|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 13, 2009
doi: 10.1242/10.1242/dev.024901
1 Stem Cell Center, Lund University, 22184 Lund, Sweden.
2 Department of Developmental Biochemistry, Institute of Biochemistry and Cell
Biology, Georg August University Göttingen, 37077 Göttingen,
Germany.
* Author for correspondence (e-mail: edgar.pera{at}med.lu.se)
Accepted 30 November 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: RDH10, Retinol dehydrogenase, Short chain dehydrogenase/reductase, Retinoic acid, Morphogen, Gradient, Spemann's organizer, Gastrulation, Induction, Pattern formation, Hindbrain, CNS, Xenopus
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). An
`activation/transformation' model has been proposed for the anteroposterior
patterning of the CNS (Nieuwkoop,
1952). First, the early neurectoderm acquires an anterior
(forebrain) fate. In a second inductive wave, additional signals emanating
from the organizer and/or the embryonic mesoderm transform neural tissue into
more posterior midbrain, hindbrain, and spinal cord fates. Studies in
Xenopus have identified several factors that mediate the first
activation step, including soluble BMP antagonists, such as Chordin and Noggin
(De Robertis and Kuroda, 2004;
Khoka et al., 2005), Wnt antagonists
(Niehrs, 2004), and active
signals, including insulin-like growth factors
(Pera et al., 2001;
Richard-Parpaillon et al.,
2002). These diverse signals are integrated at the level of Smad1
phosphorylation and turnover (Pera et al.,
2003; Fuentealba et al.,
2007). Three signalling pathways, including retinoic acid,
fibroblast growth factor and Wnt, contribute to the transforming signal and
interact in a complex manner to specify posterior neural structures
(Durston et al., 1989;
Cho and De Robertis, 1990;
Kudoh et al., 2002;
Shiotsugu et al., 2004;
Olivera-Martinez and Storey,
2007).
Retinoic acid (RA) is the most active naturally occurring member of a
family of lipophilic molecules called retinoids, all of which are derived from
vitamin A (Clagett-Dame and De Luca,
2002). The RA signal is transduced through nuclear retinoic acid
receptors, the RARs and RXRs, which control the expression of target genes
involved in vertebrate pattern formation, organogenesis and tissue homeostasis
(Mark et al., 2006). Maternal
insufficiency of vitamin A or excess RA cause a wide range of teratologic
effects - from limb malformations and organ defects to CNS abnormalities -
indicating that the embryo requires a precisely regulated supply of retinoids
(Ross et al., 2000). In
Xenopus embryos, exogenously applied RA during gastrula stages
produces a concentration-dependent truncation of anterior structures and an
enhancement of posterior structures
(Durston et al., 1989;
Sive et al., 1990) through its
influence on the embryonic mesoderm and ectoderm
(Ruiz i Altaba and Jessell,
1991; Papalopulu et al.,
1991). RA regulates the expression of the homeotic Hox genes,
which act in a combinatorial fashion (`Hox code') to specify axial identity in
the trunk (Kessel and Gruss,
1991; Kessel,
1992) and the hindbrain
(Marshall et al., 1992).
During embryonic development, the availability of RA is regulated by
retinal dehydrogenases (RALDHs) that mediate the oxidation of retinal to RA,
and by members of the cytochrome P450 family (CYP26s) that metabolize RA via
oxidative inactivation (Niederreither and
Dollé, 2008; Duester,
2008). In several vertebrates, the RALDH2 gene exhibits
tissue-specific expression (Niederreither
et al., 1997; Swindell et al.,
1999; Chen et al.,
2001) at or adjacent to sites of RA signalling
(Rossant et al., 1991;
Mendelsohn et al., 1991;
Balkan et al., 1992;
Yelin et al., 2005). In
Xenopus, overexpression of RALDH2 mimicked RA signalling
(Chen et al., 2001).
Loss-of-function studies in mice and zebrafish showed that RALDH2 is not only
critical for development, but that it accounts for the majority of RA
production in the embryo (Niederreither et
al., 1999; Begemann et al.,
2001; Grandel et al.,
2002). Expression analysis in various species suggested that
CYP26A1 is the major RA-degrading enzyme during gastrulation
(Hollemann et al., 1998;
de Roos et al., 1999;
Swindell et al., 1999;
Dobbs-McAuliffe et al., 2004).
In Xenopus, overexpression of CYP26A1 mRNA caused phenotypes
resembling RA deprivation (Hollemann et
al., 1998). Functional studies in mouse and zebrafish embryos
revealed a crucial role for CYP26A1 in axis specification, hindbrain
patterning and tail formation (Abu-Abed et
al., 2001; Sakai et al.,
2001; Kudoh et al.,
2002; Hernandez et al.,
2007).
|
), whereas oviparous embryos use retinoid and carotinoid
stores in the egg yolk (Lampert et al.,
2003). A multitude of cytosolic alcohol dehydrogenases and
microsomal short-chain dehydrogenases/reductases (SDRs)
(Duester et al., 2003;
Lidén and Eriksson,
2006), as well as the recently identified CYP1B1 mono-oxygenase
(Chambers et al., 2007), can
mediate the first step of RA synthesis from vitamin A. Retinol dehydrogenase
10 (RDH10) is a member of the SDR family that oxidizes retinol into retinal
(Wu et al., 2002;
Wu et al., 2004) in an
NAD+-dependent manner (Belyaeva
et al., 2008), and exhibits tissue-specific expression at
embryonic and foetal mouse stages (Sandell
et al., 2007; Cammas et al.,
2007; Romand et al.,
2008). Analysis of an N-ethyl-N-nitrosourea-generated mutant
called trex suggested an essential function of murine RDH10 for RA
biosynthesis during limb, craniofacial and organ development
(Sandell et al., 2007).
However, RDH10 has not been studied in species other than mammals, its
regulation is not understood, and the interplay with other RA metabolizing
enzymes, as well as its functions in early aspects of embryonic development,
remain to be addressed.
In a screen for secreted proteins, we have recently identified the
Xenopus homologue of RDH10 (Pera
et al., 2005). XRDH10 expression partially overlaps with
that of XRALDH2 in the early embryo and is subject to
negative-feedback regulation by endogenous RA. XRDH10 mimics RA
signalling and modulates organizer-specific gene expression. We find that
XRDH10 cooperates with XRALDH2, and that both enzymes are required to ensure
proper RA signalling in the early embryo. Our data describe a novel role of
RDH10 in axis formation and CNS development. We present a revised model for
the generation of the RA morphogen gradient.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
XRDH10 was fully sequenced (Gene Accession Number FJ213456). To
generate the rescue construct pCS2-XRDH10*, the wobbled
nucleotides in codons 2-8 were exchanged via a PCR-based two-step mutagenesis
from pCS2-XRDH10, using the primers XRDH10-wob-F-1st
(ATGCATATAGTCCTCGAATTCTTTCTGGTC), XRDH10-wob-F-2nd
(GCATCGATATGCATATCGTCGTGGAATTTTTTGTGGTC) XRDH10-R
(GCCTCGAGTTAAAATTCCATTTTTTGTTTCATTG), and the final PCR products were inserted
into the ClaI and XhoI restriction sites of pCS2.
pCS2-mRALDH2 was generated from pCMV-Sport6-Aldh1a2
(Imagenes GmbH, Germany; IMAGE ID, 30471325) by subcloning the insert into the
EcoRI and XbaI sites of pCS2. Plasmid constructs were
checked by sequencing and in vitro translation (TnT-Coupled Reticulocyte
Lysate System, Promega).
To prepare sense RNA, pCS2 constructs of XRDH10, XRDH10*,
XRALDH2, mRALDH2 and XCYP26A1
(Hollemann et al., 1998) (a
kind gift of Tomas Pieler, Göttingen University, Germany) were linearized
with NotI and transcribed with Sp6 RNA polymerase (mMessage Machine,
Ambion). mRNA encoding nuclear β-galactosidase was synthesized from
pXEXβgal (a kind gift of Richard Harland, UC Berkeley, CA, USA;
XbaI digestion and T7 transcription). The XRDH10-MO
(GGAAGAACTCGAGCACTATGTGCAT), XRALDH2-MO (GCATCTCTATTTTACTGGAAGTCAT)
and standard control-MO were obtained from Gene Tools.
All-trans-retinoic acid (Sigma, R2625), all-trans-retinol (Fluka, 95144) and disulfiram (Sigma, T1132) were dissolved in DMSO as 10 mM, 50 mM and 250 mM stock solutions, respectively. All-trans-retinal (Sigma, R2500) and citral (Sigma, W230308) were dissolved in 70% ethanol as 5 mM and 40 mM stock solutions, respectively. The stock solutions were then diluted to the final concentrations either in 0.1xMBS (for treatment of whole embryos) or in 1xMBS (for treatment of animal cap explants).
|
). Gelatine/albumin sections (40 µm) were done using a
LeicaVT1200S vibratome.
Total RNA was extracted and the PCR reaction performed as reported
(Hou et al., 2007), primers
and cycle numbers are available on request. The PCR products were separated on
2% agarose gels.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). A
42-kDa protein was identified by SDS-PAGE in the supernatant of
cDNA-transfected HEK293T cells after metabolic labelling with
35S-methionine and 35S-cysteine
(Fig. 1A). XRDH10 encodes a 341
amino acid protein, containing an amino terminal cleavable signal peptide, an
NAD+-cofactor binding site and a catalytic site
(Fig. 1B). Two pseudoalleles of
RDH10 in X. laevis were found, encoding XRDH10a and XRDH10b
(95% amino acid identity). XRDH10a has considerable identity to human and
mouse (88%), chick (87%) and zebrafish (77%) RDH10
(Fig. 1C,D).
Analysis by RT-PCR indicated that XRDH10 is a maternal and zygotic
gene with elevated expression levels at gastrula and neurula stages
(Fig. 2A). Whole-mount in situ
hybridization showed abundant transcripts in four-cell and blastula-stage
embryos (Fig. 2B,C), and RT-PCR
revealed equivalent levels of XRDH10 mRNA at the animal and vegetal
pole (Fig. 2D). At gastrula
stage, distinct expression of XRDH10 was observed in the invaginating
mesoderm of the dorsal blastopore lip (Fig.
2E,F). The signals were embedded in the periblastoporal expression
domain of XRALDH2 (Fig.
2G) (Chen et al.,
2001), and juxtaposed to two distinct XCYP26A1 expression
domains in the dorsal animal cap and the ventrolateral blastopore lip
(Fig. 2H)
(Hollemann et al., 1998). As
gastrulation proceeded, XRDH10 transcripts were observed in the head
process, anterior lateral plate, presomitic mesoderm, ventral blastopore lip
and cardiac crescent (Fig.
2I-K). In neural plate stage embryos, XRDH10 and
XRALDH2 genes displayed nested expression patterns in the paraxial
trunk mesoderm, with XRDH10 transcripts localized more anteriorly
than XRALDH2 signals (Fig.
2J,L) (Chen et al.,
2001). These sites of expression were flanked by non-overlapping
XCYP26A1 expression domains in the anterior and posterior parts of
the neural plate (Fig. 2M)
(Hollemann et al., 1998). In
early tailbud stage embryos, XRDH10 mRNA overlapped with
XRALDH2 expression in the eye field
(Fig. 2N,O)
(Chen et al., 2001), whereas
distinct XCYP26A1 signals could be seen around the eye anlage
(Fig. 2P)
(Hollemann et al., 1998).
Additional XRDH10 expression domains arose in the pronephros anlage,
the trunk neural crest, and the posterior inner wall of the proctodeum
(Fig. 2Q). In more advanced
tailbud embryos, XRDH10 signals were seen in distinct territories of
the neural tube (including in the telencephalon, midbrain, midbrain-hindbrain
boundary and spinal cord), in the olfactory system, in the eyes and ears, and
in the posterior branchial arch, the anterior lateral plate and the posterior
notochord (Fig. 2R-X). Common
XRALDH2 expression domains were seen in the telencephalon, spinal
cord, eyes, ears, anterior lateral plate and pronephros
(Fig. 2Y)
(Chen et al., 2001). Adjacent,
but non-overlapping XCYP26A1 expression appeared in the periocular
region, in tissues that flank the pronephros, and in the tip of the tailbud
(Fig. 2Z)
(Hollemann et al., 1998). In
conclusion, the gene expression of XRDH10 and XRALDH2
overlapped at several sites, with XRDH10 expression domains being
frequently embedded in those of XRALDH2. By contrast,
XCYP26A1 displayed a complementary, non-overlapping expression
pattern.
|
; Cammas et al.,
2007) raised the hypothesis that RA may regulate RDH10
transcription. Treatment of Xenopus embryos with 5 µM RA induced a
severe reduction of XRDH10 expression
(Fig. 3A-D). Although
microinjection of XRALDH2 mRNA alone had no effect, a combination of
XRALDH2 mRNA and treatment with 5 µM retinal caused a robust
downregulation of XRDH10 transcription
(Fig. 3E,F). By contrast,
exposure to the RA synthesis inhibitors disulfiram
(Vermot and Pourquié,
2005) or citral (3,7-dimethyl-2,6-octadienal)
(Schuh et al., 1993) increased
transcript levels of XRDH10 in the embryo
(Fig. 3G-J). Similarly,
microinjection of XCYP26A1 mRNA caused local upregulation of
XRDH10 expression (Fig.
3K,L). We conclude that endogenous RA suppresses XRDH10
gene expression and thereby controls the first enzymatic step of RA
biosynthesis (Fig. 3M).
XRDH10 has retinoic acid-like activity and modulates organizer-specific gene expression
We investigated the activity of XRDH10 in Xenopus embryos
(Fig. 4). Microinjection of
XRDH10 mRNA into the animal pole at the four-cell stage caused a
moderate reduction of head structures and shortening of the primary body axis
(Fig. 4A,B). This phenotype is
reminiscent of the microcephaly and shortened tails obtained by treating
embryos with 0.1 µM retinoic acid (Fig.
4C) (Durston et al.,
1989). Co-injection of XRDH10 and XCYP26A1 mRNA
rescued head and tail structures (Fig.
4D), and treatment of XRDH10-injected embryos with citral
restored axial development (Fig.
4E), suggesting that XRDH10 may elicit its activity via the RA
pathway. To test whether XRDH10 affects RA signalling, we analyzed in animal
cap explants a series of RA target genes, including Xgbx2, Xcad3,
Meis3 and HoxD1 (von Bubnoff
et al., 1995; Kolm et al.,
1997; Dibner et al.,
2004; Shiotsugu et al.,
2004). RT-PCR analysis revealed that, similar to exogenous RA,
injected XRDH10 mRNA induced an upregulation of these genes
(Fig. 4F). The results show
that XRDH10 and RA have common activities, and that XRDH10 activity is
abrogated by the inhibition of RA signals, suggesting that XRDH10 activates RA
signalling in Xenopus embryos.
|
) and Chordin
(Fig. 4M,N) expression, but a
downregulation of Goosecoid (Fig.
4Q,R) (Cho et al.,
1991) and ADMP (Fig.
4U,V) expression. We note that Chordin expression in the
dorsal ectoderm of earlier blastula embryos was moderately increased by
XRDH10 mRNA injection and RA treatment (see Fig. S1 in the
supplementary material). The organizer markers Noggin, Frzb1, sFRP2
and Crescent were not obviously affected in gastrula embryos (see
Fig. S2 in the supplementary material). We conclude that XRDH10
overexpression mimics RA activity and differentially affects gene expression
in the Spemann's organizer.
XRDH10 co-operates with XRALDH2 during axis development and CNS patterning
Next we analyzed the effects of XRDH10 on pattern formation at
post-gastrulation stages (Fig.
5). At stage 12.5, HoxD1 is expressed in the trunk
mesoderm and overlying ectoderm with the anterior boundary at the level of
hindbrain rhombomere 4 (Fig.
5A). Unilateral injection of XRDH10 mRNA caused
upregulation and anteriorward expansion of HoxD1 expression
(Fig. 5B). XRALDH2
alone or upon co-injection with XRDH10 mRNA had a similar effect
(Fig. 5C,D). By contrast,
XCYP26A1 reverted the effect of co-injected XRDH10 mRNA, as
it reduced HoxD1 expression and shifted its anterior boundary
posteriorly (Fig. 5E). At stage
14, Xlim1 labels two rows of neural expression in the trunk
(arrowhead in Fig. 5F).
Injected XRDH10 or XRALDH2 mRNA caused an anterior shift
(Fig. 5G,H), and a combination
of both mRNAs led to a robust expansion of these Xlim1-positive
neural cells (Fig. 5I).
XCYP26A1 overrode the effect of co-injected XRDH10 mRNA and
suppressed Xlim1 expression (Fig.
5J).
Previous studies had shown that overexpression of XRALDH2
posteriorized the neural tube (Chen et
al., 2001), whereas XCYP26A1 had the opposite effect
(Hollemann et al., 1998). At
the tailbud stage, XRDH10 mRNA showed little effect when injected
alone (Fig. 5L,Q). However,
XRDH10 enhanced the posteriorizing effect of XRALDH2 mRNA
and caused an anterior shift of the hindbrain rhombomeres 3 and 5
(Krox20), and led to a distortion of the midbrain-hindbrain boundary
(En2) and eye field (Rx2A) upon co-injection of both mRNAs
(Fig. 5M,N,R,S). Conversely, a
combination of XRDH10 and XCYP26A1 mRNA resulted in a
pronounced posterior shift of these markers
(Fig. 5O,T). The location of
the telencephalon (FoxG1) was not affected by any of the injections
(Fig. 5Q-T). The analysis of
Krox20 expression showed that the frequency and extent of rhombomeric
shifts induced by a combination of XRDH10 and XRALDH2
exceeded the sum of effects induced by each mRNA alone
(Fig. 5U). The data indicate
that XRDH10 co-operates with XRALDH2 in stimulating RA signalling in the early
embryo and that both enzymes exhibit synergistic effects on anteroposterior
patterning of the CNS.
|
), treatment of embryos between stages 9 and 12 with 50 µM
retinol caused microcephaly (Fig.
6B). Although animal injection of XRDH10 mRNA alone had
little effect (Fig. 4B),
XRDH10 mRNA injection followed by treatment with retinol caused the
complete loss of eye and head structures (anencephaly;
Fig. 6C). The effects of
XRDH10 and retinol were reverted by co-injection of XCYP26A1
mRNA in a dose-dependent manner (Fig.
6D,E). At the tailbud stage, retinol treatment caused a mild
reduction of the eye field marker Rx2A
(Fig. 6F,G). As shown above,
injected XRDH10 mRNA did not reduce the size of the eye field
(Fig. 5L). However, a
combination of XRDH10 mRNA injection and retinol administration led
to a significant downsizing of the eye anlage
(Fig. 6H), which was rescued by
XCYP26A1 mRNA (Fig.
6I). Together, the results suggest that the supply of retinol may
be limiting for XRDH10 activity during head development and eye formation.
Roles of XRDH10 and XRALDH2 in the embryo
To study the functional contribution of enzymes involved in RA
biosynthesis, we downregulated endogenous XRDH10 and XRALDH2 proteins in
Xenopus embryos (Fig.
7). Specific antisense morpholino oligonucleotides (MOs) directed
against the translation initiation sites of the known pseudoalleles of
XRDH10 (Fig. 7A) and
XRALDH2 (Fig. 7B)
reduced protein synthesis of their respective targets in an in vitro
transcription-translation assay, whereas an unspecific control MO had no
effect (Fig. 7C,D).
Microinjection of XRDH10-MO into the margin of two-cell-stage embryos caused a reduction of head structures and enlarged ventroposterior structures at the tailbud stage (Fig. 7F). In tadpole embryos, knockdown of XRDH10 led to smaller eyes and a significant shortening of the tail (Fig. 7I). Similar ventralized phenotypes were obtained with the XRALDH2-MO (Fig. 7G,J). To verify that the effects of the morpholino oligomers were specific, we generated a XRDH10 rescue construct, designated XRDH10*, in which six nucleotides in the morpholino target sequence were mutagenized (see Materials and methods). Injection of XRDH10* mRNA rescued the phenotype caused by XRDH10-MO (insets in Fig. 7F,I). Similarly, microinjection of mRNA for mouse RALDH2 (mRALDH2), which is not targeted by the morpholino oligo, neutralized the effect of XRALDH2-MO and restored normal axial development (insets in Fig. 7G,J).
|
We next investigated the effects of downregulating XRDH10 and XRALDH2 on
anteroposterior patterning of the CNS (Fig.
8). At the advanced gastrula stage, unilaterally injected
XRDH10-MO reduced transcript levels and shifted the anterior boundary
of HoxD1 expression posteriorly
(Fig. 8B). The
XRALDH2-MO (Fig. 8C),
or a combination of XRDH10-MO and XRALDH2-MO
(Fig. 8D), caused a similar
effect. The specificity of this phenotype was underscored by the findings that
a control morpholino had no effect (Fig.
8A), and that co-injection of non-targeted
XRDH10* and mRALDH2 mRNAs with their respective
MOs restored normal HoxD1 expression
(Fig. 8E,F). In neurula
embryos, XRDH10-MO and XRALDH2-MO caused a slight posterior
distortion of the midbrain-hindbrain boundary (En2), a posterior
shift of hindbrain rhombomeres (HoxB3, xCRABP), but no significant
effect on HoxC6 expression in the spinal cord
(Fig. 8G-L; see also Fig. S3 in
the supplementary material). At the tail bud stage, XRDH10 and
XRALDH2 morphant embryos exhibited a posterior shift of rhombomeres 3
and 5 (Krox20) relative to the unaffected eye field (Rx2A;
Fig. 8M-R). Notably, the extent
of the rhombomeric shift induced by 2.6 pmol XRDH10-MO was similar to
that of an equimolar amount of XRALDH2-MO, and was not significantly
increased when both MOs were injected together
(Fig. 8S). Our results are
consistent with those obtained from other loss-of-function experiments, using
dominant-negative retinoid receptors (Kolm
et al., 1997; Blumberg,
1997; van der Wees et al.,
1998) and the RA hydroxylase CYP26A1
(Hollemann et al., 1998),
supporting a contribution of XRDH10 and XRALDH2 in positioning hindbrain
rhombomeres along the anteroposterior neuraxis in Xenopus.
To address whether XRDH10 is involved in vitamin A metabolism, we investigated the effects of downregulating the XRDH10 enzyme in the presence of exogenous retinol (Fig. 8T-W). To this end, we treated embryos with DMSO as a control or with 100 µM retinol. In advanced gastrula embryos, retinol led to an anterior expansion of HoxD1 expression (Fig. 8T,V). The retinol-mediated anterior expansion of HoxD1 expression was reverted by XRDH10-MO on the injected side (Fig. 8W), suggesting that the posteriorizing effect of retinol depends on XRDH10 activity. Together, the experiments demonstrate an involvement of XRDH10 in RA biosynthesis during axes formation and hindbrain patterning.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Timing and regulation of RDH10 gene activity in the early embryo
Xenopus RDH10 exhibits tissue-specific expression with common
expression domains to mouse RDH10; for example, in the lateral trunk
mesoderm, ventral neuroepithelium, at the midbrain-hindbrain boundary, and in
sensory organs (Fig. 2)
(Sandell et al., 2007;
Cammas et al., 2007;
Romand et al., 2008). However,
there are differences in the timing of induction and distribution of gene
transcripts in both species. The earliest expression of mouse RDH10
was reported in head-fold-stage embryos just prior to somitogenesis
(Sandell et al., 2007;
Cammas et al., 2007). We
detected abundant maternal XRDH10 gene products
(Fig. 2A-D), which may
contribute to the high levels of retinal observed in the egg and embryonic
yolk (Azuma et al., 1990;
Lampert et al., 2003), and
robust expression levels during gastrulation
(Fig. 2A,E,F,I,J), when the
embryo is most sensitive to RA exposure
(Durston et al., 1989;
Sive et al., 1990).
XRDH10 displayed distinct expression in the dorsal blastopore lip,
head process, telencephalon anlage and neural crest, which have no apparent
counterpart for mouse RDH10.
|
;
Chen et al., 2001;
Dobbs-McAuliffe et al., 2004)
and, conversely, RA upregulated CYP26A1 transcript levels in several
species (White et al., 1996;
Ray et al., 1997;
Hollemann et al., 1998;
White et al., 2007). Thus, the
targeting of the XRDH10 gene by RA adds to an intricate regulatory
network, in which RA suppresses anabolic (RA-synthesizing) and stimulates
catabolic (RA-degrading) enzymes (Fig.
3M). This fine-tuned feedback control provides protection against
exogenous retinoid fluctuations and allows the stabilization of local RA
distributions in the embryo.
RDH10 in the Spemann's organizer
We observed novel expression domains of XRDH10, most strikingly in
the dorsal blastopore lip (Fig.
2E,F). This group of cells, referred to as the Spemann's
organizer, plays a prominent role in the specification of the embryonic body
axes, and the induction and pattern formation of the developing CNS
(De Robertis and Kuroda,
2004). Interestingly, XRDH10 transcripts in the organizer
not only overlap with XRALDH2 but are complementary to
XCYP26A1 expression (Fig.
2E-H) (Hollemann et al.,
1998; Chen et al.,
2001). XRDH10 gene activity also coincides with active RA
signalling in this region (Chen et al.,
1994; Yelin et al.,
2005). Our gain- and loss-of-function studies suggest a novel role
for RA in positively regulating Chordin and negatively regulating
ADMP expression (Figs
4,
7). Chordin is a soluble BMP
antagonist and a key mediator of Spemann's organizer activity
(Sasai et al., 1994;
De Robertis and Kuroda, 2004).
The anti-dorsalizing morphogenetic protein (ADMP) secreted from the dorsal
gastrula organizer (Moos et al.,
1995) induces BMP/Smad1 signalling via the ALK2 receptor
(Reversade and De Robertis,
2005). Knockdown of XRDH10 and XRALDH2 cause small head and
enlarged ventroposterior structures (Fig.
7), a phenotype that is commonly seen upon elevated BMP/Smad1
activity (e.g. Pera et al.,
2003; Fuentealba et al.,
2007). The opposite transcriptional regulation of the secreted
proteins Chordin and ADMP by RA (this study) suggests a possible mechanism of
how XRDH10 and XRALDH2 could promote Spemann's organizer activity and dorsal
development.
|
; Wolpert,
1989; Kessel and Gruss,
1991; White et al.,
2007). Along the anteroposterior neuraxis, concentration-dependent
gradients of RA specify positional values via the activation of Hox genes in
the developing hindbrain (Gould et al.,
1998; Dupé and Lumsden,
2001) and spinal cord (Muhr et
al., 1999; Liu et al.,
2001). Previous models have suggested that these RA gradients
arise mainly as a result of local RA supply by RALDH2 in the paraxial trunk
mesoderm, diffusion of RA, and CYP26A1-mediated RA decay at the anterior and
posterior ends of the neural plate (Maden,
1999; Maden, 2002;
Sirbu et al., 2005;
Hernandez et al., 2007;
White et al., 2007). During
gastrulation of lower vertebrates, retinoid stores in the yolk translocate
from vegetal cells mainly to the endoderm
(Azuma et al., 1990;
Lampert et al., 2003).
However, RALDH2 activity in the dorsal blastopore lip and trunk mesoderm may
lead to a local shortage of retinal that could cause a collapse of the RA
gradient. Indeed, the phenotypes of XRDH10 morphants affecting
organizer-specific gene expression and hindbrain patterning (Figs
7,
8) provide strong evidence for
the need of ongoing retinol conversion to retinal in the developing
embryo.
|
),
reflecting the gradual RA distribution generated by RDH10 and RALDH2. In
conclusion, our data suggest that an initial RA gradient forms in the anterior
trunk mesoderm already at the step of RA synthesis.
The combinatorial gene expression of two enzymes that act back-to-back to
produce a signal, here referred to as a `biosynthetic enzyme code',
constitutes a novel mechanism for forming and stabilizing a morphogen
gradient. This mechanism may apply not only to the establishment of RA
gradients along the embryonic axis, but also to other areas where
RDH10 and RALDH2 overlap, such as in the dorsal blastopore
lip, the pronephros anlage, the eye field and the ear placode. In the mouse,
additional sites of overlapping RDH10 and RALDH2 expression
have been reported for the limb anlage and the foetal brain
(Niederreither et al., 1997;
Sandell et al., 2007;
Cammas et al., 2007;
Romand, 2008). Future studies
need to address the significance of an interaction between the two enzymes in
these morphogenetic fields. It is noteworthy that the mechanism of nested gene
expression and combinatorial action has initially been found in the homeotic
Hox genes, which are the most prominent targets of RA signalling in
vertebrates (Kessel and Gruss,
1991). This suggests a common principle for the generation and
downstream signalling events of this morphogen.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/3/461/DC1
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Abu-Abed, S., Dollé, P., Metzger, D., Beckett, B.,
Chambon, P. and Petkovich, M. (2001). The retinoic
acid-metabolizing enzyme, CYP26A1, is essential for normal hindbrain
patterning, vertebral identity, and development of posterior structures.
Genes Dev. 15,226
-240.
Azuma, M., Seki, T. and Fujishita, S. (1990).
Changes of egg retinoids during the development of Xenopus laevis.
Vision Res. 30,1395
-1400.[CrossRef][Medline]
Balkan, W., Colbert, M., Bock, C. and Linney, E.
(1992). Transgenic indicator mice for studying activated retinoic
acid receptors during development. Proc. Natl. Acad. Sci.
USA 89,3347
-3351.
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. and
Ingham, P. W. (2001). The zebrafish neckless mutation reveals
a requirement for raldh2 in mesodermal signals that pattern the hindbrain.
Development 128,3081
-3094.
Belyaeva, O. V., Johnson, M. P., Kedishvili, N. Y.
(2008). Kinetic analysis of human enzyme RDH10 defines the
characteristics of a physiologically relevant retinol dehydrogenase.
J. Biol. Chem. 283,20299
-20308.
Blumberg, B. (1997). An essential role for
retinoid signaling in anteroposterior neural specification and neuronal
differentiation. Semin. Cell Dev. Biol.
8, 417-428.[CrossRef][Medline]
Cammas, L., Romand, R., Fraulob, V., Mura, C. and Dollé,
P. (2007). Expression of the murine retinol dehydrogenase 10
(Rdh10) gene correlates with many sites of retinoid signalling during
embryogenesis and organ differentiation. Dev. Dyn.
236,2899
-2908.[CrossRef][Medline]
Chambers, D., Wilson, L., Maden, M. and Lumsden, A.
(2007). RALDH-independent generation of retinoic acid during
vertebrate embryogenesis by CYP1B1. Development
134,1369
-1383.
Chen, Y., Huang, L. and Solursh, M. (1994). A
concentration gradient of retinoids in the early Xenopus laevis embryo.
Dev. Biol. 161,70
-76.[CrossRef][Medline]
Chen, Y., Pollet, N., Niehrs, C. and Pieler, T.
(2001). Increased XRALDH2 activity has a posteriorizing effect on
the central nervous system of Xenopus embryos. Mech.
Dev. 101,91
-103.[CrossRef][Medline]
Cho, K. W. and De Robertis, E. M. (1990).
Differential activation of Xenopus homeo box genes by mesoderm-inducing growth
factors and retinoic acid. Genes Dev.
4,1910
-1916.
Cho, K. W., Blumberg, B., Steinbeisser, H. and De Robertis, E.
M. (1991). Molecular nature of Spemann's organizer: the role
of the Xenopus homeobox gene goosecoid. Cell
67,1111
-1120.[CrossRef][Medline]
Clagett-Dame, M. and DeLuca, H. F. (2002). The
role of vitamin A in mammalian reproduction and embryonic development.
Annu. Rev. Nutr. 22,347
-381.[CrossRef][Medline]
De Robertis, E. M. (2006). Spemann's organizer
and self-regulation in amphibian embryos. Nat. Rev. Mol. Cell
Biol. 7,296
-302.[CrossRef][Medline]
De Robertis, E. M. and Kuroda, H. (2004).
Dorsal-ventral patterning and neural induction in Xenopus embryos.
Annu. Rev. Cell Dev. Biol.
20,285
-308.[CrossRef][Medline]
De Robertis, E. M., Morita, E. A. and Cho, K. W.
(1991). Gradient fields and homeobox genes.
Development 112,669
-678.[Abstract]
de Roos, K., Sonneveld, E., Compaan, B., ten Berge, D., Durston,
A. J. and van der Saag, P. T. (1999). Expression of retinoic
acid 4-hydroxylase (CYP26) during mouse and Xenopus laevis embryogenesis.
Mech. Dev. 82,205
-211.[CrossRef][Medline]
Dibner, C., Elias, S., Ofir, R., Souopgui, J., Kolm, P. J.,
Sive, H., Pieler, T. and Frank, D. (2004). The Meis3 protein
and retinoid signaling interact to pattern the Xenopus hindbrain.
Dev. Biol. 271,75
-86.[CrossRef][Medline]
Dobbs-McAuliffe, B., Zhao, Q. and Linney, E.
(2004). Feedback mechanisms regulate retinoic acid production and
degradation in the zebrafish embryo. Mech. Dev.
121,339
-350.[CrossRef][Medline]
Duester, G. (2008). Retinoic acid synthesis and
signaling during early organogenesis. Cell
134,921
-931.[CrossRef][Medline]
Duester, G., Mic, F. A. and Molotkov, A.
(2003). Cytosolic retinoid dehydrogenases govern ubiquitous
metabolism of retinol to retinaldehyde followed by tissue-specific metabolism
to retinoic acid. Chem. Biol. Interact.
143-144,201
-210.
Dupé, V. and Lumsden, A. (2001).
Hindbrain patterning involves graded responses to retinoic acid signalling.
Development 128,2199
-208.
Durston, A. J., Timmermans, J. P., Hage, W. J., Hendriks, H. F.,
de Vries, N. J., Heideveld, M. and Nieuwkoop, P. D. (1989).
Retinoic acid causes an anteroposterior transformation in the developing
central nervous system. Nature
340,140
-144.[CrossRef][Medline]
Gould, A., Itasaki, N. and Krumlauf, R. (1998).
Initiation of rhombomeric Hoxb4 expression requires induction by somites and a
retinoid pathway. Neuron
21, 39-51.[CrossRef][Medline]
Grandel, H., Lun, K., Rauch, G. J., Rhinn, M., Piotrowski, T.,
Houart, C., Sordino, P., Küchler, A. M., Schulte-Merker, S., Geisler, R.,
Holder, N., Wilson, S. W. and Brand, M. (2002). Retinoic acid
signalling in the zebrafish embryo is necessary during pre-segmentation stages
to pattern the anterior-posterior axis of the CNS and to induce a pectoral fin
bud. Development 129,2851
-2865.[Medline]
Fuentealba, L. C., Eivers, E., Ikeda, A., Hurtado, C., Kuroda,
H., Pera, E. M. and De Robertis, E. M. (2007). Integrating
patterning signals: Wnt/GSK3 regulates the duration of the BMP/Smad1 signal.
Cell 131,980
-993.[CrossRef][Medline]
Hernandez, R. E., Putzke, A. P., Myers, J. P., Margaretha, L.
and Moens, C. B. (2007). Cyp26 enzymes generate the retinoic
acid response pattern necessary for hindbrain development.
Development 134,177
-187.
Hollemann, T., Chen, Y., Grunz, H. and Pieler, T.
(1998). Regionalized metabolic activity establishes boundaries of
retinoic acid signalling. EMBO J.
17,7361
-7372.[CrossRef][Medline]
Hou, S., Maccarana, M., Min, T. H., Strate, I. and Pera, E.
M. (2007). The secreted serine protease xHtrA1 stimulates
long-range FGF signaling in the early Xenopus embryo. Dev.
Cell 13,226
-241.[CrossRef][Medline]
Kessel, M. (1992). Respecification of vertebral
identities by retinoic acid. Development
115,487
-501.[Abstract]
Kessel, M. and Gruss, P. (1991). Homeotic
transformations of murine vertebrae and concomitant alteration of Hox codes
induced by retinoic acid. Cell
67, 89-104.[CrossRef][Medline]
Khokha, M. K., Yeh, J., Grammer, T. C. and Harland, R. M.
(2005). Depletion of three BMP antagonists from Spemann's
organizer leads to a catastrophic loss of dorsal structures. Dev.
Cell 8,401
-411.[CrossRef][Medline]
Kolm, P. J., Apekin, V. and Sive, H. (1997).
Xenopus hindbrain patterning requires retinoid signaling. Dev.
Biol. 192,1
-16.[CrossRef][Medline]
Kudoh, T., Wilson, S. W. and Dawid, I. B.
(2002). Distinct roles for Fgf, Wnt and retinoic acid in
posteriorizing the neural ectoderm. Development
129,4335
-4346.[Medline]
Lampert, J. M., Holzschuh, J., Hessel, S., Driever, W., Vogt, K.
and von Lintig, J. (2003). Provitamin A conversion to retinal
via the beta,beta-carotene-15,15'-oxygenase (bcox) is essential for
pattern formation and differentiation during zebrafish embryogenesis.
Development 130,2173
-2186.
Lidén, M. and Eriksson, U. (2006).
Understanding retinol metabolism: structure and function of retinol
dehydrogenases. J. Biol. Chem.
281,13001
-13004.
Liu, J. P., Laufer, E. and Jessell, T. M.
(2001). Assigning the positional identity of spinal motor
neurons: rostrocaudal patterning of Hox-c expression by FGFs, Gdf11, and
retinoids. Neuron 32,997
-1012.[CrossRef][Medline]
Maden, M. (1999). Heads or tails? Retinoic acid
will decide. BioEssays
21,809
-812.[CrossRef][Medline]
Maden, M. (2002). Retinoid signalling in the
development of the central nervous system. Nat. Rev.
Neurosci. 3,843
-853.[CrossRef][Medline]
Mark, M., Ghyselinck, N. B. and Chambon, P.
(2006). Function of retinoid nuclear receptors: lessons from
genetic and pharmacological dissections of the retinoic acid signaling pathway
during mouse embryogenesis. Annu. Rev. Pharmacol.
Toxicol. 46,451
-480.[CrossRef][Medline]
Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden,
A. and Krumlauf, R. (1992). Retinoic acid alters hindbrain
Hox code and induces transformation of rhombomeres 2/3 into a 4/5 identity.
Nature 360,737
-741.[CrossRef][Medline]
Mendelsohn, C., Ruberte, E., LeMeur, M., Morriss-Kay, G. and
Chambon, P. (1991). Developmental analysis of the retinoic
acid-inducible RAR-beta 2 promoter in transgenic animals.
Development 113,723
-734.[Abstract]
Moos, M., Jr, Wang, S. and Krinks, M. (1995).
Anti-dorsalizing morphogenetic protein is a novel TGF-beta homolog expressed
in the Spemann organizer. Development
121,4293
-4301.[Abstract]
Muhr, J., Graziano, E., Wilson, S., Jessell, T. M. and Edlund,
T. (1999). Convergent inductive signals specify midbrain,
hindbrain, and spinal cord identity in gastrula stage chick embryos.
Neuron 23,689
-702.[CrossRef][Medline]
Niederreither, K. and Dollé, P. (2008).
Retinoic acid in development: towards an integrated view. Nat. Rev.
Genet. 9,541
-553.[CrossRef][Medline]
Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P. and
Dolle, P. (1997). Restricted expression and retinoic
acid-induced downregulation of the retinaldehyde dehydrogenase type 2
(RALDH-2) gene during mouse development. Mech. Dev.
62, 67-78.[CrossRef][Medline]
Niederreither, K., Subbarayan, V., Dolle, P. and Chambon, P.
(1999). Embryonic retinoic acid synthesis is essential for early
mouse post-implantation development. Nat. Genet.
21,444
-448.[CrossRef][Medline]
Niehrs, C. (2004). Regionally specific
induction by the Spemann-Mangold organizer. Nat. Rev.
Genet. 5,425
-434.[Medline]
Nieuwkoop, P. (1952). Activation and
organization of the central nervous system in amphibians. III. Synthesis of a
new working hypothesis. J. Exp. Zool.
120,83
-108.[CrossRef]
Olivera-Martinez, I. and Storey, K. G. (2007).
Wnt signals provide a timing mechanism for the FGF-retinoid differentiation
switch during vertebrate body axis extension.
Development 134,2125
-2135.
Papalopulu, N., Clarke, J. D., Bradley, L., Wilkinson, D.,
Krumlauf, R. and Holder, N. (1991). Retinoic acid causes
abnormal development and segmental patterning of the anterior hindbrain in
Xenopus embryos. Development
113,1145
-1158.[Abstract]
Pera, E. M., Wessely, O., Li, S. Y. and De Robertis, E. M.
(2001). Neural and head induction by insulin-like growth factor
signals. Dev. Cell 1,655
-665.[CrossRef][Medline]
Pera, E. M., Ikeda, A., Eivers, E. and De Robertis, E. M.
(2003). Integration of IGF, FGF, and anti-BMP signals via Smad1
phosphorylation in neural induction. Genes Dev.
17,3023
-3028.
Pera, E. M., Hou, S., Strate, I., Wessely, O. and De Robertis,
E. M. (2005). Exploration of the extracellular space by a
large-scale secretion screen in the early Xenopus embryo. Int. J.
Dev. Biol. 49,781
-796.[CrossRef][Medline]
Persson, B., Kallberg, Y., Oppermann, U. and Jörnvall,
H. (2003). Coenzyme-based functional assignments of
short-chain dehydrogenases/reductases (SDRs). Chem. Biol.
Interact. 143-144,271
-278.
Ray, W. J., Bain, G., Yao, M. and Gottlieb, D. I.
(1997). CYP26, a novel mammalian cytochrome P450, is induced by
retinoic acid and defines a new family. J. Biol. Chem.
272,18702
-18708.
Reversade, B. and De Robertis, E. M. (2005).
Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a
self-regulating morphogenetic field. Cell
123,1147
-1160.[CrossRef][Medline]
Richard-Parpaillon, L., Héligon, C., Chesnel, F.,
Boujard, D. and Philpott, A. (2002). The IGF pathway
regulates head formation by inhibiting Wnt signaling in Xenopus.
Dev. Biol. 244,407
-417.[CrossRef][Medline]
Romand, R., Kondo, T., Cammas, L., Hashino, E. and Dollé,
P. (2008). Dynamic expression of the retinoic
acid-synthesizing enzyme retinol dehydrogenase 10 (rdh10) in the developing
mouse brain and sensory organs. J. Comp. Neurol.
508,879
-892.[CrossRef][Medline]
Ross, S. A., McCaffery, P. J., Drager, U. C. and De Luca, L.
M. (2000). Retinoids in embryonal development.
Physiol. Rev. 80,1021
-1054.
Rossant, J., Zirngibl, R., Cado, D., Shago, M. and Giguere,
V. (1991). Expression of a retinoic acid response
element-hsplacZ transgene defines specific domains of transcriptional activity
during mouse embryogenesis. Genes Dev.
5,1333
-1344.
Ruiz i Altaba, A. and Jessell, T. (1991).
Retinoic acid modifies mesodermal patterning in early Xenopus embryos.
Genes Dev. 5,175
-187.
Sandell, L. L., Sanderson, B. W., Moiseyev, G., Johnson, T.,
Mushegian, A., Young, K., Rey, J. P., Ma, J. X., Staehling-Hampton, K. and
Trainor, P. A. (2007). RDH10 is essential for synthesis of
embryonic retinoic acid and is required for limb, craniofacial, and organ
development. Genes Dev.
21,1113
-1124.
Sakai, Y., Meno, C., Fujii, H., Nishino, J., Shiratori, H.,
Saijoh,Y., Rossant, J. and Hamada, H. (2001). The retinoic
acid-inactivating enzyme CYP26 is essential for establishing an uneven
distribution of retinoic acid along the anterio-posterior axis within the
mouse embryo. Genes Dev.
15,213
-225.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K.
and De Robertis, E. M. (1994). Xenopus chordin: a novel
dorsalizing factor activated by organizer-specific homeobox genes.
Cell 79,779
-790.[CrossRef][Medline]
Schuh, T. J., Hall, B. L., Kraft, J. C., Privalsky, M. L. and
Kimelman, D. (1993). v-erbA and citral reduce the teratogenic
effects of all-trans retinoic acid and retinol, respectively, in Xenopus
embryogenesis. Development
119,785
-798.
Shiotsugu, J., Katsuyama, Y., Arima, K., Baxter, A., Koide, T.,
Song, J., Chandraratna, R. A. and Blumberg, B. (2004).
Multiple points of interaction between retinoic acid and FGF signaling during
embryonic axis formation. Development
131,2653
-2667.
Sirbu, I. O., Gresh, L., Barra, J. and Duester, G.
(2005). Shifting boundaries of retinoic acid activity control
hindbrain segmental gene expression. Development
132,2611
-2622.
Sive, H. L., Draper, B. W., Harland, R. M. and Weintraub, H.
(1990). Identification of a retinoic acid-sensitive period during
primary axis formation in Xenopus laevis. Genes Dev.
4, 932-942.
Swindell, E. C., Thaller, C., Sockanathan, S., Petkovich, M.,
Jessell, T. M. and Eichele, G. (1999). Complementary domains
of retinoic acid production and degradation in the early chick embryo.
Dev. Biol. 216,282
-296.[CrossRef][Medline]
Taira, M., Otani, H., Jamrich, M. and Dawid, I. B.
(1994). Expression of the LIM class homeobox gene Xlim-1 in
pronephros and CNS cell lineages of Xenopus embryos is affected by retinoic
acid and exogastrulation. Development
120,1525
-1536.[Abstract]
Thaller, C. and Eichele, G. (1987).
Identification and spatial distribution of retinoids in the developing chick
limb bud. Nature 327,625
-628.[CrossRef][Medline]
van der Wees, J., Schilthuis, J. G., Koster, C. H.,
Diesveld-Schipper, H., Folkers, G. E., van der Saag, P. T., Dawson, M. I.,
Shudo, K., van der Burg, B. and Durston, A. J. (1998).
Inhibition of retinoic acid receptor-mediated signalling alters positional
identity in the developing hindbrain. Development
125,545
-556.[Abstract]
Vermot, J. and Pourquié, O. (2005).
Retinoic acid coordinates somitogenesis and left-right patterning in
vertebrate embryos. Nature
435,215
-220.[CrossRef][Medline]
von Bubnoff, A., Schmidt, J. E. and Kimelman, D.
(1995). The Xenopus laevis homeobox gene Xgbx-2 is an early
marker of anteroposterior patterning in the ectoderm. Mech.
Dev. 54,149
-160.[CrossRef]
Ward, S. J., Chambon, P., Ong, D. E. and Båvik, C.
(1997). A retinol-binding protein receptor-mediated mechanism for
uptake of vitamin A to postimplantation rat embryos. Biol.
Reprod. 57,751
-755.[Abstract]
White, J. A., Guo, Y. D., Baetz, K., Beckett-Jones, B.,
Bonasoro, J., Hsu, K. E., Dilworth, F. J., Jones, G. and Petkovich, M.
(1996). Identification of the retinoic acid-inducible
all-trans-retinoic acid 4-hydroxylase. J. Biol. Chem.
271,29922
-29927.
White, R. J., Nie, Q., Lander, A. D. and Schilling, T. F.
(2007). Complex regulation of cyp26a1 creates a robust retinoic
acid gradient in the zebrafish embryo. PLoS Biol.
5, e304.[CrossRef][Medline]
Wolpert, L. (1989). Positional information
revisited. Development 107
Suppl., 3-12.
Wu, B. X., Chen, Y., Chen, Y., Fan, J., Rohrer, B., Crouch, R.
K. and Ma, J. X. (2002). Cloning and characterization of a
novel all-trans retinol short-chain dehydrogenase/reductase from the RPE.
Invest. Ophthalmol. Vis. Sci.
43,3365
-3372.
Wu, B. X., Moiseyev, G., Chen, Y., Rohrer, B., Crouch, R. K. and
Ma, J. X. (2004). Identification of RDH10, an all-trans
retinol dehydrogenase, in retinal Muller cells. Invest. Ophthalmol.
Vis. Sci. 45,3857
-3862.
Yelin, R., Schyr, R. B., Kot, H., Zins, S., Frumkin, A.,
Pillemer, G. and Fainsod, A. (2005). Ethanol exposure affects
gene expression in the embryonic organizer and reduces retinoic acid levels.
Dev. Biol. 279,193
-204.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
