|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 December 2008
doi: 10.1242/dev.026419
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Zoology, Graduate School of Science, Kyoto University, Sakyo-ku,
Kyoto, 606-8502, Japan.
2 Department of Molecular and Cellular Biology, Division of Genetics and
Development, University of California, Berkeley, CA 94720, USA.
* Author for correspondence (e-mail: yutaka{at}ascidian.zool.kyoto-u.ac.jp)
Accepted 7 November 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Ciona intestinalis, Gene regulatory network, Fgf8
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Lowe et al.,
2003; Reichert,
2005). The vertebrate CNS has elaborated on this basic tripartite
structure to produce complexity and novelty. The anterior neural tube develops
into the brain, whereas posterior regions form the spinal cord. The brain
becomes regionalized into forebrain, midbrain and hindbrain, which are further
subdivided at later stages. The MHB organizer is one of the mechanisms used
for the elaboration of the complex vertebrate brain
(Liu and Joyner, 2001;
Wurst and Bally-Cuif, 2001;
Rhinn et al., 2006). A number
of transcription factors and signaling molecules are expressed in the MHB
region, and these molecules constitute a complex genetic network that
establishes and maintains features of the organizer. Fgf8 and Wnt1 are the key
factors in this network controlling the development of the midbrain and
hindbrain.
The ascidian tadpole represents the closest living relative of the
vertebrates and possesses a simplified CNS derived from the dorsal neural
tube. The ascidian CNS consists of a centralized sensory vesicle (SV),
visceral ganglion (VG) and nerve cord composed of 
260 cells
(Meinertzhagen et al., 2004).
There is a morphologically distinguishable domain called the `neck' between
the SV and VG (Nicol and Meinertzhagen,
1988). Although the SV corresponds to the forebrain, it is unclear
whether the neck and VG correspond to the hindbrain and/or spinal ganglia of
vertebrates (Wada et al.,
1998; Dufour et al.,
2006). It is conceivable that a distinct midbrain counterpart is
absent in the ascidian larva (Takahashi
and Holland, 2004). Therefore, the MHB organizer has been regarded
as a novel property of the vertebrate CNS. The vertebrate MHB organizer
secretes Wnt1 and Fgf8, which are important for the MHB organizing activity.
Although the Ciona genome does not contain Wnt1
(Hino et al., 2003), an
ortholog of Fgf8 exhibits localized expression during the development
of the Ciona CNS at the late gastrula stage
(Imai et al., 2004;
Hudson and Yasuo, 2005;
Imai et al., 2006) and at the
middle tailbud stage (Imai et al.,
2002), thereby raising the possibility that an MHB organizer-like
structure operates in ascidians.
To determine the extent to which the compartmentalization of the ascidian and vertebrate CNS are controlled by conserved and non-conserved gene circuits, we have examined the expression and function of a comprehensive set of neural regulatory genes. These studies permitted the reconstitution of a provisional gene regulatory network for the development of the ascidian CNS based on systematic gene disruption assays. The resultant network can explain the causalities of the gene expression profiles seen in the CNS and provide insights into the evolutionary origin of the vertebrate CNS.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
Expression profiles of regulatory genes
Most cDNA clones were obtained from our EST collection
(Satou et al., 2002). The
detailed procedure for whole-mount in situ hybridization has been described
(Satou and Satoh, 1997). Cell
identities were determined by DAPI staining of nuclei.
Gene knockdowns
MO oligonucleotides were purchased from Gene Tools: BMP2/4,
AAGTCCAATCCGTAAGCGCCACCAT; Cdx, TTGTGCGTTTCTCATCAATGGTTGC;
Delta-like, GAAGTAATATAAGCTTGATGCTCAT; Emc,
CAACTTTAACCATTTTGCTGATTCT; en, TGGGCAACCTTGTATTTCGCTTCAT;
ephrinA-b, ACAAAGGCATGGTGATATACGCATT; Fgf8/17/18,
TACTCGCAATGCATTAAATCCGAAT; FoxB, AGTCTCGTCCTGGTCGTGGCATTTT;
Gli, CGCGTTCTCCATGTAAAATCTACGA; Hedgehog2,
ACTGTCCCGCTTATACGTTACTCGC; Hnf6, CAGACTGACCGAGCGAAACTGGCAT;
Irx-C, TAAGACCGGGCAGCTCCGACTGCAT; Lhx3,
AGAATTAACTGTAACAAATTGATCG; Lmx, TTTCGTCGTTAGAAGAACGCAGCAT;
Mnx, CTGACTTTGAAGTACTTAGCATCAT; Msxb,
ATTCGTTTACTGTCATTTTTAATTT; Neurogenin, AAATCCAACATTTTGTAGCAAGAGC;
Nk6, GAACCAGATTCTTCCATGGACATCA; Otx,
CATGTTAGGAATTGAACCCGTGGTA; Pax2/5/8-A, CAGTTCATATTCAAACTTACTAACA;
Pax3/7, AATTAGACCCTGGATGCATCATGTT; Pax6,
GCCTACAAGAATCGTACGTCGCCAT; Snail, GTCATGATGTAATCACAGTAATATA;
SoxB1, AACATGAAGTCGTTCTGAGATGGCT; Tbx2/3,
GAGGTCCACACCAACACTTTAACAT; and Raldh2, GTACTGCTGATACGACTGAAGACAT.
Microinjections were performed as described
(Imai et al., 2000). Blast
searches of the MO sequences could find no possible mis-targeting sites in the
genome sequence (Dehal et al.,
2002), and we found no relations that cannot be explained from the
expression profiles. Different effective MOs produced different phenotypes
(see Fig. S1 in the supplementary material), and we could not find any effects
in embryos injected with an MO against lacZ (data not shown),
indicating that there were no generalized disruptions. For further
confirmation of specificities of the MOs, we injected second MOs against
Fgf8/17/18 (CATTTTCGTATGTAATCCAAGAGAA) and Snail
(TATTTCACAGTGAGAATTTTAATAT), and MOs against Otx
(AGTGTGGAGATTTCAAGTATGACAT) and Neurogenin
(ATCGGTTTGCAGAATAATCCAACAT) of Ciona savignyi, a closely related
species, into Ciona savignyi eggs. We carried out in situ
hybridization of Otx and Pax2/5/8-A for Fgf8/17/18
morphant embryos, of Fgf8/17/18 for Snail morphant embryos,
of Snail for Neurogenin morphant C. savignyi
embryos and of Cyp26, FoxB and Hox1 for Otx
morphant C. savignyi embryos (see Fig. S1 in the supplementary
material). They recapitulated the original phenotypes. All of these
observations support specificities of the MOs used in the present study.
Whole-mount in situ hybridization was used for determining genes expressed in
the downstream of genes that were knocked down.
|
). All were cloned into pCESA vector upstream of unc-76-tagged
GFP or mCherry reporter gene (Dynes and
Ngai, 1998). The detailed procedure for electroporation has been
described previously (Corbo et al.,
1997). |
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
), the posterior region of the sensory vesicle (PSV) and VG
are derived from the posterior neural plate
(Fig. 1A). The short region
between the PSV and VG is called the `neck'. Both the PSV and neck are derived
from a single pair of neuronal progenitor cells in gastrulating embryos,
A9.16, whereas the VG is derived from two neighboring blastomeres, A9.30 and
A9.29 (Fig. 1B). The latter
cell also contributes to the caudal nerve cord, which consists of non-neuronal
ependymal cells. The ventral and dorsal rows of the neural tube are derived
from A9.13/A9.14/A9.15 and b9.37/b9.38, respectively
(Fig. 1C).
|
). To confirm this idea, we traced the A9.30
lineage with an RFP fusion gene containing the Fgf8/17/18 enhancer
(Fig. 1D-F) throughout
development, as Fgf8/17/18 expression is restricted to A9.30 at the late
gastrula stage (Imai et al.,
2004). Co-electroporation of this fusion gene with a GFP fusion
gene containing the enhancer of the acetylcholine transporter gene (AchTP)
identifies two pairs of early post-mitotic cholinergic motoneurons derived
from A9.30 (yellow cells, Fig.
1D). The anterior A9.30 lineage forms non-neuronal ependymal cells
(red cells, Fig. 1E), as well
as two additional pairs of motoneurons in the VG of older embryos (anterior
two yellow cells, Fig. 1E). The
posterior-most pair of motoneurons (A10.57) arises from the A9.29 lineage
(posterior green cells, Fig.
1D,E). Embryos electroporated with a GFP fusion gene containing
the FoxB enhancer permitted visualization of the anterior lineage
arising from A9.16, which forms the PSV. As seen for endogenous FoxB
transcripts, GFP is strongly expressed in the anterior A9.16 lineage that
forms the PSV, but not in the posterior A9.16 lineage that forms the neck
region (Fig. 1F). The neck
consists of quiescent undifferentiated precursors that form the neurons
homologous to cranial motoneurons of vertebrates after metamorphosis
(Dufour et al., 2006). These
molecular data confirmed the idea that the PSV, neck and VG have distinctive
properties (Cole and Meinertzhagen,
2004).
The regulatory states of cells in the developing CNS
An earlier study identified a comprehensive list of regulatory genes
expressed in the developing nervous system
(Imai et al., 2004). The
recent advances in imaging technology and the knowledge of the cell lineages
of the CNS (Cole and Meinertzhagen,
2004) allowed us to elaborate on this description at single cell
resolution by in situ hybridization (summarized in
Fig. 2A-C; see also in situ
hybridizations of control embryos in Fig. S1 in the supplementary material).
The resultant diagrams of the expression profiles of individual cells define
the regulatory states of the cells from the late gastrula to the mid-tailbud
stage.
|
Provisional gene regulatory networks in the developing CNS
On the basis of the expression profile data, we systematically perturbed
the functions of regulatory genes expressed in the CNS with specific
morpholino oligonucleotides (MOs) in order to determine the molecular basis
for the compartmentalization of the Ciona brain. We succeeded in
disrupting the activities of a total of 25 regulatory genes (Tables
1 and
2). In situ hybridization
assays were used to monitor the effects of the different MO-induced mutants on
the expression of all of the regulatory genes expressed at the stages examined
(see Fig. S1 and Table S1 in the supplementary material). This information,
along with earlier results (Imai et al.,
2002; Lemaire et al.,
2002; Hudson and Yasuo,
2005; Moret et al.,
2005; Imai et al.,
2006; Hudson et al.,
2007; Ikuta and Saiga,
2007), was used to create a provisional circuit diagram showing
the interconnections among the regulatory genes controlling the
regionalization of the CNS (Fig.
3A). The simplicity of the system permits the elucidation of gene
networks at single cell resolution (Fig.
3B-E; see Figs S2-S4 in the supplementary material).
|
|
Localized Fgf8/17/18 delineates PSV and neck regions of the Ciona CNS
The reconstituted networks reveal a central role of Fgf8/17/18 in
generating regional patterns of gene expression. Fgf8/17/18 is
expressed at the late gastrula stage in A9.30 (see
Fig. 5C), which forms most of
the VG (A11.117 through A11.120) at later stages. This Fgf signal acts on the
neighboring A9.16 cell to define the neck region of the definitive tadpole
CNS, which forms between the PSV and VG. Otx and FoxB
expression is normally restricted to the anterior-most regions of the CNS,
including the presumptive PSV (Fig.
4A; see Fig. S1Q in the supplementary material; see also
Fig. 2B). There is a posterior
expansion of both expression patterns in morphant embryos injected with an
Fgf8/17/18 MO (Fig. 4B; see
Fig. S1Q in the supplementary material). Thus, Fgf8/17/18 inhibits
Otx and FoxB expression in the neck, thereby restricting
their activities to the PSV. En normally displays periodic expression
in the PSV and VG (Fig. 4C),
but expression extends into the neck of morphant embryos
(Fig. 4D). There is also a loss
of Pax2/5/8-A expression (Fig.
4F), which is normally restricted to a tight stripe of expressing
cells in the neck (Fig. 4E).
Gli, Fgf9/16/20 and Arix, which are normally expressed in
the neck, are lost in morphant embryos, because these genes are under the
control of Pax2/5/8-A (see Fig. S1A,O,S in the supplementary
material). Finally, Hox1 expression is normally restricted to the
neck and VG (Fig. 4G), but
expression is lost in the neck of morphant embryos
(Fig. 4H). Altogether, the
network analysis suggests that the neck is not formed in Fgf8/17/18
morphants, but is transformed into an expanded PSV
(Fig. 4I,J).
Fgf8/17/18 is first expressed at the 64-cell stage in A7.6, which abuts
A7.8 (a progenitor of A9.29-A9.32, the VG and caudal nerve cord lineage
cells), but this expression disappears before the late gastrula stage.
Although this early expression is also suppressed in the Fgf8/17/18
morphant, this early Fgf8/17/18 expression is not likely to be required for
the CNS regionalization, because Pax2/5/8-A is not expressed in
embryos treated with a MEK inhibitor, U0126, from the late gastrula
(Fig. 5). The same Fgf gene is
again expressed in the VG at the middle tailbud stage
(Imai et al., 2002), but this
expression is later than Pax2/5/8-A expression. Therefore, the
expression in A9.30 at the late gastrula stage is most likely to be
responsible for the regionalization of the CNS.
This phenotype of Fgf8/17/18 morphants is evocative of the
transformation of the metencephalon into an expanded mesencephalon seen in
ace (Fgf8a) mutants in the zebrafish CNS where there is
expanded expression of Otx2 (mesencephalon) and a loss of
Pax8 (metencephalon) (Jaszai et
al., 2003). Similar transformations are also seen in conditional
knockout mice of Fgf8 (Chi et al.,
2003). Thus, in the vertebrate CNS, Fgf8 is expressed in the MHB
region and required for proper specification of the midbrain and anterior
hindbrain. We might therefore be able to regard the PSV and neck as
counterparts of the vertebrate midbrain and anterior hindbrain, although this
has been a debatable issue (Wada et al.,
1998; Takahashi and Holland,
2004; Canestro et al.,
2005; Dufour et al.,
2006). Regardless of their exact evolutionary counterparts and the
timing of the signaling, we propose that the recruitment of Fgf8 signaling
might have been a crucial event for the compartmentalization of the chordate
brain. It is less likely that the same signaling system was independently
acquired for similar uses by tunicates and vertebrates.
Despite the apparent similarities in the patterning of the ascidian PSV and
neck with the compartmentalization of the vertebrate midbrain and anterior
hindbrain, we note a number of differences in these processes. First,
Ciona Fgf8/17/18 acts much earlier - during late gastrulation - than
it does in vertebrate embryos. Fgf8 might act early in the ancestral
chordates, as seen in the Ciona embryos, or the timing of Fgf8
signaling might have shifted to earlier stages during the retrograde evolution
of tunicates. Second, Wnt1 is absent in the Ciona genome
(Hino et al., 2003), and,
hence, it is not involved in the regionalization of the Ciona CNS. It
is possible that the ancestral chordate had a regionalization mechanism
directed by Fgf8 and Wnt1, but that Wnt1 was subsequently lost by ascidians.
However, in amphioxus, Wnt1 is not expressed around the boundary of the
putative midbrain and hindbrain, and therefore the ancestral chordate might
have relied solely on an Fgf8-dependent mechanism for regionalization of the
CNS.
|
|
;
Wada et al., 2003). In
contrast to vertebrates, Fgf8/17/18 is positively regulated by Nodal
signals emanating from the b-line neural cells (blue cells in
Fig. 1)
(Imai et al., 2006). The key
component of Fgf8/17/18 regulation is the differential expression of
the Snail repressor in the A9.30 and A9.32 neural progenitors.
Snail expression is explicitly stronger in A9.32 than A9.30
(Fig. 6A). This augmented
expression depends on Neurogenin, which is expressed only in A9.32.
MO-induced suppression of Neurogenin resulted in reduced levels of
Snail in A9.32, similar to the levels normally seen in A9.30 (white
arrowhead, Fig. 6A').
This reduction in Snail causes ectopic activation of
Fgf8/17/18 in the A9.32 lineage (white arrowhead,
Fig. 6B'). There is a
similar de-repression of Fgf8/17/18 expression upon MO-mediated
disruption of Snail activity (Fig.
6C).
Neurogenin is under the control of Nodal signaling, and
suppression of Nodal via MO injection led to the complete elimination
of Snail expression in both A9.30 and A9.32
(Imai et al., 2006). Thus,
Nodal is sufficient to induce low levels of Snail expression
in A9.30. These low levels fail to block Fgf8/17/18 expression, but
might restrict the levels of expression. The enhanced expression of
Snail seen in A9.32 arises from a feed-forward loop: Nodal
induces Neurogenin and the two regulators work together to activate
Snail (Fig. 6D). These
augmented levels of Snail result in the complete repression of
Fgf8/17/18 in the A9.32 lineage of the CNS.
|
|
;
Imai et al., 2006), and the
Delta-Notch signaling contributes to activation of Neurogenin (see
Fig. S1Ad in the supplementary material). Thus, these two inputs induce
localized expression of Neurogenin in A9.32 cooperatively or by a
simple cascade mechanism.
It has been proposed that the ancestral chordates had the Otx/Gbx
system but lacked an apparent MHB organizer, as the Otx and
Gbx expression patterns abut in amphioxus CNS, although other
components of the MHB organizer such as En, Pax2/5/8 and
Wnt1 are not expressed at this boundary
(Castro et al., 2006). If so,
the recruitment of Fgf8 signaling as an MHB organizer might have evolved after
the divergence of the cephalochordates and tunicate/vertebrate lineages. There
are two possible scenarios for the advent of Fgf8 in the compartmentalization
of the vertebrate CNS. First, the Otx/Gbx gene circuit might have
been used to regulate Fgf8 in the ancestral chordate, and the switch
in Fgf8 regulation to the
Nodal/Neurogenin/Snail gene circuit might reflect
the streamlined cell lineages in the early Ciona embryo and the need
for the precise regulation of Fgf8 at single-cell resolution.
Alternatively, Fgf8 regulation by the
Nodal/Neurogenin/Snail gene circuit might be
ancient, and in vertebrates the upstream regulatory mechanism was integrated
into a pre-existing Otx/Gbx gene circuit. In this regard, we note
that orthologs of Fgf8 are regulated by Snail during
gastrulation of the Drosophila embryo (e.g.
Stathopoulos et al.,
2004).
Hox1 expression is controlled by Fgf8/17/18 through retinoic acid signaling
As discussed earlier, Fgf8/17/18 signaling inhibits Otx expression
in the posterior A9.16 lineage, thereby restricting its expression to the
anterior lineage, the future PSV. Otx either directly or indirectly
activates the forkhead regulatory gene FoxB, which represses
Hox1 expression in the PSV. It is well known that Hox genes
are regulated by retinoic acid (RA) signaling in chordates
(Holland and Holland, 1996;
Maden, 2002). It has
previously been shown that RA enhances Hox1 expression in the
Ciona embryo (Nagatomo and
Fujiwara, 2003). RA is synthesized by Raldh2
(retinaldehyde dehydrogenase 2), which is expressed in the most anterior
muscle cells at the tailbud stage (Fig.
7A) (Nagatomo and Fujiwara,
2003). Indeed, knockdown of Raldh2 eliminates
Hox1 expression (Fig.
7B,C). Endogenously synthesized RA is therefore responsible for
Hox1 expression. Interestingly, Cyp26 is expressed in the
presumptive PSV region of the Ciona CNS, and this expression is lost
in morphant embryos injected with either Otx or FoxB MOs
(see Fig. S1F in the supplementary material). Cyp26 encodes an enzyme
responsible for degrading RA. These observations raise the possibility that
FoxB indirectly represses Hox1 expression in the presumptive
PSV by activating Cyp26, which in turn inhibits RA signaling
(Fig. 7D). Previous studies
suggested a possible connection between Fgf signaling and Hox
expression (Irving and Mason,
2000; Shimizu et al.,
2006; Skromne et al.,
2007) and between Cyp26 and Hox expression in
the vertebrate CNS (Hernandez et al.,
2007). We propose that this connection might reflect a direct
regulatory connection between the MHB organizer and RA signaling.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Finally, although the regulatory genes responsible for the
compartmentalization of the vertebrate CNS (e.g. Otx, Pax2,
Neurogenin, etc.) exhibit comparable patterns of expression in the
Ciona CNS, there are both conserved and distinctive features of the
underlying mechanism. Localized Fgf8 signaling is used to deploy these
expression patterns in both systems, even though different regulatory
mechanisms are used to restrict Fgf8.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/2/285/DC1
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Canestro, C., Bassham, S. and Postlethwait, J.
(2005). Development of the central nervous system in the
larvacean Oikopleura dioica and the evolution of the chordate brain.
Dev. Biol. 285,298
-315.[CrossRef][Medline]
Castro, L. F., Rasmussen, S. L., Holland, P. W., Holland, N. D.
and Holland, L. Z. (2006). A Gbx homeobox gene in amphioxus:
insights into ancestry of the ANTP class and evolution of the
midbrain/hindbrain boundary. Dev. Biol.
295, 40-51.[CrossRef][Medline]
Chi, C. L., Martinez, S., Wurst, W. and Martin, G. R.
(2003). The isthmic organizer signal FGF8 is required for cell
survival in the prospective midbrain and cerebellum.
Development 130,2633
-2644.
Cole, A. G. and Meinertzhagen, I. A. (2004).
The central nervous system of the ascidian larva: mitotic history of cells
forming the neural tube in late embryonic Ciona intestinalis. Dev.
Biol. 271,239
-262.[CrossRef][Medline]
Corbo, J. C., Levine, M. and Zeller, R. W.
(1997). Characterization of a notochord-specific enhancer from
the Brachyury promoter region of the ascidian, Ciona intestinalis.
Development 124,589
-602.[Abstract]
Dehal, P., Satou, Y., Campbell, R. K., Chapman, J., Degnan, B.,
De Tomaso, A., Davidson, B., Di Gregorio, A., Gelpke, M., Goodstein, D. M. et
al. (2002). The draft genome of Ciona intestinalis: insights
into chordate and vertebrate origins. Science
298,2157
-2167.
Dufour, H. D., Chettouh, Z., Deyts, C., de Rosa, R., Goridis,
C., Joly, J. S. and Brunet, J. F. (2006). Precraniate origin
of cranial motoneurons. Proc. Natl. Acad. Sci. USA
103,8727
-8732.
Dynes, J. L. and Ngai, J. (1998). Pathfinding
of olfactory neuron axons to stereotyped glomerular targets revealed by
dynamic imaging in living zebrafish embryos. Neuron
20,1081
-1091.[CrossRef][Medline]
Engle, E. C. (2006). The genetic basis of
complex strabismus. Pediatr. Res.
59,343
-348.[CrossRef][Medline]
Hernandez, R. E., Putzke, A. P., Myers, J. P., Margaretha, L.
and Moens, C. B. (2007). Cyp26 enzymes generate the retinoic
acid response pattern necessary for hindbrain development.
Development 134,177
-187.
Hino, K., Satou, Y., Yagi, K. and Satoh, N.
(2003). A genomewide survey of developmentally relevant genes in
Ciona intestinalis. VI. Genes for Wnt, TGFbeta, Hedgehog and JAK/STAT
signaling pathways. Dev. Genes Evol.
213,264
-272.[CrossRef][Medline]
Holland, L. Z. and Holland, N. D. (1996).
Expression of AmphiHox-1 and AmphiPax-1 in amphioxus embryos treated with
retinoic acid: insights into evolution and patterning of the chordate nerve
cord and pharynx. Development
122,1829
-1838.[Abstract]
Hudson, C. and Yasuo, H. (2005). Patterning
across the ascidian neural plate by lateral Nodal signalling sources.
Development 132,1199
-1210.
Hudson, C., Lotito, S. and Yasuo, H. (2007).
Sequential and combinatorial inputs from Nodal, Delta2/Notch and FGF/MEK/ERK
signalling pathways establish a grid-like organisation of distinct cell
identities in the ascidian neural plate. Development
134,3527
-3537.
Ikuta, T. and Saiga, H. (2007). Dynamic change
in the expression of developmental genes in the ascidian central nervous
system: revisit to the tripartite model and the origin of the
midbrain-hindbrain boundary region. Dev. Biol.
312,631
-643.[CrossRef][Medline]
Imai, K., Takada, N., Satoh, N. and Satou, Y.
(2000). β-catenin mediates the specification of endoderm
cells in ascidian embryos. Development
127,3009
-3020.[Abstract]
Imai, K. S., Satoh, N. and Satou, Y. (2002).
Region specific gene expressions in the central nervous system of the ascidian
embryo. Mech. Dev. 119Suppl. 1, S275-S277.[CrossRef][Medline]
Imai, K. S., Hino, K., Yagi, K., Satoh, N. and Satou, Y.
(2004). Gene expression profiles of transcription factors and
signaling molecules in the ascidian embryo: towards a comprehensive
understanding of gene networks. Development
131,4047
-4058.
Imai, K. S., Levine, M., Satoh, N. and Satou, Y.
(2006). Regulatory blueprint for a chordate embryo.
Science 312,1183
-1187.
Irving, C. and Mason, I. (2000). Signalling by
FGF8 from the isthmus patterns anterior hindbrain and establishes the anterior
limit of Hox gene expression. Development
127,177
-186.[Abstract]
Jaszai, J., Reifers, F., Picker, A., Langenberg, T. and Brand,
M. (2003). Isthmus-to-midbrain transformation in the absence
of midbrain-hindbrain organizer activity. Development
130,6611
-6623.
Lemaire, P., Bertrand, V. and Hudson, C.
(2002). Early steps in the formation of neural tissue in ascidian
embryos. Dev. Biol. 252,151
-169.[CrossRef][Medline]
Liu, A. and Joyner, A. L. (2001). Early
anterior/posterior patterning of the midbrain and cerebellum. Annu.
Rev. Neurosci. 24,869
-896.[CrossRef][Medline]
Lowe, C. J., Wu, M., Salic, A., Evans, L., Lander, E.,
Stange-Thomann, N., Gruber, C. E., Gerhart, J. and Kirschner, M.
(2003). Anteroposterior patterning in hemichordates and the
origins of the chordate nervous system. Cell
113,853
-865.[CrossRef][Medline]
Maden, M. (2002). Retinoid signalling in the
development of the central nervous system. Nat. Rev.
Neurosci. 3,843
-853.[CrossRef][Medline]
Meinertzhagen, I. A., Lemaire, P. and Okamura, Y.
(2004). The neurobiology of the ascidian tadpole larva: recent
developments in an ancient chordate. Annu. Rev.
Neurosci. 27,453
-485.[CrossRef][Medline]
Moret, F., Christiaen, L., Deyts, C., Blin, M., Vernier, P. and
Joly, J. S. (2005). Regulatory gene expressions in the
ascidian ventral sensory vesicle: evolutionary relationships with the
vertebrate hypothalamus. Dev. Biol.
277,567
-579.[CrossRef][Medline]
Nagatomo, K. and Fujiwara, S. (2003).
Expression of Raldh2, Cyp26 and Hox-1 in normal and retinoic acid-treated
Ciona intestinalis embryos. Gene Expr. Patterns
3, 273-277.[CrossRef][Medline]
Nicol, D. and Meinertzhagen, I. A. (1988).
Development of the central nervous system of the larva of the ascidian, Ciona
intestinalis L. II. Neural plate morphogenesis and cell lineages during
neurulation. Dev. Biol.
130,737
-766.[CrossRef][Medline]
Reichert, H. (2005). A tripartite organization
of the urbilaterian brain: developmental genetic evidence from Drosophila.
Brain Res. Bull. 66,491
-494.[CrossRef][Medline]
Rhinn, M., Picker, A. and Brand, M. (2006).
Global and local mechanisms of forebrain and midbrain patterning.
Curr. Opin. Neurobiol.
16, 5-12.[CrossRef][Medline]
Satou, Y. and Satoh, N. (1997). Posterior end
mark 2 (pem-2), pem-4, pem-5, and pem-6: maternal genes with localized mRNA in
the ascidian embryo. Dev. Biol.
192,467
-481.[CrossRef][Medline]
Satou, Y., Yamada, L., Mochizuki, Y., Takatori, N., Kawashima,
T., Sasaki, A., Hamaguchi, M., Awazu, S., Yagi, K., Sasakura, Y. et al.
(2002). A cDNA resource from the basal chordate Ciona
intestinalis. Genesis
33,153
-154.[CrossRef][Medline]
Shimizu, T., Bae, Y.-K. and Hibi, M. (2006).
Cdx-Hox code controls competence for responding to Fgfs and retinoic acid in
zebrafish neural tissue. Development
133,4709
-4719.
Skromne, I., Thorsen, D., Hale, M., Prince, V. E. and Ho, R.
K. (2007). Repression of the hindbrain developmental program
by Cdx factors is required for the specification of the vertebrate spinal
cord. Development 134,2147
-2158.
Stathopoulos, A., Tam, B., Ronshaugen, M., Frasch, M. and
Levine, M. (2004). pyramus and thisbe: FGF genes that pattern
the mesoderm of Drosophila embryos. Genes Dev.
18,687
-699.
Takahashi, T. and Holland, P. W. (2004).
Amphioxus and ascidian Dmbx homeobox genes give clues to the vertebrate
origins of midbrain development. Development
131,3285
-3294.
Wada, H., Saiga, H., Satoh, N. and Holland, P. W.
(1998). Tripartite organization of the ancestral chordate brain
and the antiquity of placodes: insights from ascidian Pax-2/5/8, Hox and Otx
genes. Development 125,1113
-1122.[Abstract]
Wada, S., Tokuoka, M., Shoguchi, E., Kobayashi, K., Di Gregorio,
A., Spagnuolo, A., Branno, M., Kohara, Y., Rokhsar, D., Levine, M. et al.
(2003). A genomewide survey of developmentally relevant genes in
Ciona intestinalis. II. Genes for homeobox transcription factors.
Dev. Genes Evol. 213,222
-234.[CrossRef][Medline]
Wurst, W. and Bally-Cuif, L. (2001). Neural
plate patterning: upstream and downstream of the isthmic organizer.
Nat. Rev. Neurosci. 2,99
-108.[CrossRef][Medline]
Yoshida, R., Sakurai, D., Horie, T., Kawakami, I., Tsuda, M. and
Kusakabe, T. (2004). Identification of neuron-specific
promoters in Ciona intestinalis. Genesis
39,130
-140.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
This article has been cited by other articles:
|
|
 |
|
  A. Kubo, K. S. Imai, and Y. Satou Gene-regulatory networks in the Ciona embryos Brief Funct Genomic Proteomic, July 1, 2009; 8(4): 250 - 255. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
