (Huet
et al., 2002). Two y-/w+
deletions were further characterized. laspy45 and
laspy41 delete 2859 bp and 3514 bp with respect to the
original insertion point of
P{wHy}LaspDG14505 (nt 16675541 3L; GB
accession number AE014296, release 5.7). RT-PCR (not shown) and western
analysis demonstrated that neither lasp mRNA is present, and that
neither the C terminus (Fig.
4D; anti-Lasp Cterm antibody #6528) nor the N terminus (anti-Lasp
Nterm #7271; not shown) of Lasp is expressed. laspy45 and
laspy41 are thus molecular null alleles.
Transgenesis
Transgenic fly lines were generated by P element-mediated transformation of
a w1118 stock and then balanced
(Rubin and Spradling, 1982).
Several independent lines were assayed for each construct and results with
typical lines are shown in this study.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Grunewald and Butt, 2008;
Schreiber et al., 1998), as
being a strong interactor. Lasp consists of an N-terminal LIM domain, followed
by two nebulin-like repeats (NEB; Fig.
4A), a spacer region and a C-terminal SH3 domain (for a review,
see Grunewald and Butt, 2008).
NEB repeats were first identified in human nebulin, an actin-binding,
structural muscle protein (Labeit and
Kolmerer, 1995). SH3 domains are evolutionarily conserved
protein-protein interaction domains of about 60 amino acids
(Musacchio et al., 1992a),
which are frequently present in cytoskeletal proteins and proteins involved in
signal transduction. Within the LIM, NEB and SH3 domains, Drosophila
Lasp is highly similar to vertebrate and Caenorhabditis elegans Lasp,
whereas the spacer between the NEB repeats and the SH3 domain is not
conserved, and its length varies greatly between different species (see Fig.
S1E in the supplementary material).
|
;
Musacchio et al., 1994) was
changed to alanine (Gst_W
A), was at least 15-fold less efficient in
precipitating Short-Oskar, confirming that the Lasp-Oskar interaction behaves
as expected for a canonical SH3 domain interaction
(Fig. 1A). Neither equal
amounts (Fig. 1B) of Gst alone,
nor Gst fused to the SH3 domain of Src (Gst_Src) or to the neuronal variant of
the Src SH3 domain (Gst_NSrc) was capable of binding Short-Oskar
(Fig. 1B). GST-pull downs of
Oskar from ovary extracts showed similar results (see Fig. S1D in the
supplementary material). Thus, independent assay systems show that Oskar and
Lasp interact specifically.
Lasp and Oskar localization overlaps in oocytes and embryos
For the interaction of Lasp with Oskar to be physiologically relevant, the
distribution of the two proteins should overlap in vivo. Consistent with in
situ hybridization data (not shown), antibodies against the initial two-hybrid
fragment of Lasp strongly stain region 2 and two or so cells at the anterior
tip of the germarium (Fig. 2A).
Double-labeling experiments showed that these cells do not express Hts, which
suggests that they are cap cells rather than germline stem cells (data not
shown) (Lin et al., 1994).
During mid-oogenesis, Lasp is strongly expressed in nurse cells and is highly
enriched in the oocyte (Fig.
2B). Lasp appears to be mildly enriched at the posterior of the
oocyte and is also expressed in the pair of anterior and posterior polar
follicle cells; it is also present on ring canals
(Fig. 2B, data not shown). At
stage 10 of oogenesis, Lasp is detected at the nurse cell borders, ring canals
and around the cortex of the oocyte (Fig.
2C), and it tightly colocalizes with Oskar at the posterior pole
of the oocyte [Fig. 2D-F;
Fig. 5A; the inset in
Fig. 2F shows a fluorescence
profile of Oskar (red) and Lasp (green) peaking at similar positions across
the oocyte cortex]. Similarly, co-detection of Lasp and Oskar in embryos at
the preblastoderm stage shows that the proteins colocalize at the posterior
pole (Fig. 3B-D). The antibody
staining is specific, as no staining is detected in lasp mutants
(Fig. 2A',
Fig. 3,
Fig. 5A; see below for mutant
generation). Thus, Oskar and Lasp are closely associated in both oocytes and
embryos.
Drosophila Lasp is an actin-binding protein
The sequence of Drosophila Lasp contains two NEB repeats, which
are predicted to bind to actin (Chen et
al., 1993). To test whether Drosophila Lasp binds F-actin
in vitro, we expressed the N terminus of Lasp, including the LIM domain and
both NEB repeats, as a Gst-fusion protein (GN) and performed co-sedimentation
assays. After polymerization of purified G-actin in the presence of the GN
fusion protein, GN co-sedimented with F-actin fibers
(Fig. 1C). Almost no GN protein
was found in the pellet in the absence of F-actin
(Fig. 1C). None of BSA, Gst
alone or Gst fused to the C terminus of Lasp (lacking the NEB repeats)
co-sedimented with F-actin, whereas the actin-binding protein -actinin
co-sedimented quantitatively under the same conditions (data not shown).
Consistent with the antibody stainings, functional (data not shown) GFP-tagged
Lasp expressed under control of the germline specific nanos-Gal4VP16
driver (Rorth, 1998;
Van Doren et al., 1998) showed
a distribution very similar to that of F-actin
(Fig. 1D-F).
|
|
). Similarly, Lasp was detected as a network throughout the
embryo cytoplasm and around the cortical dense layer at the preblastoderm
stage (Fig. 3A). At the
syncytial blastoderm stage, Lasp accumulated apically along the invaginating
plasma membrane (Fig. 3E,F), in
a distribution resembling that of F-actin
(Fig. 3G). At the blastoderm
stage, both Lasp (Fig. 3H,I)
and F-actin (Fig. 3J)
accumulated apically and laterally in the epithelial cells. No Lasp staining
was detected at either stage in lasp mutants
(Fig.
3A'-D',H',I'). Taken together, the
colocalization and binding data suggest that Lasp anchors Oskar to the actin
cytoskeleton. Consistent with this hypothesis, both the cortical Lasp (see
Fig. S2 in the supplementary material) and posterior Oskar localization
(Babu et al., 2004) are lost
upon treatment of the oocytes with the actin polymerization inhibitor
Latrunculin A.
Phenotypic characterization of lasp mutants
FlyBase predicts a long Lasp (L-Lasp) isoform of 660 amino acids (aa) and a
short isoform of 504 aa (S-Lasp), encoded by alternatively spliced transcripts
(Fig. 4A,B). The short isoform
lacks a part of the spacer region encoded by the fifth exon. RT-PCR revealed
that, although transcripts encoding each isoform are expressed in the ovary,
only the long isoform-encoding transcript is detected in 0- to 2-hour embryos
(Fig. 4C). Consistent with
this, both Lasp isoforms are detected in the ovary, whereas only L-Lasp is
detected in 0- to 2-hour embryos by western blotting
(Fig. 4D).
|
) inserted in the second intron of lasp
(P{wHy}DG14505, kindly provided by the Gelbart
laboratory, Harvard University, USA; Fig.
4B). In two of the mutants we generated,
laspy41 and laspy45, a large region
including exons 3, 4 and 5 of the lasp-coding region was deleted
(Fig. 4B) and no mRNA could be
detected in ovaries by RT-PCR (data not shown). Western blotting confirmed
that neither S-Lasp nor L-Lasp was present in either the ovaries of
laspy41 or laspy45 homozygous females,
or the embryos laid by them (lasp mutant embryos;
Fig. 4D).
laspy41 and laspy45 are semi-lethal
alleles, and 40-50% of lasp mutant eggs fail to develop, mostly
because they are unfertilized (as assessed by DAPI staining; data not shown).
Hatching is restored by expressing transgenic wild-type L-Lasp, but not by
expressing S-Lasp or a version of L-Lasp bearing the WA mutation in its
SH3 domain (e.g. driven by maternal tubulin-Gal4 or pCOG; data not
shown), revealing that both the SH3 domain and the spacer region (fifth exon)
are crucial for this Lasp function. The other 50-60% of embryos hatch and
develop normally.
Homozygous mutant lasp females all contain normally developed
ovaries. Oskar protein (Fig.
5A), oskar mRNA and Staufen protein, which is required
for oskar mRNA localization and serves as an oskar mRNA
reporter (data not shown) (St Johnston et
al., 1991), are localized normally, and oskar mRNA levels
appear to be normal, as evaluated by quantitative RT-PCR (data not shown).
However, western blotting revealed a mild reduction in Oskar protein levels in
the ovary and a strong reduction in 0- to 2-hour lasp mutant embryos
compared with in wild-type controls (Fig.
5B). Accordingly, in situ hybridization and antibody staining of
embryos derived from lasp mutant mothers showed reduced amounts of
oskar RNA and protein at the posterior pole
(Fig. 5C; quantification of
fluorescent signals in Fig.
5D). By contrast, bicoid mRNA detected at the anterior
pole was unchanged (Fig. 5C,D),
demonstrating that the reduction was specific to oskar. As
quantitative RT-PCR (see Fig. S3 in the supplementary material) revealed
similar total levels of oskar mRNA in lasp mutant and
wild-type embryos (0-2 hours), the reduced amount of localized oskar
mRNA observed at the posterior pole of lasp mutant embryos did not
result from mRNA degradation, but rather might result from its failure to
remain localized at the posterior pole, a process that requires the Oskar
protein itself (Ephrussi et al.,
1991). In conclusion, lasp appears to be required
specifically for the stable accumulation of wild-type levels of oskar
mRNA and Oskar protein at the posterior pole of the embryo.
Lasp promotes Oskar accumulation at the posterior pole
Oskar activity at the posterior pole is required for abdomen and germline
formation in the embryo (Ephrussi et al.,
1991; Lehmann and
Nusslein-Volhard, 1986), with germline formation being more
sensitive to reductions in Oskar dosage than is abdominal patterning and thus
an ideal read-out for threshold Oskar levels
(Lehmann and Nusslein-Volhard,
1986). The progeny of heterozygous osk54/+
females and laspy45, osk54/+ double
heterozygotes develop no germline (grandchildless phenotype) at very low
frequency (e.g. osk54/+: 1% no ovary, 8% only one ovary;
Fig. 6A). By contrast,
oskar heterozygous females lacking both copies of lasp show
a penetrant grandchildless phenotype, with 20% of their offspring displaying a
complete absence of ovaries, and another 25% having only a single ovary
(Fig. 6A). Western blot
analysis showed that the amount of Oskar protein in laspy45,
osk54/laspy45 ovaries was reduced by
40-50% relative to osk54/+ ovaries (normalized to Tubulin
and Kinesin Heavy Chain, respectively; see Fig. S4 in the supplementary
material), which is consistent with the increased penetrance of the
grandchildless phenotype.
|
We conclude that oskar and lasp cooperate to ensure that Oskar protein accumulates at the posterior pole of the embryo at levels that are sufficient for germline formation (see Discussion).
An SH3 domain capable of interacting with Oskar is required for Lasp function in vivo
To test whether the SH3 domain of Lasp is required for Oskar accumulation
at the posterior pole of the embryo, we performed rescue experiments using
either a wild-type Lasp transgene or one bearing the WA mutation that
disrupts the Lasp-Oskar interaction in vitro
(Fig. 1; see also Fig. S1 in
the supplementary material). The grandchildless phenotype of
laspy45, osk54/laspy41
females was rescued almost fully by a lasp transgene
(Fig. 7A), thereby also
confirming that absence of lasp was responsible for the phenotype. By
contrast, no rescue of the grandchildless phenotype was observed with the
L-Lasp (WA) transgene, indicating that the SH3 domain that is crucial
for the Lasp-Osk interaction in vitro is also crucial in vivo. The S-Lasp
transgene also failed to rescue the phenotype. The number of germ cells
detected in the progeny of laspy45,
osk54/laspy41 females expressing the
different lasp transgenes (Fig.
7B,C) paralleled the penetrance of the grandchildless phenotype
(Fig. 7A). These results
indicate that the SH3 domain is essential for Lasp function during germline
formation and that the Lasp-Oskar interaction is relevant in vivo.
|
; Vanzo and Ephrussi,
2002). Consequently, the embryos develop anterior patterning
defects or even a bicaudal phenotype, in which anterior structures (head and
thorax) are replaced by a duplicated abdomen of reversed polarity
(Fig. 8A). To test whether Lasp
is required for this ectopic Oskar-induced phenotype, we expressed the
osk-K103'UTR transgene in lasp
mutant females. Indeed, whereas wild-type females expressing the
osk-K103'UTR transgene produced embryos that
displayed the full range of Oskar-related anterior patterning phenotypes with
high penetrance, embryos of lasp mutant
osk-K103'UTR females showed anterior
patterning defects with both significantly reduced penetrance and severity
(Fig. 8A,B).
Similarly, an oskar-bicoid (osk-bcd) 3'UTR
transgene (Ephrussi and Lehmann,
1992) caused the formation of ectopic pole cells at the anterior
in 43% of embryos, whereas in a lasp mutant background, pole cells
formed at the anterior in only 10% of embryos
(Fig. 8C). Furthermore, only
20% of the embryos of laspy41/+ females developed pole
cells at the anterior pole, revealing an effect of lasp gene dosage
on Oskar accumulation. All fertilized eggs produced by
osk-bcd-expressing laspy41 females developed into
embryos displaying the bicaudal phenotype, confirming that abdominal
patterning is less sensitive than germ cell formation to the reduction of
Oskar levels in the embryo. Taken together, these results demonstrate that
Lasp is necessary to achieve the high levels of Oskar activity required for
pole cell formation in the embryo.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
|
;
Chew et al., 2002;
Schreiber et al., 1998;
Terasaki et al., 2004), and
motile growth cones of cultured neurons
(Phillips et al., 2004). In
our study, we have shown that the NEB repeats of Drosophila Lasp bind
actin in vitro and that Lasp colocalizes with actin in vivo. lasp
mutant egg-chambers display no obvious actin defects, consistent with the
observation that rabbit Lasp1 has no detectable effect on actin polymerization
and that cells depleted of Lasp1 can form focal adhesions
(Chew et al., 2002;
Chew et al., 2000). Lasp1 has
also been shown to be a substrate of protein kinase A (PKA)
(Chew et al., 1998;
Schreiber et al., 1998). After
PKA stimulation of parietal cells in isolated gastric glands, Lasp1
redistributes from cortical regions to the actin-rich intracellular
canalicular region (Chew et al.,
2000). In Drosophila, egg chambers lacking PKA catalytic
subunit activity contain multinucleate nurse cells and abnormal ring canals.
In addition, pka mutant oocytes fail to respond to a signal from
posterior follicle cells and consequently fail to reorganize the microtubule
cytoskeleton (Lane and Kalderon,
1993; Lane and Kalderon,
1994). Oocytes lacking Lasp function show neither of these
phenotypes. By contrast, excess PKA activity, as in Pka-RI mutant
oocytes, causes the accumulation of high levels of ectopic Oskar protein and
embryos displaying the bicaudal phenotype
(Yoshida et al., 2004). This
ectopic accumulation could be due to delocalized oskar mRNA
translation, or to the stabilization of Oskar protein produced ectopically
that would normally be targeted for degradation. Given the reduced Oskar
levels we observed in lasp mutant embryos and the dependence of
ectopic Oskar activity on Lasp (Figs
7,
8), it would be interesting to
determine whether PKA phosphorylation of Lasp contributes either to the
accumulation of Oskar or to its anchoring in the embryo.
Oskar anchoring becomes crucial at stage 10B of oogenesis, when cytoplasmic
streaming starts, a vigorous process that ensures the mixing and even
distribution of cytoplasmic mRNAs and proteins in the egg
(Gutzeit and Koppa, 1982).
Treatment of embryos with the actin-severing drugs Cytochalasin D and
Latrunculin A disrupts the localization of oskar mRNA and protein,
but not of bicoid mRNA (Lantz et
al., 1999), which is similar to what we observed in lasp
mutant embryos and consistent with a role of Lasp in actin-dependent Oskar
anchoring. Several mechanisms contribute to oskar RNA and protein
anchoring. Bifocal (Bif) and Homer (Hom) redundantly promote Oskar anchoring
at the oocyte posterior pole via an actin-dependent and an unknown,
actin-independent process, respectively
(Babu et al., 2004).
Remarkably, the Oskar detachment defects of Latrunculin A-treated hom
egg chambers are stronger than in hom/bif double mutants
(Babu et al., 2004), suggesting
there are additional actin-dependent attachment mechanisms. However, we were
unable to detect genetic interactions between lasp and
hom/bif, as neither hom/lasp nor bif/lasp double
mutants showed an Oskar localization defect in ovaries (data not shown).
|
). As
Lasp is uniformly distributed along the actin-rich cortex, it could
participate in Oskar anchoring at ectopic cortical locations. Consistent with
this, the deleterious effects of ectopic anterior (osk-bcd) or
cortical (osk-K10) Oskar on embryonic patterning are suppressed in
lasp mutant embryos. In further support of our anchoring model, only
Lasp with a functional SH3 domain (i.e. one capable of interacting with Oskar
in vitro and in the two-hybrid assay; see
Fig. 1 and below; see also Fig.
S1 in the supplementary material), is able to rescue the grandchildless
phenotype and the reduction in pole cell number observed in
osk-, lasp-/lasp-
embryos.
The interaction of Oskar with Lasp depends on its SH3 domain, because a
single WA point mutation on the binding surface of the SH3 domain
abolishes its binding to Oskar (Fig.
1; see also Fig. S1 in the supplementary material). SH3 domains
usually interact with short, proline-rich sequences with the consensus RxxPxxP
(class I binding site) or PxxPxR (class II binding site)
(Kay et al., 2000). The region
of Oskar that is sufficient to interact with the SH3 domain of Lasp (aa
290-369; data not shown) does not encode a perfect class I or class II binding
site, nor does it contain any of the less frequently occurring SH3-binding
motifs (Kang et al., 2000;
Mongiovi et al., 1999). Three
PxxP motifs are present within the SH3-binding region of Oskar, but all of
them lack the neighboring basic amino acid. Nevertheless, Oskar is highly
specific for the SH3 domain of Lasp, as it does not interact with six other
SH3 domains tested, and the interaction capability is conserved in Oskar of
D. virilis (not shown).
Interestingly, the Lasp SH3 domain shares a high degree of similarity with
several proteins involved in clathrin-mediated endocytosis: the actin-binding
proteins Cortactin and Abp1, as well as Syndapin and Amphiphysin, both of
which bind Dynamin and contain an F-actin- or an Arp2/3-interacting domain
(Qualmann and Kessels, 2002).
It has been reported that both Lasp and Dynamin II localize to the apical
membrane of parietal cells, and that they interact in vitro
(Okamoto et al., 2002). Thus,
it is possible that Lasp is not only an actin binding-protein, but is also
involved in vesicle trafficking. Endocytic trafficking and actin-based
mechanisms also contribute to Oskar anchoring, and it is thus possible that
Lasp, together with other functionally related proteins, represents a link
between these processes. Furthermore, one of the two Oskar isoforms -
Long-Oskar - plays a crucial role in the anchoring of both Oskar isoforms and
oskar mRNA at the oocyte cortex at stage 10 of oogenesis
(Vanzo and Ephrussi, 2002).
Oocytes lacking Oskar have a dramatically reduced endocytic compartment and
lack the thick actin bundles that are normally observed at the posterior pole.
Thus Oskar anchoring in the oocyte appears to be a dynamic process, with
Oskar-stimulated recycling endocytosis and filamentous actin outgrowths
playing an important role in the maintenance of Oskar at the cell cortex
(Tanaka and Nakamura, 2008;
Vanzo et al., 2007). It is
thus conceivable that Oskar, Lasp, and other possibly redundant actin-binding
proteins act in feedback loops with components of the endocytic pathway to
maintain Oskar at the posterior pole.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/1/95/DC1
|
Footnotes |
|---|
* These authors contributed equally to this work 
Present address: Department of Developmental and Molecular Biology, Albert
Einstein College of Medicine, Chanin 503, 1300 Morris Park Avenue, Bronx, New
York, NY 10461, USA
Present address: Department of Biochemistry and Biophysics, Genetics,
Development and Behavioral Sciences, University of California San Francisco,
1550 Fourth Street, San Francisco, CA 94143, USA
Present address: Department of Physiological Chemistry, Centre for
Biomedical Genetics, UMC Utrecht, Universiteitsweg 100, 3584 CG Utrecht,
Netherlands
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Babu, K., Cai, Y., Bahri, S., Yang, X. and Chia, W.
(2004). Roles of Bifocal, Homer, and F-actin in anchoring Oskar
to the posterior cortex of Drosophila oocytes. Genes
Dev. 18,138
-143.
Breitwieser, W., Markussen, F. H., Horstmann, H. and Ephrussi,
A. (1996). Oskar protein interaction with Vasa represents an
essential step in polar granule assembly. Genes Dev.
10,2179
-2188.
Butt, E., Gambaryan, S., Gottfert, N., Galler, A., Marcus, K.
and Meyer, H. E. (2003). Actin binding of human LIM and SH3
protein (LASP) is regulated by cGMP- and cAMP-dependent protein kinase
phosphorylation on Ser-146. J. Biol. Chem.
278,15601
-15607.
Chen, M. J., Shih, C. L. and Wang, K. (1993).
Nebulin as an actin zipper: a two-module nebulin fragment promotes actin
nucleation and stabilizes actin filaments. J. Biol.
Chem. 268,20327
-20334.
Chew, C. S., Parente, J. A., Zhou, C., Baranco, E. and Chen,
X. (1998). Lasp-1 is a regulated phosphoprotein within the
cAMP signaling pathway in the gastric parietal cell. Am. J.
Physiol. 275,C56
-C67.[Medline]
Chew, C. S., Parente, J. A., Chen, X., Chaponnier, C. and
Cameron, R. S. (2000). The LIM and SH3 domain-containing
protein, lasp-1, may link the cAMP signaling pathway with dynamic membrane
restructuring activities in ion transporting epithelia. J. Cell
Sci. 113,2035
-2045.[Abstract]
Chew, C. S., Chen, X., Parente, J. A., Jr, Tarrer, S., Okamoto,
C. and Qin, H. Y. (2002). Lasp-1 binds to non-muscle F-actin
in vitro and is localized within multiple sites of dynamic actin
assembly in vivo. J. Cell Sci.
115,4787
-4799.[CrossRef][Medline]
Driever, W. and Nusslein-Volhard, C. (1988). A
gradient of bicoid protein in Drosophila embryos. Cell
54, 83-93.[CrossRef][Medline]
Ephrussi, A. and Lehmann, R. (1992). Induction
of germ cell formation by oskar. Nature
358,387
-392.[CrossRef][Medline]
Ephrussi, A., Dickinson, L. K. and Lehmann, R.
(1991). Oskar organizes the germ plasm and directs localization
of the posterior determinant nanos. Cell
66, 37-50.[CrossRef][Medline]
Fromont-Racine, M., Rain, J. C. and Legrain, P.
(1997). Toward a functional analysis of the yeast genome through
exhaustive two-hybrid screens. Nat. Genet.
16,277
-282.[CrossRef][Medline]
Grosshans, J., Schnorrer, F. and Nusslein-Volhard, C.
(1999). Oligomerisation of Tube and Pelle leads to nuclear
localisation of dorsal. Mech. Dev.
81,127
-138.[CrossRef][Medline]
Grunewald, T. G. and Butt, E. (2008). The LIM
and SH3 domain protein family: structural proteins or signal transducers or
both? Mol. Cancer 7,31
.[CrossRef][Medline]
Gutzeit, H. O. and Koppa, R. (1982). Time-lapse
film analysis of cytoplasmic streaming during late oogenesis of
Drosophila. J. Embryol. Exp. Morphol.
67,101
-111.
Hachet, O. and Ephrussi, A. (2004). Splicing of
oskar RNA in the nucleus is coupled to its cytoplasmic localization.
Nature 428,959
-963.[CrossRef][Medline]
Huet, F., Lu, J. T., Myrick, K. V., Baugh, L. R., Crosby, M. A.
and Gelbart, W. M. (2002). A deletion-generator compound
element allows deletion saturation analysis for genomewide phenotypic
annotation. Proc. Natl. Acad. Sci. USA
99,9948
-9953.
Kang, H., Freund, C., Duke-Cohan, J. S., Musacchio, A., Wagner,
G. and Rudd, C. E. (2000). SH3 domain recognition of a
proline-independent tyrosine-based RKxxYxxY motif in immune cell adaptor
SKAP55. EMBO J. 19,2889
-2899.[CrossRef][Medline]
Kay, B. K., Williamson, M. P. and Sudol, M.
(2000). The importance of being proline: the interaction of
proline-rich motifs in signaling proteins with their cognate domains.
FASEB J. 14,231
-241.
Kim-Ha, J., Smith, J. L. and Macdonald, P. M.
(1991). oskar mRNA is localized to the posterior pole of the
Drosophila oocyte. Cell
66, 23-35.[CrossRef][Medline]
Kim-Ha, J., Kerr, K. and Macdonald, P. M.
(1995). Translational regulation of oskar mRNA by bruno, an
ovarian RNA-binding protein, is essential. Cell
81,403
-412.[CrossRef][Medline]
Labeit, S. and Kolmerer, B. (1995). The
complete primary structure of human nebulin and its correlation to muscle
structure. J. Mol. Biol.
248,308
-315.[Medline]
Lane, M. E. and Kalderon, D. (1993). Genetic
investigation of cAMP-dependent protein kinase function in Drosophila
development. Genes Dev.
7,1229
-1243.
Lane, M. E. and Kalderon, D. (1994). RNA
localization along the anteroposterior axis of the Drosophila oocyte requires
PKA-mediated signal transduction to direct normal microtubule organization.
Genes Dev. 8,2986
-2995.
Lantz, V. A., Clemens, S. E. and Miller, K. G.
(1999). The actin cytoskeleton is required for maintenance of
posterior pole plasm components in the Drosophila embryo. Mech.
Dev. 85,111
-122.[CrossRef][Medline]
Lehmann, R. and Nusslein-Volhard, C. (1986).
Abdominal segmentation, pole cell formation, and embryonic polarity require
the localized activity of oskar, a maternal gene in Drosophila.
Cell 47,141
-152.[CrossRef][Medline]
Lin, H., Yue, L. and Spradling, A. C. (1994).
The Drosophila fusome, a germline-specific organelle, contains
membrane skeletal proteins and functions in cyst formation.
Development 120,947
-956.[Abstract]
Lock, P., Fumagalli, S., Polakis, P., McCormick, F. and
Courtneidge, S. A. (1996). The human p62 cDNA encodes Sam68
and not the RasGAP-associated p62 protein. Cell
84, 23-24.[CrossRef][Medline]
Markussen, F. H., Michon, A. M., Breitwieser, W. and Ephrussi,
A. (1995). Translational control of oskar generates short
OSK, the isoform that induces pole plasma assembly.
Development 121,3723
-3732.[Abstract]
Mongiovi, A. M., Romano, P. R., Panni, S., Mendoza, M., Wong, W.
T., Musacchio, A., Cesareni, G. and Di Fiore, P. P. (1999). A
novel peptide-SH3 interaction. EMBO J.
18,5300
-5309.[CrossRef][Medline]
Musacchio, A., Gibson, T., Lehto, V. P. and Saraste, M.
(1992a). SH3-an abundant protein domain in search of a function.
FEBS Lett. 307,55
-61.[CrossRef][Medline]
Musacchio, A., Noble, M., Pauptit, R., Wierenga, R. and Saraste,
M. (1992b). Crystal structure of a Src-homology 3 (SH3)
domain. Nature 359,851
-855.
Musacchio, A., Saraste, M. and Wilmanns, M.
(1994). High-resolution crystal structures of tyrosine kinase SH3
domains complexed with proline-rich peptides. Nat. Struct.
Biol. 1,546
-551.[CrossRef][Medline]
Okamoto, C. T., Li, R., Zhang, Z., Jeng, Y. Y. and Chew, C.
S. (2002). Regulation of protein and vesicle trafficking at
the apical membrane of epithelial cells. J. Control
Release 78,35
-41.[CrossRef][Medline]
Phillips, G. R., Anderson, T. R., Florens, L., Gudas, C., Magda,
G., Yates, J. R., 3rd and Colman, D. R. (2004). Actin-binding
proteins in a postsynaptic preparation: Lasp-1 is a component of central
nervous system synapses and dendritic spines. J. Neurosci.
Res. 78,38
-48.[CrossRef][Medline]
Qualmann, B. and Kessels, M. M. (2002).
Endocytosis and the cytoskeleton. Int. Rev. Cytol.
220,93
-144.[Medline]
Riechmann, V. and Ephrussi, A. (2004). Par-1
regulates bicoid mRNA localisation by phosphorylating Exuperantia.
Development 131,5897
-5907.
Riechmann, V., Gutierrez, G. J., Filardo, P., Nebreda, A. R. and
Ephrussi, A. (2002). Par-1 regulates stability of the
posterior determinant Oskar by phosphorylation. Nat. Cell
Biol. 4,337
-342.[Medline]
Rongo, C., Gavis, E. R. and Lehmann, R. (1995).
Localization of oskar RNA regulates oskar translation and requires Oskar
protein. Development
121,2737
-2746.[Abstract]
Rorth, P. (1998). Gal4 in the Drosophila female
germline. Mech. Dev. 78,113
-118.[CrossRef][Medline]
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element vectors.
Science 218,348
-353.
Schreiber, V., Moog-Lutz, C., Regnier, C. H., Chenard, M. P.,
Boeuf, H., Vonesch, J. L., Tomasetto, C. and Rio, M. C.
(1998). Lasp-1, a novel type of actin-binding protein
accumulating in cell membrane extensions. Mol. Med.
4, 675-687.[Medline]
St Johnston, D., Beuchle, D. and Nusslein-Volhard, C.
(1991). Staufen, a gene required to localize maternal RNAs in the
Drosophila egg. Cell 66,51
-63.[CrossRef][Medline]
Tanaka, T. and Nakamura, A. (2008). The
endocytic pathway acts downstream of Oskar in Drosophila germ plasm assembly.
Development 135,1107
-1117.
Terasaki, A. G., Suzuki, H., Nishioka, T., Matsuzawa, E.,
Katsuki, M., Nakagawa, H., Miyamoto, S. and Ohashi, K.
(2004). A novel LIM and SH3 protein (lasp-2) highly expressing in
chicken brain. Biochem. Biophys. Res. Commun.
313, 48-54.[CrossRef][Medline]
Tomancak, P., Piano, F., Riechmann, V., Gunsalus, K. C.,
Kemphues, K. J. and Ephrussi, A. (2000). A Drosophila
melanogaster homologue of Caenorhabditis elegans par-1 acts at an early step
in embryonic-axis formation. Nat. Cell Biol.
2, 458-460.[CrossRef][Medline]
Van Doren, M., Williamson, A. L. and Lehmann, R.
(1998). Regulation of zygotic gene expression in Drosophila
primordial germ cells. Curr. Biol.
8, 243-246.[CrossRef][Medline]
Vanzo, N. F. and Ephrussi, A. (2002). Oskar
anchoring restricts pole plasm formation to the posterior of the Drosophila
oocyte. Development 129,3705
-3714.
Vanzo, N., Oprins, A., Xanthakis, D., Ephrussi, A. and
Rabouille, C. (2007). Stimulation of endocytosis and actin
dynamics by Oskar polarizes the Drosophila oocyte. Dev.
Cell 12,543
-555.[CrossRef][Medline]
von Dassow, G. and Schubiger, G. (1994). How an
actin network might cause fountain streaming and nuclear migration in the
syncytial Drosophila embryo. J. Cell Biol.
127,1637
-1653.
Yoshida, S., Muller, H. A., Wodarz, A. and Ephrussi, A.
(2004). PKA-R1 spatially restricts Oskar expression for
Drosophila embryonic patterning. Development
131,1401
-1410.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  K. V. Myrick, F. Huet, S. E. Mohr, I. Alvarez-Garcia, J. T. Lu, M. A. Smith, M. A. Crosby, and W. M. Gelbart Large-Scale Functional Annotation and Expanded Implementations of the P{wHy} Hybrid Transposon in the Drosophila melanogaster Genome Genetics, July 1, 2009; 182(3): 653 - 660. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Suyama, A. Jenny, S. Curado, W. P.-v. Berkel, and A. Ephrussi The actin-binding protein Lasp promotes Oskar accumulation at the posterior pole of the Drosophila embryo J. Cell Sci., January 1, 2009; 122(1): e107 - e107. [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2 test).
(B,C) Pole cells of stage 11 embryos produced by females of the
indicated genotypes were stained with anti-Vasa antibodies (C) and counted
(B). The number of pole cells in progeny of laspy45,
osk54/laspy45 (12 cells on average) was
half that of the osk54/+ progeny (23 cells on
average; ***P<0.001; two-sample t-test).
Wild-type embryos have an average of 33 pole cells.
