|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 April 2009
doi: 10.1242/dev.034157
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Departments of Pediatrics and Pathology, University of Chicago, Chicago, IL
60637, USA.
2 Department of Psychiatry, Weill Medical College of Cornell University, New
York, NY 10065, USA.
* Author for correspondence (e-mail: imoskowitz{at}uchicago.edu)
Accepted 17 March 2009
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Hedgehog, Heart, Organogenesis, Cardiac progenitor, Second heart field, Atrial septum, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Reifers et al.,
2000; Klaus et al.,
2007; Ueno et al.,
2007; Thomas et al.,
2008). However, the subsequent steps linking cardiac progenitor
specification to cardiac morphogenesis are less well described. The degree to
which cardiac progenitors are subspecified to unique lineages, the cues that
specify fates among cardiac precursor cells, and whether lineage
specialization occurs in progenitors or later during formal cardiac
morphogenesis remain open questions. Here we investigate the relationship
between cardiac progenitor subspecification and atrial septum
morphogenesis.
The cellular origin of the atrial septal structures is of considerable
clinical, developmental and evolutionary interest. The morphogenesis of the
atrial septum occurs in the mouse between E10 and E13 (reviewed by
Anderson et al., 2003). This
process includes the coordinated development of two distinct physical septa,
the primary atrial septum (PAS) and the dorsal mesenchymal protrusion (DMP;
also known as the spina vestibuli or vestibular spine)
(Snarr et al., 2007a). The
fusion of the mesenchymal cap of the PAS, the DMP and mesenchyme of the
atrioventricular canal endocardial cushions closes the primary atrial ostium.
Recent studies have highlighted a requirement for the DMP in atrioventricular
septation (Tasaka et al.,
1996; Webb et al.,
1998; Wessels et al.,
2000; Kim et al.,
2001; Blom et al.,
2003; Mommersteeg et al.,
2006; Snarr et al.,
2007a; Goddeeris et al.,
2008), and an extracardiac origin of the DMP from the posterior
second heart field (SHF) has also been inferred
(Mommersteeg et al., 2006;
Snarr et al., 2007b;
Goddeeris et al., 2008).
Atrial septal defects (ASDs) are a common class of congenital heart defect
in humans (Hoffman, 1995).
Several cardiogenic transcription factors have been implicated in human ASDs;
haploinsufficiency of Gata4, Nkx2-5 or Tbx5 causes human and
murine ASDs (Lyons et al.,
1995; Basson et al.,
1997; Kuo et al.,
1997; Li et al.,
1997; Schott et al.,
1998; Bruneau et al.,
2001; Garg et al.,
2003). Each is expressed in the atria during atrial septation
(Molkentin et al., 1997;
Kasahara et al., 1998;
Bruneau et al., 1999),
engendering a paradigm for atrial septation in which these transcription
factors are involved in establishing intracardiac positional information
during atrial septum morphogenesis
(Bruneau, 2002). Recent
studies have also demonstrated a role for Hh signaling in atrial and outflow
tract septation within the SHF (Jacob and
Lum, 2007; Washington Smoak et
al., 2005; Lin et al.,
2006; Goddeeris et al.,
2007; Goddeeris et al.,
2008).
Here we report the identification of Hh-induced atrial septum and pulmonary
trunk progenitors in the SHF. Genetic inducible fate mapping
(Joyner and Zervas, 2006)
demonstrates that Hh-receiving cells generate both the primary atrial septum
and the DMP. Hh signaling marks atrial septal progenitors between E8 and E10,
several days prior to atrial septum morphogenesis. Hh signaling also marks
pulmonary trunk progenitors to a greater degree than aortic progenitors during
this period. Marking of atrial septum progenitors by Hh signaling in the
second heart field, their migration into the atria and their participation in
atrial septum morphogenesis is demonstrated. Removal of Hh responsiveness
during atrial septum progenitor specification results in both atrial and
atrioventricular septal defects. Loss- and gain-of-function studies suggest
that Hh signaling acts to specify atrial septum from non-septum atrial
progenitors. Removal of Shh from pulmonary endoderm causes
atrioventricular septal defects, implicating the lung as the source of the Hh
signal required for atrial septation. These observations have implications for
the pathogenesis of atrial septal defects and for the evolution of
cardiopulmonary circulation.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Tamoxifen administration
Activation of CreERT2 was accomplished by oral gavage
with 2 mg Tamoxifen (TM) per dose in corn oil to pregnant dams. Dose titration
was performed to achieve optimal activation of CreERT2
without toxicity, as measured by embryonic size and viability (data not
shown). As CreERT2 activation by TM induction is mosaic
(Ahn and Joyner, 2004a;
Ahn and Joyner, 2004b), serial
section analysis of six hearts from each time point was used for analysis of
R26RGli1-CreERT2 embryos.
Embryo dissection and X-gal staining
Embryos were dissected from maternal tissue samples and tail samples were
taken for genotyping. Embryos were fixed for 1 hour in 4% paraformaldehyde and
stained with X-gal staining solution (5 mM K3Fe(CN)6, 5
mM K4Fe(CN)6, 2 mM MgCl2, 0.02% NP-40, 0.01%
deoxycholate, 0.1% X-gal in PBS) when appropriate or fixed in 10% neutral
buffered formalin. Embryos older than E10.5 were dissected prior to staining.
If X-gal stain was present, slides were counterstained with 50% Eosin for 1
second. If no X-gal stain was present, the slides were stained with
Hematoxylin and Eosin.
In situ hybridization
In situ hybridization was performed using digoxigenin-labeled probes. The
protocol was as described in Biris et al.
(Biris et al., 2007) with the
following changes: embryos were washed for 1 hour six times in maelic acid
buffer (MAB; 0.1 M maelic acid pH 7.5, 0.15 M NaCl, 0.1% Tween-20 and 0.002 M
levamisole) followed by a 16 hour overnight wash at room temperature. Color
reactions were allowed to develop overnight and images were taken prior to
storage in 80% glycerol. Probes for Gli1 and Shh were a kind
gift from Dr Elizabeth Grove (University of Chicago, Chicago, IL, USA).
RT-PCR
RNA was isolated from three embryos per genotype and extracted using Trizol
(Invitrogen). RT-PCR was performed using a OneStep RT-PCR Kit (Qiagen).
Reactions were hot-started at 50°C for 30 minutes for reverse
transcription and heated to 95°C for 15 minutes; then cycled from 95°C
for 1 minute, 55°C for 1 minute and 72°C for 1 minute for 20 cycles;
followed by a final extension for 10 minutes at 72°C. Primer sequences
were: Gli1 forward, TGCCTATAGCCAGTGTCCTC; Gli1 reverse,
CATCTGCTTGGGGTTCCTTA; β-actin forward, TAAGGCCAACCGTGAAAAGATGAC;
β-actin reverse, ACCGCTCGTTGCCAATAGTGATG.
Cell death
Whole-mount cell death analysis was performed using the vital lysosomal dye
LysoTracker Red (Invitrogen), previously shown to be an accurate marker of
cell death (Zucker et al.,
1999; Abu-Issa et al.,
2002; Goddeeris et al.,
2007). Embryos were imaged with an IX70 Olympus Fluoview 200 laser
scanning confocal microscope with a 10x (NA 0.3) dry objective. Images
were prepared with ImageJ software (NIH) and Adobe Photoshop 10.0.1.
Cell proliferation
Pregnant mice at E9.5 and E10.5 were given intraperitoneal injections of
150 µl BrdU solution (Zymed, 00-0103) 5 and 2.5 hours prior to embryo
harvesting. After embryo dissection and sectioning was performed as described
above, proliferation was assessed by marking BrdU-labeled cells using a kit
from Zymed (93-3943).
Statistical methods
β-Galactosidase positive cells were counted on all sections with a DMP
in WT specimens and R26R;SmoGli1-CreERT2
specimens. Cells were classified as either having atrial free wall or DMP
location and were counted, and their sum was used as the total number of
atrial β-galactosidase positive cells. Mean numbers of
β-galactosidase positive cells were compared using the Student's
t-test.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Goddeeris et
al., 2007; Goddeeris et al.,
2008). Although activation of the Hh pathway is not observed
within the developing heart (Goddeeris et
al., 2007; Goddeeris et al.,
2008), tissue-specific ablation of Hh signaling within the
anterior heart field using the transgenic line
Mef2c-AHF-Cre has suggested an anterior heart field
role for Hh signaling in atrial septation
(Goddeeris et al., 2008). We
hypothesized that non-cardiac Hh-receiving cells contribute directly to
cardiac septal structures. We tested this hypothesis in mice using genetic
inducible fate mapping (GIFM) (Joyner and
Zervas, 2006) to mark cells that receive Hh signaling early during
early cardiac morphogenesis and then evaluate their location at the completion
of cardiac septation. Hh-responding cells were marked in space and time using
a Tamoxifen (TM)-inducible Cre recombinase expressed from the
Gli1 locus (Gli1CreERT2), a transcriptional
target of Hh signaling (Ahn and Joyner,
2004a). TM administration activates CreERT2 recombinase
activity within 8 to 12 hours of treatment, for up to 24 hours
(Ahn and Joyner, 2004a;
Ahn and Joyner, 2004b;
Joyner and Zervas, 2006;
Zervas et al., 2004). Using
the Cre-inducible lacZ reporter R26R
(Soriano, 1999) in concert
with Gli1CreERT2, cells and the progeny of cells that
receive Hh signaling and TM simultaneously are labeled by constitutive
lacZ expression. β-galactosidase activity in
R26RGli1-CreERT2 embryos administered with TM at E7.5 or
E8.5 and analyzed 24 hours later recapitulated the endogenous Gli1
expression pattern (data not shown).
Atrial septal structures were specifically marked at E13.0 in
R26RGli1-CreERT2 embryos administered with TM at E7.5,
E8.5 or E9.5 (Fig. 1A,B and C,
respectively). Hh-receiving cells contributed to structures that included the
primary atrial septum (PAS) and the dorsal mesenchymal protrusion (DMP)
(Fig. 1A-C and data not shown).
The cumulative contribution of Hh-receiving cells to the atrial septum was
determined in R26RGli1-CreERT2 embryos administered with
TM at E7.5, 8.5 and 9.5 (Fig.
1D). The complete mesenchymal core of the DMP, the core of the
primary atrial septum and the mesenchymal cap of the primary atrial septum
were marked by E13.0. Marking of atrial septum structures was specific and
consistent, in contrast, the atrial free wall, atrial appendages and
ventricular chambers were only occasionally marked by small groups of
β-galactosidase positive cells, with no consistent pattern between
specimens (Fig. 1 and data not
shown). Small numbers of Hh-receiving cells also contributed to the dorsal
superior and inferior endocardial cushions in embryos administered with TM at
E7.5 (Fig. 1A; blue
arrowheads). Few β-galactosidase positive cells were observed in the
atrial septum from embryos administered with TM earlier, at E6.5, or later, at
E10.5 (data not shown). Consistent with recent studies
(Thomas et al., 2008) TM at
E6.5 marked some atrial and ventricular myocytes (data not shown). These data
demonstrate that Hh signaling marks atrial septum progenitors between E8.0 and
E10.5.
|
|
). In
R26RGli1-CreERT2 marked embryos, the aorta and aortic
trunk (`Ao' in Fig. 2) showed
far fewer β-galactosidase positive cells than the pulmonary trunk
(Fig. 2A-C). Few
β-galactosidase positive cells were observed in the outflow tract from
embryos administered with TM earlier, at E6.5, or later, at E10.5 (data not
shown). Comparison with neural crest-derived cells marked in
R26RWnt1-Cre embryos revealed domains of labeling that
appeared non-overlapping, suggesting that Hh signaling at the times analyzed
marked non-neural crest derivatives (Fig.
2D,E). These data demonstrate that Hh signaling marks pulmonary
trunk progenitors between E8.0 and E10.5.
Hh-receiving cells migrate from the second heart field into the atrial septum and pulmonary trunk
Previous studies have demonstrated that Hh pathway activation appears to be
absent from the developing heart
(Goddeeris et al., 2007;
Goddeeris et al., 2008),
implying that atrial septum and pulmonary trunk progenitors migrate into the
heart after receiving Hh signaling elsewhere. The conclusion that Hh-receiving
cells are marked outside the heart by Gli1CreERT2 relied
on exclusion of Gli1 expression from the heart. We evaluated
Gli1 expression by in situ hybridization and semi-quantitative
RT-PCR. By both methods, Gli1 expression was excluded from the heart
at E9 and E10, and was confined to the splanchnic mesoderm and neural tube in
the axial planes that included the heart (see Fig. S1 in the supplementary
material).
To test the hypothesis that Hh-receiving cardiac progenitors were labeled in SHF mesoderm and subsequently migrated into the heart, the location of Hh-receiving cells was followed by time course analysis. Hh-receiving cardiac progenitors were marked by TM administration to R26RGli1-CreERT2 embryos at E7.5 and E8.5. The location of marked progenitors was evaluated at daily intervals from E8.5 to E12.5 (Figs 3 and 4). At E8.5, β-galactosidase expressing cells marked splanchnic mesoderm and dorsal mesocardium adjacent to the common atrium (Fig. 3A). At E9.5, marked Hh-receiving cells had migrated ventrally to begin populating the dorsal wall of the common atrium (Fig. 3B). At E10.5, a large expansion of Hh-receiving cells had populated the dorsal mesenchymal protrusion and the dorsal wall of the common atrium (Fig. 3C). A population of marked cells extended from the splanchnic mesoderm adjacent to the pulmonary endoderm through the dorsal mesocardium into the DMP. At E11.5, cells in the Hh-receiving population had migrated into central positions within the primary atrial septum and DMP (Fig. 3D). At E12.5, Hh-marked cells formed the primary atrial septum, DMP and dorsal cells in the atrioventricular endocardial cushion (Fig. 3E). Some marked cells were also observed in dorsal locations within the inferior and superior atrioventricular canal endocardial cushions at E11.5 and E12.5 (data not shown). These observations suggest that Hh-receiving cardiac progenitors migrate between E9.5 and E11.5 from posterior SHF splanchnic mesoderm into the atrial septum.
In the cardiac outflow tract, few β-galactosidase expressing cells were identified at E8.5 (Fig. 4A). At E9.5, a few Hh-receiving cells had entered the outflow tract (Fig. 4B). At E10.5, cells in the anterior Hh-receiving population were present in the medial, presumptive pulmonary, region of the outflow tract (Fig. 4C). A direct continuum of cells from the pharyngeal mesoderm into the outflow tract was observed. At E11.5, the medial common cardiac outflow tract was well populated by β-galactosidase expressing cells (Fig. 4D). Outflow tract endocardial cushions were also populated by significant numbers of marked cells (Fig. 4D, right column). At E12.5, Hh-marked cells contributed significantly to the pulmonary trunk primordium, including the pulmonary artery wall and endocardial cushion (Fig. 4E). The continuum of cells from Hh-receiving regions in the pulmonary and pharyngeal mesoderm was no longer observed, suggesting that active migration had ceased. These observations suggest that Hh-receiving cardiac progenitors migrate between E9.5 and E11.5 from pharyngeal mesoderm into the pulmonary artery.
|
; Long et al.,
2001). Smoothened is required for all Hh signal transduction, and
Smo knockout mice exhibit the complete inactivation of all Hh
signaling pathways, as evidenced by the total absence of Ptc1-lacZ
expression (Zhang et al.,
2001). Hh responsiveness was thereby disrupted in cells receiving
TM and Hh simultaneously. SmoGli1-CreERT2 embryos and
littermate controls (Smofl/fl) were administered with TM
at E7.5 and E8.5 and evaluated at E13.5. Mutant
SmoGli1-CreERT2 embryos demonstrated atrial and
atrioventricular septal defects (5/6; Fig.
5B,D). All five affected animals demonstrated atrioventricular
septal defects and three out of five also possessed a common atrium. Each
littermate control demonstrated normal cardiac septation (6/6,
P=0.01; Fig. 5A,C). Hh
signaling is therefore required in atrial septum progenitors for atrial
septation. Neither SmoGli1-CreERT2 embryos (TM
administered at E7.5 and E8.5) nor littermate controls demonstrated outflow
tract septation defects (data not shown). This observation suggests that
either the timing of the requirement for Hh signaling in atrial and outflow
tract progenitors is different or that atrial septation is more sensitive to
partial abrogation of Hh signaling than outflow tract septation.
|
|
Hh signaling specifies septum from non-septum atrial progenitors
We hypothesized that Hh signaling specifically altered the fate of atrial
septal progenitors. We therefore marked Hh-receiving cells and analyzed their
location in wild-type and Hh signaling mutant embryos. We simultaneously
activated lacZ expression and inactivated smoothened in
R26R;SmoGli1-CreERT2 (TM administered at E7.5 and
E8.5) embryos. Hh responsive cells were analyzed in mutant
R26R;SmoGli1-CreERT2 embryos
(Fig. 6B,D) and in littermate
control (R26R;SmoGli1-CreERT2/+) embryos. All
mutant embryos demonstrated atrioventricular septal defects (3/3) compared
with littermate controls showing normal morphology (0/5; P=0.02;
Fig. 6A,C). Hh-receiving cells
failed to populate the atrial septum in
R26R;SmoGli1-CreERT2 embryos, leading to an
atrioventricular septal defect at E13.5
(Fig. 6B, asterisk) and a
hypoplastic DMP at E10.5 (Fig.
6D, arrow), in contrast to the normal Hh-marked atrial lineages
observed in littermate controls. Although the removal of Hh signaling from
atrial septal progenitors caused atrial septal defects, we observed that
numerous Hh-marked cells were nevertheless present in the atria of
R26R;SmoGli1-CreERT2 mutant embryos.
|
Having established that Hh signaling did not affect the total number of
atrial cells, we hypothesized that neither cell death nor proliferation would
be altered in Hh signaling mutants. We assessed cell death in Hh pathway
mutants using LysoTracker Red, a vital lysosomal dye that has been shown to
accurately mark cell death in whole mouse embryos
(Zucker et al., 1999).
SmoGli1-CreERT2 (TM administered at E7.5 and E8.5) and
Shh–/– mutants were compared with littermate
controls (Smofl/fl and Shh+/+,
respectively). No difference in the prevalence of LysoTracker fluorescence was
observed in the posterior SHF and DMP at E9.0 or E10.0, indicating that Hh
signaling does not affect SHF cell survival (see Fig. S2A,B in the
supplementary material and data not shown).
We next assessed proliferation in the posterior SHF in Hh signaling mutants. Proliferation was analyzed using BrdU incorporation in wild-type and Shh–/– mutant embryos before E10.5. The posterior SHF was analyzed following BrdU treatment 5 and 2.5 hours prior to dissection. No discernable difference in the number of proliferating cells was observed in the posterior SHF of Shh–/– and wild-type littermate control embryos (see Fig. S2C-F in the supplementary material). Together, these findings suggest that neither cell survival, nor proliferation, nor migration of cardiac progenitors into the atrium are abnormal in Hh signaling mutants.
We hypothesized that Hh signaling might be necessary to specify atrial septum from non-septum progenitor fate. We analyzed the distribution of Hh-marked atrial cardiac progenitors in control and Hh signaling mutant embryos. In control embryos (n=3), the majority of Hh signaling marked cells were localized to the primordial atrial septum, the DMP (58% DMP versus 42% atrial free wall; P=0.002). However, in R26R;SmoGli1-CreERT2 mutant embryos (n=3), the majority of marked cells were localized to the atrial free wall (28% DMP versus 72% atrial free wall; P=5.18x10–9). Thus, a significant reduction in the number of Hh-receiving cells contributing to the atrial septum was observed. Abrogation of Hh signaling caused marked cells to be significantly less likely to contribute to the atrial septum (58% DMP versus 28% DMP; P=7.83x10–11), and more likely to contribute to the atrial free wall (42% free wall versus 72% free wall; P=7.83x10–11). These results suggest that Hh signaling is required for the specification of a subset of atrial progenitors specific for the atrial septum.
We next hypothesized that Hh signaling might be sufficient for specifying
atrial septum progenitor fate in SHF atrial progenitors. We predicted that
activating the Hh pathway in an expanded domain in the posterior SHF might
cause specification of too many septal progenitors, at the expense of
non-septum atrial progenitors. To test this prediction, we used a conditional
Cre-dependent, constitutively active allele of Smo, R26-smoM2
(Jeong et al., 2004), in
conjunction with two Cre drivers with different SHF expression patterns. When
Gli1CreERT2 was used to constitutively activate
Smo in SHF cells that typically receive Hh signaling, no phenotypic
consequences were observed compared to wild-type embryos
(Fig. 7A,B).
R26-smoM2Gli1-CreERT2 embryos (TM administered at E7.5 and
E8.5) had normal viability and demonstrated normal cardiac morphology,
including the atrial septum (Fig.
7C,D). By contrast, when Nkx2-5Cre
(Moses et al., 2001) was used
to constitutively activate Hh signaling in a broader domain of cardiac
progenitors, including within the SHF (Fig.
7E,F), embryonic lethality and severe atrial septal defects were
observed. R26-smoM2Nkx2.5-Cre caused lethality by E13.5
(12/12). R26-smoM2Nkx2.5-Cre embryos demonstrated specific
abnormalities of the atria and atrial septum compared with R26-smoM2
littermates at E11.5. The DMP of mutant embryos was significantly enlarged,
filling the dorsal cavity of the common atrium
(Fig. 7G,H). The morphology of
the ventricles appeared normal (Fig.
7G,H). These results suggest that expanded second heart field Hh
signaling specifies too many atrial septum progenitors.
|
),
during atrial septal progenitor specification at E8.5, E9.5 and E10.5. Two
regions of strong Hh responsiveness could be discriminated along the
anterior-posterior axis of the SHF splanchnic mesoderm, particularly at E9.5
(Fig. 8C,D) and E10.5
(Fig. 8E,F). A previously
described anterior (cranial) center was observed within the pharyngeal
mesoderm (`Ph' in Fig. 8C,E),
adjacent to the cardiac outflow tract. A distinct posterior (caudal) center
was also present, located within the splanchnic mesoderm of the pulmonary
primordium, adjacent to tracheal pulmonary endoderm (`Tr' in
Fig. 8C-F). These observations
raise the possibility that pulmonary endoderm, a known source of Shh
expression (Litingtung et al.,
1998), is the source of the Hh signal received by posterior SHF
cardiac precursors.
We tested the possibility that Shh is required in pulmonary
endoderm for atrial septation. Nkx2-1Cre drives
Cre expression very early in pulmonary endoderm, concomitant with
atrial septal progenitor specification
(Lazzaro et al., 1991).
Comparison of Shh expression by in situ hybridization
(Fig. 8G,H) and Cre activity in
R26RNkx2.1-Cre embryos demonstrated overlap in the
pulmonary endoderm at E9.0 and 10.0 (Fig.
8I,J and data not shown), the only location of overlap in the
thorax or abdomen. Nkx2-1Cre was used to selectively
remove a conditional allele of Shh in pulmonary endoderm.
ShhNkx2.1-Cre embryos demonstrated reproducible atrial
septal defects at E13.5 (3/3), whereas littermate
Shh+/– control embryos were morphologically normal
(0/5; P<0.01) (Fig.
8K,L). We conclude that Shh expression in the pulmonary
endoderm is required for atrioventricular septation.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
The atrial septum progenitor: a subclass of second heart field cardiac progenitor
The description of the Hh-dependent lineage of atrial septal progenitors
extends our understanding of SHF cardiac progenitor cell specification.
Posterior SHF contributions to the atrium have been recently documented in
detail. The existence of SHF-derived atrial cardiomyocytes was inferred from
retrospective clonal analysis (Meilhac et
al., 2004) and from fate map experiments using
Isl1Cre (Cai et al.,
2003) and Mef2cCre
(Goddeeris et al., 2008).
Recent prospective lineage tracing experiments have directly demonstrated that
posterior SHF derivatives include left and right atrial cardiomyocytes
(Galli et al., 2008). It was
noted that differentiated cells with specific chamber identity are formed from
different regions of the posterior SHF, implying distinct left/right fate
among posterior SHF progenitors. Our results extend this paradigm of
predetermination within the posterior SHF to include septum versus non-septum
atrial progenitor fates. These observations imply considerable molecular
prepatterning within cardiac progenitors and suggest that the molecular logic
governing atrial morphogenesis, including atrial septation, is firmly
established within posterior SHF cardiac progenitors long before formal atrial
septum morphogenesis begins. Whether molecular prepatterning of cardiac
progenitors predicts cardiac morphogenesis as a general principle remains an
important open question.
|
). Our in vivo quantitative analysis also suggested that Hh
signaling is dispensable for migration of atrial progenitors from the SHF into
the atrium (Fig. 6). We can not
rule out the possibility that Hh signaling is required for proper intra-atrial
migration of the septal progenitor cells. A role for Hh signaling in SHF cell
migration was observed in vitro by Goddeeris et al.
(Goddeeris et al., 2008); and
might pertain to the behavior of septal progenitors within the atrium. Our
experimental approach also required recombination of conditional Smo
alleles in a Hh-receiving cell. Therefore, a caveat to our conclusions is the
possibility that earlier or more complete Hh abrogation could uncover effects
on atrial septum progenitor proliferation, cell survival or migration from the
SHF into the atrium.
Atrial septum progenitor specification and congenital heart disease
Anomalies of atrial septation are a major class of human congenital heart
disease. Deficiency of the primary atrial septum (PAS) causes atrial septal
defects of the secundum type. Recent work has implicated maldevelopment of the
DMP as a cause of atrioventricular septal defects, including atrial septal
defects of the primum type, in mice and humans
(Wessels et al., 2000;
Snarr et al., 2007a;
Snarr et al., 2007b;
Goddeeris et al., 2008). Here
we demonstrate that a common molecular pathway marks progenitors of both the
PAS and the DMP and is required for their development. This observation
suggests the possibility of a mechanistic link between at least some primum
and secundum atrial septal defects. The presence of both primum and secundum
atrial septal defects segregating in human families haploinsufficient for
either Tbx5 or Gata4 supports a potential causal
association.
To what degree is atrial septum morphogenesis patterned within the
posterior SHF rather than within the developing atria? The cardiogenic
transcription factors Tbx5, Nkx2-5 and Gata4 are all
implicated in human atrial septal defects and are expressed in atrial
myocardium during formal atrial septum morphogenesis
(Molkentin et al., 1997;
Kasahara et al., 1998;
Bruneau et al., 1999). These
observations have engendered a paradigm describing roles for these
transcription factors in generating intracardiac positional information.
Intriguingly, each transcription factor is also expressed in the posterior SHF
during atrial septal progenitor specification
(Molkentin et al., 1997;
Kasahara et al., 1998;
Bruneau et al., 1999). These
observations raise the possibility that these transcription factors might play
a role in atrial septum progenitor specification. An expanded paradigm for the
requirement of these important cardiac transcription factors in atrial
septation and human atrial septal defects should include possible roles in
both atrial septum progenitors and atrial cardiomyocytes until further work
establishes their true role.
|
). These studies also imply a requirement for endoderm in
later stages of cardiogenesis, including promotion of cardiomyocyte
differentiation and morphogenesis. Recent studies have inferred a direct role
for Shh in the pharyngeal endoderm for cardiac septation
(Goddeeris et al., 2007),
based on the phenocopy of the cardiovascular phenotype of
Shh–/– embryos, including both outflow tract
and atrioventricular septal defects, by conditional ablation of Shh
with Nkx2-5Cre, in concert with the overlap in expression
of Shh and Nkx2-5Cre in the pharyngeal endoderm.
Here we demonstrated that ablation of Shh with the pulmonary
endoderm-specific Cre driver Nkx2-1Cre results in
atrial, but not outflow tract, septal defects
(Fig. 8K,L and data not shown).
As the only overlapping domain of expression between
Nkx2-1Cre and Shh outside of the head was limited
to the pulmonary endoderm, we concluded that pulmonary Shh is
required for atrial septation. Reconciling the presence of atrial septal
defects in ShhNkx2.5-Cre embryos with our conclusion that
the lungs are the responsible signaling source, we demonstrated that
Nkx2-5Cre is also expressed in the pulmonary endoderm,
including the mainstem and branching trachea (inset,
Fig. 7F). No outflow tract
septation defects were observed in ShhNkx2.5-Cre mutant
embryos, demonstrating specificity of pulmonary Shh for inflow tract
septation and implying that two respiratory endodermal sources of Shh
are required for cardiac septation: pharyngeal endoderm for outflow tract
septation and pulmonary endoderm for atrial septation.
Thus, the respiratory primordium appears to pattern cardiac septation of
the inflow and outflow tracts, specifying development of cardiac structures
vital for efficient cardiopulmonary circulation
(Fig. 9). The structures
populated by Hh-induced cardiac progenitors in mice, the atrial septum in the
inflow and the pulmonary trunk in the outflow tract, are orthologous to the
earliest ancestral cardiac septal structures observed in basal tetrapods
(Icardo et al., 2005). We
speculate that cardiac septal structures and the respiratory apparatus
coevolved and that Hh signaling from primordial respiratory structures to
splanchnic mesoderm of the SHF might underlie early events in the evolution of
cardiac septation.
|
Footnotes |
|---|
Supplementary material available online at http://dev.biologists.org/cgi/content/full/136/10/1761/DC1
The authors thank A. Joyner for providing the Gli1-CreERT2 line and A. Imamoto for providing Wnt1-Cre;R26R embryos; and C. Micchelli, M. Nobrega, E. Ferguson, J. Martin, E. McNally and members of the Moskowitz laboratory for critical reading of the manuscript. This study was funded by the NIH (NHLBI-HL078180), the March of Dimes and the American Heart Association. Deposited in PMC for release after 12 months.
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Abu-Issa, R., Smyth, G., Smoak, I., Yamamura, K. and Meyers, E.
N. (2002). Fgf8 is required for pharyngeal arch and cardiac
development in the mouse. Development
129,4613
-4625.
Ahn, S. and Joyner, A. L. (2004a). Dynamic
changes in the response of cells to positive hedgehog signaling during mouse
limb patterning. Cell
118,505
-516.[CrossRef][Medline]
Ahn, S. and Joyner, A. L. (2004b). In vivo
analysis of quiescent adult neural stem cells responding to Sonic hedgehog.
Nature 437,894
-897.[CrossRef]
Anderson, R. H., Webb, S., Brown, N. A., Lamers, W. and Moorman,
A. (2003). Development of the heart: (2) Septation of the
atriums and ventricles. Heart
89,949
-958.
Bajolle, F., Zaffran, S., Kelly, R. G., Hadchouel, J., Bonnet,
D., Brown, N. A. and Buckingham, M. E. (2006). Rotation of
the myocardial wall of the outflow tract is implicated in the normal
positioning of the great arteries. Circ. Res.
98,421
-428.
Basson, C. T., Bachinsky, D. R., Lin, R. C., Levi, T., Elkins,
J. A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T. A.,
Leblanc-Straceski, J. et al. (1997). Mutations in human TBX5
cause limb and cardiac malformation in Holt-Oram syndrome. Nat.
Genet. 15,30
-35.[CrossRef][Medline]
Biris, K. K., Dunty, W. C., Jr and Yamaguchi, T. P.
(2007). Mouse Ripply2 is downstream of Wnt3a and is
dynamically expressed during somitogenesis. Dev. Dyn.
236,3167
-3172.[CrossRef][Medline]
Blom, N. A., Ottenkamp, J., Wenink, A. G. and Gittenberger-de
Groot, A. C. (2003). Deficiency of the vestibular spine in
atrioventricular septal defects in human fetuses with down syndrome.
Am. J. Cardiol. 91,180
-184.[CrossRef][Medline]
Bruneau, B. G., Logan, M., Davis, N., Levi, T., Tabin, C. J.,
Seidman, J. G. and Seidman, C. E. (1999). Chamber-specific
cardiac expression of Tbx5 and heart defects in Holt-Oram syndrome.
Dev. Biol. 211,100
-108.[CrossRef][Medline]
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F.,
Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C.
E. et al. (2001). A murine model of Holt-Oram syndrome
defines roles of the T-box transcription factor Tbx5 in cardiogenesis and
disease. Cell 106,709
-721.[CrossRef][Medline]
Bruneau, B. G. (2002). Transcriptional
regulation of vertebrate cardiac morphogenesis. Circ.
Res. 90,509
-519.
Cai, C. L., Liang, X., Shi, Y., Chu, P. H., Pfaff, S. L., Chen,
J. and Evans, S. (2003). Isl1 identifies a cardiac progenitor
population that proliferates prior to differentiation and contributes a
majority of cells to the heart. Dev. Cell.
5, 877-889.[CrossRef][Medline]
Foley, A. C., Gupta, R. W., Guzzo, R. M., Korol, O. and Mercola,
M. (2006). Embryonic heart induction. Ann. New
York Acad. Sci. 1080,85
-96.[CrossRef][Medline]
Galli, D., Domínguez, J. N., Zaffran, S., Munk, A.,
Brown, N. A. and Buckingham, M. E. (2008). Atrial myocardium
derives from the posterior region of the second heart field, which acquires
left-right identity as Pitx2c is expressed.
Development 35,1157
-1167.
Garg, V., Kathiriya, I. S., Barnes, R., Schluterman, M. K.,
King, I. N., Butler, C. A., Rothrock, C. R., Eapen, R. S., Hirayama-Yamada,
K., Joo, K. et al. (2003). GATA4 mutations cause human
congenital heart defects and reveal an interaction with TBX5.
Nature 424,443
-447.[CrossRef][Medline]
Goddeeris, M. M., Schwartz, R., Klingensmith, J. and Meyers, E.
N. (2007). Independent requirements for Hedgehog signaling by
both the anterior heart field and neural crest cells for outflow tract
development. Development
134,1593
-1604.
Goddeeris, M. M., Rho, S., Petiet, A., Davenport, C. L.,
Johnson, G. A., Meyers, E. N. and Klingensmith, J. (2008).
Intracardiac septation requires hedgehog-dependent cellular contributions from
outside the heart. Development
135,1887
-1895.
Goodrich, L. V., Milenkovi, L., Higgins, K. M. and Scott, M.
P. (1997). Altered neural cell fates and medulloblastoma in
mouse patched mutants. Science
277,1109
-1113.
Hoffman, J. I. E. (1995). Incidence of
congenital heart disease: I. Postnatal incidence. Pediatr.
Cardiol. 16,103
-113.[CrossRef][Medline]
Icardo, J. M., Ojeda, J. L., Colvee, E., Tota, B., Wong, W. P.
and Ip, Y. K. (2005). Heart inflow tract of the African
lungfish Protopterous dolloi. J. Morphol.
263, 30-38.[CrossRef][Medline]
Jacob, L. and Lum, L. (2007). Deconstructing
the hedgehog pathway in development and disease.
Science 318,66
-68.
Jeong, J., Mao J., Tenzen T., Kottmann, A. H. and McMahon A.
P. (2004). Hedgehog signaling in the neural crest cells
regulates the patterning and growth of facial primordia. Genes
Dev. 18,937
-951.
Joyner, A. L. and Zervas, M. (2006). Genetic
inducible fate mapping in mouse: establishing genetic lineages and defining
genetic neuroanatomy in the nervous system. Dev. Dyn.
235,2376
-2385.[CrossRef][Medline]
Kasahara, H., Bartunkova, S., Schinke, M., Tanaka, M. and Izumo,
S. (1998). Cardiac and extracardiac expression of Csx/Nkx2.5
homeodomain protein. Circ. Res.
82,936
-946.
Kim, J. S., Virágh, S., Moorman A. F., Anderson, R. H.
and Lamers, W. H. (2001). Development of the myocardium of
the atrioventricular canal and the vestibular spine in the human heart.
Circ. Res. 88,395
-402.
Klaus, A., Saga, Y., Taketo, M. M., Tzahor, E. and Birchmeier,
W. (2007). Distinct roles of Wnt/beta-catenin and Bmp
signaling during early cardiogenesis. Proc. Natl. Acad. Sci.
USA 104,18531
-18536.
Kuo, C. T., Morrisey, E. E., Anandappa, R., Sigrist, K., Lu, M.
M., Parmacek, M. S., Soudais, C. and Leiden, J. M. (1997).
GATA4 transcription factor is required for ventral morphogenesis and heart
tube formation. Genes Dev.
11,1048
-1060.
Lazzaro, D., Price, M., de Felice, M. and Di Lauro, R.
(1991). The transcription factor TTF-1 is expressed at the onset
of thyroid and lung morphogenesis and in restricted areas of the foetal brain.
Development 113,1093
-1104.[Abstract]
Li, Q. Y., Newbury-Ecob, R. A., Terrett, J. A., Wilson, D. I.,
Curtis, A. R., Yi, C. H., Gebuhr, T., Bullen, P. J., Robson, S. C., Strachan,
T. et al. (1997). Holt-Oram syndrome is caused by mutations
in TBX5, a member of the Brachyury (T) gene family. Nat.
Genet. 15,21
-29.[CrossRef][Medline]
Lin, L., Bu, L., Cai, C. L., Zhang, X. and Evans, S.
(2006). Isl1 is upstream of sonic hedgehog in a pathway required
for cardiac morphogenesis. Dev. Biol.
295,756
-763.[CrossRef][Medline]
Litingtung, Y., Lei, L., Westphal, H. and Chiang, C.
(1998). Sonic hedgehog is essential to foregut development.
Nat. Genet. 20,58
-61.[CrossRef][Medline]
Long, F., Zhang, X. M., Karp, S., Yang, Y. and McMahon, A.
P. (2001). Genetic manipulation of hedgehog signaling in the
endochondral skeleton reveals a direct role in the regulation of chondrocyte
proliferation. Development
128,5099
-5108.
Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E.,
Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenetic
defects in the heart tubes of murine embryos lacking the homeo box gene
Nkx2-5. Genes Dev. 9,1654
-1666.
Meilhac, S. M., Esner, M., Kelly, R. G., Nicolas, J. F. and
Buckingham, M. E. (2004). The clonal origin of myocardial
cells in different regions of the embryonic mouse heart. Dev.
Cell 6,685
-698.[CrossRef][Medline]
Molkentin, J. D., Lin, Q., Duncan, S. A. and Olson, E. N.
(1997). Requirement of the transcription factor GATA4 for heart
tube formation and ventral morphogenesis. Genes Dev.
11,1061
-1072.
Mommersteeg, M. T., Soufan, A. T., de Lange, F. J., van den
Hoff, M. J., Anderson, R. H., Christoffels, V. M. and Moorman, A. F.
(2006). Two distinct pools of mesenchyme contribute to the
development of the atrial septum. Circ. Res.
4, 351-353.
Moses, K. A., DeMayo, F., Braun, R. M., Reecy, J. L. and
Schwartz, R. J. (2001). Embryonic expression of an Nkx2-5/Cre
gene using ROSA26 reporter mice. Genesis
31,176
-180.[CrossRef][Medline]
Reifers, F., Walsh, E. C., Léger, S., Stanier, D. Y. and
Brand, M. (2000). Induction and differentiation of the
zebrafish heart requires fibroblast growth factor 8 (fgf8/acerebellar).
Development 127,225
-235.[Abstract]
Schott, J. J., Benson, D. W., Basson, C. T., Pease, W.,
Silberbach, G. M., Moak, J. P., Maron, B. J., Seidman, C. E. and Seidman, J.
G. (1998). Congenital heart disease caused by mutations in
the transcription factor NKX2-5. Science
281,108
-111.
Snarr, B. S., Wirrig, E. E., Phelps, A. L., Trusk, T. C. and
Wessels, A. (2007a). A spatiotemporal evaluation of the
contribution of the dorsal mesenchymal protrusion to cardiac development.
Dev. Dyn. 236,1287
-1294.[CrossRef][Medline]
Snarr, B. S., O'Neal, J. L., Chintalapudi, M. R., Wirrig, E. E.,
Phelps, A. L., Kubalak, S. W. and Wessels, A. (2007b). Isl1
expression at the venous pole identifies a novel role for the second heart
field in cardiac development. Circ. Res.
101,971
-974.
Solloway, M. J. and Robertson, E. J. (1999).
Early embryonic lethality in Bmp5;Bmp7 double mutant mice suggests functional
redundancy within the 60A subgroup. Development
126,1753
-1768.[Abstract]
Soriano, P. (1999). Generalized lacZ expression
with the ROSA26 Cre reporter strain. Nat. Genet.
21, 70-71.[CrossRef][Medline]
Tasaka, H., Krug, E. L. and Markwald, R. R.
(1996). Origin of the pulmonary venous orifice in the mouse and
its relation to the morphogenesis of the sinus venosus, extracardiac
mesenchyme (spina vestibuli), and atrium. Anat. Rec.
246,107
-113.[CrossRef][Medline]
Thomas, N. A., Koudijs, M., van Eeden, F. J., Joyner, A. L. and
Yelon, D. (2008). Hedgehog signaling plays a cell-autonomous
role in maximizing cardiac developmental potential.
Development 135,3789
-3799.
Ueno, S., Weidinger, G., Osugi, T., Kohn, A. D., Golob, J. L.,
Pabon, L., Reinecke, H., Moon, R. T. and Murry, C. E. (2007).
Biphasic role for Wnt/beta-catenin signaling in cardiac specification in
zebrafish and embryonic stem cells. Proc. Natl. Acad. Sci.
USA 104,9685
-9690.
van den Heuvel, M. and Ingham, P. W. (1996).
Smoothened encodes a receptor-like serpentine protein required for hedgehog
signalling. Nature 382,547
-551.[CrossRef][Medline]
Washington Smoak, I., Byrd, N. A., Abu-Issa, R., Goddeeris, M.
M., Anderson, R., Morris, J., Yamamura, K., Klingensmith, J. and Meyers, E.
N. (2005). Sonic hedgehog is required for cardiac outflow
tract and neural crest cell development. Dev. Biol.
283,357
-372.[CrossRef][Medline]
Webb, S., Brown, N. A. and Anderson, R. H.
(1998). Formation of the atrioventricular septal structures in
the normal mouse. Circ. Res.
82,645
-656.
Wessels, A., Anderson, R. H., Markwald, R. R., Webb, S., Brown,
N. A., Virágh, S., Moorman A. F. and Lamers, W. H.
(2000). Atrial development in the human heart: an
immunohistochemical study with emphasis on the role of mesenchymal tissues.
Anat. Rec. 259,288
-300.[CrossRef][Medline]
Zervas, M., Millet, S., Ahn, S. and Joyner A. L.
(2004). Cell behaviours and genetic lineages of the mesencephalon
and rhombomere 1. Neuron
43,345
-357.[CrossRef][Medline]
Zhang, X. M., Ramalho-Santos, M. and McMahon, A. P.
(2001). Smoothened mutants reveal redundant roles for
Shh and Ihh signaling including regulation of L/R asymmetry by the mouse node.
Cell 105,781
-792.[CrossRef][Medline]
Zucker, R. M., Hunter E. S., III and Rogers J. M.
(1999). Apoptosis and morphology in mouse embryos by confocal
laser scanning microscopy. Methods
18,473
-480.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
