|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 January 2009
doi: 10.1242/dev.029959
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Stazione Zoologica Anton Dohrn di Napoli, Villa Comunale, 80121 Napoli,
Italy.
2 Department de Genètica, Universitat de Barcelona, Avenida Diagonal,
645, 08028 Barcelona, Spain.
Author for correspondence (e-mail:
miarnone{at}szn.it)
Accepted 9 December 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Strongylocentrotus purpuratus, QPCR, Endomesoderm, Sea urchin larval development, Hindgut specification, GRN, Triple in situ hybridization
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Parrington et al.,
2007) to gastrulation (e.g.
Ettensohn, 1984;
Hardin, 1996) and cell
specification (e.g. pigment cells)
(Calestani et al., 2003). In
the recent era of molecular biology, the purple sea urchin
Strongylocentrotus purpuratus has come to the forefront as the model
urchin. S. purpuratus is the first non-chordate deuterostome to have
its genome sequenced (Sea Urchin
Sequencing Consortium, 2006), and is the taxon used in building of
one of the first and most fully resolved gene regulatory networks that
describes the genetic basis behind the separation of the germ layers from
fertilization through gastrulation
(Davidson et al., 2002).
One of these germ layers is the endoderm, which eventually gives rise to a
three-part gut consisting of an esophagus, stomach and hindgut or intestine.
Evidence of patterning is obvious in the dynamic expression of transcription
factors within the endodermal tube (GataE, Brn 1/2/4, Fox A, Blimp/KroxA, Cdx
and xLox, Hox11-13b) (Lee and Davidson,
2004; Yuh et al.,
2005; Olivieri et al., 2006; Livi et al., 2006;
Arnone et al., 2006;
Arenas-Mena et al., 2006), as
well as from some well-known endodermal marker genes (Endo1, Endo16, CyIIa)
(Wessel and McClay 1985;
Ransick et al., 1993;
Arnone et al., 1998). Although
the early specification of the gut results from the coordinated activity of
the endomesodermal regulatory network genes, little is known about the later
patterning events leading to the differentiation of three morphologically and
functionally distinct gut regions.
In vertebrates, regionalization of the gut has been shown to be under the
late control of homeobox genes, in particular the members of the so-called
ParaHox class. The genes are called gsx, xLox and cdx in
chordates, where the three have been identified
(Brooke et al., 1998). In
insects only orthologs of gsx (ind) and cdx
(caudal) are known (Weiss et al.,
1998; Mlodzik et al.,
1985), whereas an xLox homolog has been identified in
both annelids (Fröbius and Seaver,
2006; Kulakova et al.,
2008) and mollusks (Barucca et
al., 2006), as well as from the more basal nermertodermatida
(Jimenez-Guri et al., 2006).
Though ParaHox genes have been identified in several taxa, very little is
known about the functions of this group of genes during development with the
exception of the mouse homolog Pdx1, which plays an important role in
pancreas formation (for a review, see
Al-Quobaili and Montenarh,
2008).
SpLox, the purple urchin xLox homolog, is expressed in the mid-
and hindguts of gastrula stage embryos, and is restricted to the posterior
sphincter separating these two gut regions in the pluetus larva
(Arnone et al., 2006). This
expression pattern is conserved also in sea stars (R. Annunziata, unpublished)
(Hwang et al., 2003). Given
the relative simplicity of the sea urchin digestive system and the wealth of
data available concerning the gene regulatory network (GRN) specifying the
endodermal precursors, the purple urchin represents an optimal developmental
system with which to investigate the role of ParaHox genes in endodermal
partitioning to create a functional tripartite gut. Here, we describe our
detailed analysis of the expression and function of the sea urchin
SpLox gene and its genetic interaction with a second endodermally
expressed ParaHox gene, SpCdx.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Whole-mount in situ hybridization
Embryos and larvae were collected as needed and fixed for 2 hours to
overnight in 4% paraformaldehyde in filtered seawater, washed in Tris-buffered
saline (TBS) and stored in 70% ethanol until use. For detailed expression
analysis of the onset of SpLox and SpCdx expression, a
series of embryos was fixed every 2 hours between 48 and 72 hours post
fertilization (hpf). Labeled probes were transcribed from linearized DNA using
digoxygenin-11-UTP or fluorescein-12-UTP (Roche), or labeled with DNP (Mirus
Cat # MIR 3800) following kit instructions. In situ RNA probe sequences are as
previously published (SpCdx, SpLox)
(Arnone et al., 2006)
Endo16 (Ransick et al.,
1993). For single gene expression, the protocol outlined by
Minokawa et al. (Minokawa et al.,
2004) was followed. For multi-gene fluorescent in situ (up to
three genes contemporaneously), fixed embryos were washed in Tris-buffered
saline containing 0.1% Tween-20 (TBST), pre-hybridized for 1 hour at 65°C
in fresh hybridization buffer (50% formamide, 5x SSC, 0.1% Tween-20, 50
µg/ml heparin, and 50 µg/ml yeast tRNA) and incubated overnight at
65°C with antisense labeled probes. Embryos were washed in a descending
gradient of SSC (2x, 0.2x, 0.1x) at 65°C followed by
TBST washes at room temperature. Embryos were then blocked for 30 minutes in
fresh 0.5% Perkin Elmer Blocking Reagent (PEBR) in TBST, and incubated
overnight at 4°C with peroxidase conjugated antibodies (Roche: 1 µl in
100 µl of 0.5% PEBR in TBST). Antibodies were removed with washes in TBST,
and signal was developed with fluorophore-conjugated tyramide (1 µl/50
µl reagent dilutant: Perkin Elmer). Residual enzyme activity was inhibited
via a 20-minute incubation in 0.1% hydrogen peroxide, followed by TBST washes
prior to addition and development of the second and third antibody. Embryos
were imaged with a Zeiss Axio Imager.M1. Triple in situs were imaged with a
Zeiss 510Meta confocal microscope.
Morpholino antisense oligonucleotide (MASO) injections
We followed the method indicated by Oliveri et al.
(Oliveri et al., 2003). All
morpholino antisense oligonucleotides (MASOs) were used in a concentration of
150 µM. To assess the effect of morpholino injections, fertilized eggs were
injected with the injection solution (1% rhodamine dextran in 0.1 M KCl)
without morpholino oligonucleotides, or with one of the following control
morpholinos: GeneTools standard control oligonucleotide, SpLox mutated
morpholino sequence (mismatch control, see below), or a GCM specific
morpholino that blocks pigment formation
(Ransick and Davidson, 2006).
We see no phenotypic effect upon injection of control morpholinos, and
endoderm development is unaffected in the presence of GCM-MASO (see Fig. S1F
in the supplementary material). Two different SpLox specific MASOs
were used in combination with a mismatch control morpholino:
mLox1, AGTACcCGcGATTcTTCCcTTCgAT (mismatch control);
Lox1, AGTACGCGGGATTGTTCCCTTCCAT;
Lox2, AGGACATTGGATATTCAGACGCCAT.
The mismatch control morpholino produced no morphological phenotype (see Fig. S1I in the supplementary material), and was unable to block in vitro synthesis of SpLox protein (performed as described below under EMSA), which was completely inhibited by the Lox1 MASO (see Fig. S1J in supplementary material). No significant difference in phenotype was observed between Lox1 and Lox2 MASOs, and all data presented herein derives from the MASO directed against the 5' start codon (Lox1). After injection, fertilized eggs were washed with fresh filtered seawater (FSW) and incubated overnight. The following day, rhodamine-positive embryos were transferred to new plates and incubated at 15°C in fresh FSW.
Assay on digestive function
One-week-old larvae were cultured for 6 days in the presence of the micro
alga Isochrysis galbana (2106 cell/ml). At different time
points, larvae were selected and observed under a fluorescent microscope using
a FITC filter set. The presence of chlorophyll in this phytoplankton species
allows direct observation of the micro alga under fluorescent light, and
allows for differential detection between degraded and intact algal cells. To
assess levels of alkaline phosphatase in the guts of injected versus control
larvae, alkaline phosphatase staining was performed as detailed by Livingston
and Wilt (Livingston and Wilt,
1989).
Phalloidin and Endo1 immunostaining of embryos
Larvae were freshly fixed in 4% PFA in FSW for 2 hours at room temperature,
washed multiple times in phosphate-buffered saline with 0.1% Tween-20 (PBST),
and incubated overnight at 4°C with anti-Endo1 primary antibody
(Wessel and McClay, 1985),
diluted at working concentration (1:5) in 5% goat serum in PBST. Following
primary antibody incubation, larvae were washed three times with PBST, and
incubated for 1 hour at room temperature with the secondary antibody Alexa
Fluor 555 goat anti-mouse IgG (Molecular Probes) diluted 1/100 in 5% goat
serum in PBST. After removal of secondary antibodies, larvae were incubated in
1 µl phalloidin-488 in 100 µl PBST for 1 hour (Roche). Larvae were
washed in PBST and mounted for imaging with a confocal microscope (Zeiss
510Meta).
Quantitative PCR (qPCR)
Total RNA was collected from a minimum of 400 larvae per experimental trial
using a RNAeasy mini-kit (Qiagen) following the manufacturer's instructions.
cDNA was synthesized with Sprint PowerScript (Clontech). qPCR was performed
according to Rast et al. (Rast et al.,
2002), using an ABI prism 7000 sequence detection system and SYBR
green chemistry (PE Biosystems). For all qPCR experiments, the data from each
cDNA sample were normalized against ubiquitin mRNA levels, which are known to
remain relatively constant during embryogenesis
(Nemer et al., 1991). Details
of primer sets can be provided on request.
Electrophoretic mobility shift assay (EMSA)
Putative binding sites were identified by alignment of the Endo16
regulatory sequence (Yuh et al.,
1994) with the Pdx1-binding sequence A1 from the insulin
promoter (Liberzon et al.,
2004). Of the putative sites found, we chose to analyze the most
proximal one, which contains two core homeobox DNA-binding sites (site n. 28)
(Yuh et al., 1994). Mobility
shift assays were performed as previously described
(Martin et al., 2001). In
vitro translated SpLox protein was synthesized using the TNT coupled in vitro
transcription/translation system (Promega) from the cDNA clone p16I16ES under
the control of a T7 promoter. DNA-protein complexes were resolved by gel
electrophoresis and imaged on a Typhoon Trio (Amersham).
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). We have further characterized the detailed spatial
expression pattern from pre-gastrula through 72 hours by whole-mount in situ
hybridization, as illustrated in Fig.
1.
At the mesenchyme blastula stage (Fig.
1A), SpLox transcripts are not detectable, consistent
with the limited number of transcripts per embryo detected by quantitative PCR
(Arnone et al., 2006). The
first developmental stage at which the signal is clearly visible is the late
mid-gastrula, when the archenteron is more than three-quarters invaginated. At
this stage, expression is first seen within single cells at the edge of the
blastopore (Fig. 1B). The onset
of this expression pattern is consistently asymmetrical; however, within 2
hours, all cells surrounding the inner edge of the blastopore exhibit high
levels of expression (Fig. 1C).
The original asymmetric pattern of expression appears to be retained, with an
expanded signal localized in the aboral side as the archenteron elongates
(Fig. 1D,E). When gastrulation
is completed, the domain of SpLox-expressing cells encompasses the
entire posterior region of the developing gut
(Fig. 1F). As differentiation
of the tripartite gut continues, expression within the hindgut is reduced and
expression becomes restricted to the constriction between the mid- and hindgut
(Fig. 1G,H). This endodermal
pattern is stable, and persists at least into the pluteus stage, although at
lower levels (Fig. 1I).
SpLox-MASO injections disrupt gut morphology
To investigate the function of the SpLox gene in the embryo,
gene-specific morpholino antisense oligonucleotides (MASO) were injected into
fertilized eggs to silence the gene by blocking production of the protein, and
the phenotype of the resultant embryos and larvae was analyzed. Control
injected larvae show no phenotypic effects (see Fig. S1 in the supplementary
material). Injection of the SpLox-MASO results in alterations of endoderm
formation, as expected from the in situ expression pattern. The ectoderm
develops normally and the secondary mesenchyme derivatives are both
differentiated and properly distributed (e.g. the pigment cells are located
mainly in the aboral ectoderm). The formation of the vegetal plate and
invagination of the archenteron are not affected (data not shown) in
accordance with the in situ hybridization data, indicating that SpLox
is not expressed until mid-late gastrula in S. purpuratus. The first
and most apparent morphological difference between control
(Fig. 2C) and morpholino
(Fig. 2F) -injected embryos is
the delay in development of the constriction between the midgut and hindgut
(see also Fig. S1 in the supplementary material), corresponding to the late
expression domain of this gene. Embryos are not able to compensate for this
loss, as evidenced by the continued absence of a closed sphincter in stage I
(Smith et al., 2008) pluteus
larvae (compare Fig. 2A,B with
2D,E). The tripartite gut can
be clearly identified in control injected specimens (rhodamine dextran-KCl
injected; Fig. 2A,B): foregut,
midgut and hindgut are clearly defined by the presence of an anterior and
posterior sphincter separating the midgut from the foregut and hindgut,
respectively, whereas SpLox-MASO injected embryos have an anterior cardiac
sphincter (gray arrows in Fig.
2D,E) but show only a mild posterior constriction (white arrows).
We further investigated the lack of this posterior sphincter using
FITC-labeled phalloidin to visualize actin fibers, and analyzed the larvae
with a confocal microscope to ensure accurate interpretation of the staining
patterns. Control animals have a well-delineated border between the gut
compartments, including a muscular sphincter
(Fig. 2G-J). SpLox-MASO-treated
embryos lack this sphincter, possessing solely a mild posterior constriction
(Fig. 2K-N). In addition, the
entire mid and hindgut region exhibits staining of short processes within the
lumen (arrowheads in Fig. 2N)
that are not seen in control larvae (Fig.
2J). Surprisingly, we find that morpholino-injected embryos also
exhibit a reduction in the organization of the muscle fibers surrounding the
foregut. In order to investigate whether these effects are species specific,
we also tested the morphological effects of this morpholino in another
distantly related sea urchin species, Paracentrotus lividus. We find
that these morpholino-injected embryos also lack the posterior sphincter and
exhibit a disorganized foregut musculature (data not shown), suggesting a
conserved gene function within the echinoids.
|
),
as demonstrated by a reduction in phosphatase activity within the gut
(Fig. 3C,F).
Levels of endoderm marker genes are altered in the absence of SpLox function
To address the genetic mechanism by which SpLox exerts its effect,
we evaluated changes in the levels of transcription in morpholino-injected
larvae 72 and 96 hours post-fertilization using quantitative PCR. Transcript
levels were evaluated for some endoderm transcription factors from the
endomesoderm gene regulatory network (GRN), endodermally expressed ParaHox
genes, a number of transcription factors known to be involved in the
putatively homologous network derived from studies of the xLox homolog
(Pdx) in the vertebrate pancreas, as well as a number of terminal
differentiation genes (Fig. 4).
Only those genes whose transcript levels differ by a factor of ±1.8 are
considered to be significant (see bold text in
Fig. 4). Genes from the
endomesoderm GRN, which are expressed much earlier in development than
SpLox, show no significant changes in transcript levels, with the
exception of brachyury (brac), the expression of which increases by a
moderate twofold, in three out of five replicate experiments
(Fig. 4). By contrast,
significant changes in transcript levels were identified for both
SpLox itself, as well as for the other endodermally expressed ParaHox
gene SpCdx. SpLox transcript levels increase by 2-7 times over the
levels in control embryos at both time points, whereas SpCdx
transcript levels decrease 2-5 times at both time points when compared with
control embryos. Two genes identified as being part of the murine Pdx1
pathway, the islet factor 1 gene (Isl1)
(Kojima et al., 2002) and
myelin transcription factor 1 gene (Myt1)
(Gu et al., 2004), are the
only other transcription factors examined that demonstrate altered expression
in response to silencing the SpLox gene.
|
|
), showed little change in transcript prevalence. Also
consistent with the morphological phenotype, wherein there is a disruption of
the organization of the musculature associated with the gut (see
Fig. 2), a second mesodermal
differentiation marker, actin M (actM)
(Cox et al., 1986),
consistently decreased in expression (two- to fivefold decrease), as did a sea
urchin muscle-specific transcription factor (sum1, a MyoD-like gene)
(Beach et al., 1999).
SpLox represses Endo16 expression in the hindgut
Endo16 is an extremely well-studied endodermal marker gene,
encoding a calcium-binding protein
(Soltysik-Española et al.,
1994) that is initially expressed throughout the vegetal plate and
invaginating endoderm. However, at the end of gastrulation, its expression is
restricted to the midgut (Ransick et al.,
1993). The early domain of SpLox expression almost
completely overlaps with the posterior-most expression domain of
Endo16 (Fig. 5A,B).
Our qPCR data indicate that the transcript levels of Endo16 are
highly elevated in response to silencing SpLox. Thus, we investigated
whether this increase corresponds to a change in the Endo16
expression domain or simply an upregulation of the gene within the confines of
its normal expression area. Expression levels of Endo16 are
consistently elevated in injected embryos; Endo16 transcripts are
detectable by in situ hybridization in less than half the time it takes for
the in situ signal to develop in control embryos processed in parallel (data
not shown). Furthermore, we find that the domain of Endo16 expression
is expanded to encompass the entire mid- and hindgut territories
(Fig. 5E,F), whereas expression
of this gene in control larvae is confined to the midgut region
(Fig. 5C,D). This expansion of
the expression domain remains restricted to the endoderm; at no time is
ectopic expression of Endo16 outside of the gut observed. This
expression pattern is also retained in 1-week-old stage I pluteus larvae (data
not shown).
|
). Owing to the strong effect of the SpLox morpholino
injections on Endo16 expression, we investigated its cis-regulatory sequence
for possible SpLox-binding sites. We analyzed the proximal-most putative
binding sequence (Fig. 6A) by
competitive binding assay, using in vitro synthesized SpLox and
oligonucleotides containing this sequence. We find that SpLox specifically
binds this oligonucleotide (Fig.
6B, lane 1), as assessed by competition with increasing
concentrations of unlabeled oligonucleotide
(Fig. 6B, lanes 2,3). By
contrast, addition of unlabeled oligonucleotides containing a mutation within
the ATTA core binding sequence (Fig.
6A) does not interfere with the efficiency of in vitro binding
(Fig. 6B, lanes 4,5),
indicating the specificity of the binding to that site. Additionally, we show
that in vitro synthesized SpLox also binds with high efficiency to
oligonucleotides containing the Pdx1-binding site A1 from the insulin promoter
(Liberzon et al., 2004)
(Fig. 6B, lanes 6,7).
Posterior endodermal patterning results from interaction between ParaHox genes
One of the most intriguing results from the qPCR analysis is the decrease
in expression of a second ParaHox gene expressed in the gut: the caudal
homolog SpCdx. In order to address the interactions between these two
genes, we re-evaluated the expression pattern of the SpCdx gene at
the same level of detail as that of SpLox. SpCdx expression appears
slightly later than SpLox expression
(Fig. 7A,B), but similarly
appears as cells enter the blastopore near the end of gastrulation
(Fig. 7C,D). SpCdx
expression is retained throughout the developing hindgut region
(Fig. 7E,F), and persists at
high levels in the hindguts of 72-hour pluteus larvae
(Fig. 7G-I). To investigate the
extent of overlapping expression between these two genes, we performed
double-fluorescent in situ hybridization. We find that at the onset of
Cdx expression, the expression domains of these two genes largely
overlap (Fig. 8A-C). As
development progresses, SpLox progressively clears from the hindgut
region (Fig. 8D-F) so that the
fully developed larva retains SpCdx expression throughout the
hindgut, whereas SpLox is restricted to the posterior sphincter in a
non-overlapping domain of expression (Fig.
8G-I).
By contrast, SpLox-MASO injected larvae show a distinct absence of SpCdx expression within the hindgut (Fig. 8L), in accordance with the decrease in the transcripts of this gene indicated by qPCR. The absence of SpCdx expression suggests that SpLox is involved in SpCdx activation in the zone of overlapping expression. We also find that SpLox expression is no longer restricted to the posterior sphincter, as in control larvae, but rather maintained within the entire posterior-most region of the developing gut in the SpLox-MASO-injected animals (Fig. 8J,K). This result is consistent with the elevated SpLox transcript levels revealed by qPCR (see Fig. 4), and together illustrate that translation of SpLox is required for inhibiting further transcription of this gene within the region of the hindgut.
|
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Offield et al.,
1996). Thus, consistent with our data from echinoid echinoderms,
the boundary between expression domains of murine gastric and duodenal markers
appear shifted posteriorly. Pdx1 also acts as a potent repressor of posterior
gut enzymes, including those normally mediated by Cdx homologs
(Heller et al., 1998;
Wang et al., 2004). Taken
altogether, these data clearly indicate the importance of SpLox in
establishing the mid-hindgut boundary within the deuterostome lineage.
Hox genes are known for their coordinated control of patterning of body
regions, for example rhombomere patterning under the control of Hoxb genes
(Maconochie et al., 1997).
Little is known, however, about whether ParaHox genes also function in a
coordinated manner to establish boundaries between adjacent territories. Our
results reveal that the silencing of an anteriorly expressed ParaHox gene
(SpLox) leads to the loss of a posterior identity (hindgut),
accompanied by the downregulation of a second ParaHox gene (SpCdx)
that is normally expressed in the missing territory. These data suggest
coordination between these two ParaHox genes at a gene regulatory level. Here,
we present a proposal for a gene regulatory network involved in hindgut
specification (Fig. 9), derived
from the data described in this article.
|
|
), similar to the phenotype of SpLox morpholino embryos (see
Fig. 5). Unfortunately SpLox
was not analyzed in the Hox11-13b knockdown experiments, and, thus,
we cannot speculate whether or not this similar phenotype is due to abolition
of the SpLox protein.
|
). As our
data illustrate, the sea urchin provides a precise example of how a
developmental field (gut) is subdivided using homeobox genes and how these
subfields are subsequently refined by a negative-feedback loop at the gene
regulatory level.
Conclusions and perspectives
Our results are consistent with the view that gut morphogenesis in sea
urchins has different temporal components: an early specification process
(governed by the Wnt pathway)
(Wikramanayake et al., 2004)
and a late differentiation process in which genes of the ParaHox complex
(SpLox and SpCdx) are involved in regionally partitioning
the endoderm. The phenotypes generated through the use of gene specific MASOs
have shown us that SpLox is a key regulator in the formation of the
midgut-hindgut boundary, repressing regions of the midgut differentiation
program and activating the hindgut gene battery through a second ParaHox gene,
SpCdx.
SpLox endodermal expression conforms to the rule that
xLox homologs are endodermal markers, expressed in specific regions
within the gut and endodermal derivatives
(Wright et al., 1989;
Brooke et al., 1998;
Stoffers et al., 1999;
Fröbius and Seaver, 2006)
and supports the speculation that the SpLox orthologs are part of a
group of genes dedicated to generate diversity in the gut
(Brooke et al., 1998;
Fröbius and Seaver,
2006). Although no functional data are available from a
protostome, the nested expression pattern of the endodermal ParaHox genes in
annelids (Fröbius and Seaver,
2006; Kukalova et al., 2008) suggests a similar system of
regionalization. This would imply that ParaHox gut regionalization is shared
among all bilaterians, thus representing a pan-bilaterian character. Moreover,
our data indicate that at least portions of the gene regulatory network that
control pancreas development and maintenance in vertebrates were available for
cooption from the gene regulatory network used to partition the gut of the
common ancestor of the deuterostomes. It seems clear now that the ParaHox
group of genes regionalizes the endoderm along the anteroposterior axis. Thus,
given the apparent use of the same system in both deuterostomes and
protostomes, we assume that this arose early in evolution, most probably
coincidently with the origin of bilaterians.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/4/541/DC1
|
Footnotes |
|---|
* These authors contributed equally to this study 
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Al-Quobaili, F. and Montenarh, M. (2008).
Pancreatic duodenal homeobox factor-1 and diabetes mellitus type 2 (review).
Int. J. Mol. Med. 21,399
-404.[Medline]
Arenas-Mena, C., Cameron, R. A. and Davidson, E. H.
(2006). Hindgut specification and cell-adhesion functions of
Sphox11/13b in the endoderm of the sea urchin embryo. Dev.
Growth Differ. 48,463
-472.[CrossRef][Medline]
Arnone, M. I., Martin, E. L. and Davidson, E. H.
(1998). Cis-regulation downstream of cell type specification: a
single compact element controls the complex expression of the CyIIa
gene in sea urchin embryos. Development
125,1381
-1395.[Abstract]
Arnone, M. I., Rizzo, F., Annunciata, R., Cameron, R. A.,
Peterson, K. J. and Martinez, P. (2006). Genetic organization
and embryonic expression of the ParaHox genes in the sea urchin S.
purpuratus: insights into the relationship between clustering and
colinearity. Dev. Biol.
300, 63-73.[CrossRef][Medline]
Barucca, M., Biscotti, M. A., Olmo, E. and Canapa, A.
(2006). All the three ParaHox genes are present in
Nuttallochiton mirandus (Mollusca: polyplacophora): evolutionary
considerations. J. Exp. Zoolog. B Mol. Dev. Evol.
306,164
-167.[Medline]
Beach, R. L., Seo, P. and Venuti, J. M. (1999).
Expression of the sea urchin MyoD homologue, SUM1, is not restricted
to the myogenic lineage during embryogenesis. Mech.
Dev. 86,209
-212.[CrossRef][Medline]
Briggs, E. and Wessel, G. M. (2006). In the
beginning...animal fertilization and sea urchin development. Dev.
Biol. 300,15
-26.[CrossRef][Medline]
Brooke, N. M., Garcia-Fernandez, J. and Holland, P. W.
(1998). The ParaHox gene cluster is an evolutionary sister of the
Hox gene cluster. Nature
392,920
-922.[CrossRef][Medline]
Calestani, C., Rast, J. P. and Davidson, E. H.
(2003). Isolation of pigment cell specific genes in the sea
urchin embryo by differential macroarray screening.
Development 130,4587
-4596.
Cox, K. H., Angerer, L. M., Lee, J. J., Davidson, E. H. and
Angerer, R. C. (1986). Cell lineage-specific programs of
expression of multiple actin genes during sea urchin embryogenesis.
J. Mol. Biol. 188,159
-172.[CrossRef][Medline]
Davidson, E. H., Rast, J. P., Oliveri, P., Ransick, A.,
Calestani, C., Yuh, C. H., Minokawa, T., Amore, G., Hinman, V., Arenas-Mena,
C. et al. (2002). A provisional regulatory gene network for
specification of endomesoderm in the sea urchin embryo. Dev.
Biol. 246,162
-190.[CrossRef][Medline]
Ettensohn, C. A. (1984). Primary invagination
of the vegetal plate during sea urchin gastrulation. Amer.
Zool. 24,571
-588.
Fröbius, A. C. and Seaver, E. C. (2006).
ParaHox gene expression in the polychaete annelid Capitella sp. I.
Dev. Genes Evol. 216,81
-88.[CrossRef][Medline]
Gu, G., Wells, J. M., Dombkowski, D., Preffer, F., Aronow, B.
and Melton, D. A. (2004). Global expression analysis of gene
regulatory pathways during endocrine pancreatic development.
Development 131,165
-179.
Hardin, J. (1996). The cellular basis of sea
urchin gastrulation. Curr. Top. Dev. Biol.
33,159
-262.[Medline]
Heller, R. S., Stoffers, D. A., Hussain, M. A., Miller, C. P.
and Habener, J. F. (1998). Misexpression of the pancreatic
homeodomain protein IDX-1 by the Hoxa-4 promoter associated with
agenesis of the cecum. Gastroenterology
115,381
-387.[CrossRef][Medline]
Hwang, S. P., Wu, J. Y., Chen, C. A., Hui, C. F. and Chen, C.
P. (2003). Novel pattern of AtXlox gene expression
in starfish Archaster typicus embryos. Dev. Growth
Differ. 45,85
-93.[CrossRef][Medline]
Jimenez-Guri, E., Paps, J., Garcia-Fernandez, J. and Salo,
E. (2006). Hox and ParaHox genes in Nemertodermatida, a basal
bilaterian clade. Int. J. Dev. Biol.
50,675
-679.[CrossRef][Medline]
Jonsson, J., Carlsson, L., Edlund, T. and Edlund, H.
(1994). Insulin-promoter-factor 1 is required for pancreas
development in mice. Nature
371,606
-609.[CrossRef][Medline]
Kojima, H., Nakamura, T., Fujita, Y., Kishi, A., Fujimiya, M.,
Yamada, S., Kudo, M., Nishio, Y., Maegawa, H., Haneda, M. et al.
(2002). Combined expression of pancreatic duodenal homeobox 1 and
islet factor 1 induces immature enterocytes to produce insulin.
Diabetes 51,1398
-1408.
Kulakova, M. A., Cook, C. E. and Andreeva, T. F.
(2008). ParaHox gene expression in larval and postlarval
development of the polychaete Nereis virens (Annelida,
Lophotrochozoa). BMC Dev. Biol.
8, 61.[CrossRef][Medline]
Lee, P. Y. and Davidson, E. H. (2004).
Expression of Spgatae, the Strongylocentrotus purpuratus
ortholog of vertebrate GATA4/5/6 factors. Gene Expr.
Patterns 5,161
-165.[CrossRef][Medline]
Liberzon, A., Ridner, G. and Walker, M. D.
(2004). Role of intrinsic DNA binding specificity in defining
target genes of the mammalian transcription factor PDX1.
Nucleic Acids Res. 32,54
-64.
Livi, C. B. and Davidson, E. H. (2006).
Expression and function of blimp1/krox, an alternatively transcribed
regulatory gene of the sea urchin endomesoderm network. Dev.
Biol. 293,513
-525.[CrossRef][Medline]
Livingston, B. T. and Wilt, F. H. (1989).
Lithium evokes expression of vegetal-specific molecules in the animal
blastomeres of sea urchin embryos. Proc. Natl. Acad. Sci.
USA 86,3669
-3673.
Maconochie, M. K., Nonchev, S., Studer, M., Chan, S. K.,
Pöpperl, H., Sham, M. H., Mann, R. S. and Krumlauf, R.
(1997). Cross-regulation in the mouse HoxB complex: the
expression of Hoxb2 in rhombomere 4 is regulated by Hoxb1.
Genes Dev. 11,1885
-1895.
Martin, E. L., Consales, C., Davidson, E. H. and Arnone, M.
I. (2001). Evidence for a mesodermal embryonic regulator of
the sea urchin CyIIa gene. Dev. Biol.
236, 46-63.[CrossRef][Medline]
Minokawa, T., Rast, J. P., Arenas-Mena, C., Franco, C. B. and
Davidson, E. H. (2004). Expression patterns of four different
regulatory genes that function during sea urchin development. Gene
Expr. Patterns 4,449
-456.[CrossRef][Medline]
Mlodzik, M., Fjose, A. and Gehring, W. J.
(1985). Isolation of caudal, a Drosophila homeo
box-containing gene with maternal expression, whose transcripts form a
concentration gradient at the pre-blastoderm stage. EMBO
J. 4,2961
-2969.[Medline]
Nemer, M., Rondinelli, E., Infante, D. and Infante, A. A.
(1991). Polyubiquitin RNA characteristics and conditional
induction in sea urchin embryos. Dev. Biol.
145,255
-265.[CrossRef][Medline]
Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein,
R. W., Magnuson, M. A., Hogan, B. L. and Wright, C. V.
(1996). PDX-1 is required for pancreatic outgrowth and
differentiation of the rostral duodenum. Development
122,983
-995.[Abstract]
Oliveri, P., Davidson, E. H. and McClay, D. R.
(2003). Activation of pmar1 controls specification of
micromeres in the sea urchin embryo. Dev. Biol.
258, 32-43.[CrossRef][Medline]
Oliveri, P., Walton, K. D., Davidson, E. H. and McClay, D.
R. (2006). Repression of mesodermal fate by foxa, a
key endoderm regulator of the sea urchin embryo.
Development 133,4173
-4181.
Parrington, J., Davis, L. C., Galione, A. and Wessel, G.
(2007). Flipping the switch: how a sperm activates the egg at
fertilization. Dev. Dyn.
236,2027
-2038.[CrossRef][Medline]
Ransick, A. and Davidson, E. H. (2006).
cis-regulatory processing of Notch signaling input to the sea urchin glial
cells missing gene during mesoderm specification. Dev.
Biol. 297,587
-602.[CrossRef][Medline]
Ransick, A., Ernst, S., Britten, R. J. and Davidson, E. H.
(1993). Whole mount in situ hybridization shows Endo 16 to be a
marker for the vegetal plate territory in sea urchin embryos. Mech.
Dev. 42,117
-124.[CrossRef][Medline]
Rast, J. P., Amore, G., Calestani, C., Livi, C. B., Ransick, A.
and Davidson, E. H. (2000). Recovery of developmentally
defined gene sets from high-density cDNA macroarrays. Dev.
Biol. 228,270
-286.[CrossRef][Medline]
Rast, J. P., Cameron, R. A., Poustka, A. J. and Davidson, E.
H. (2002). brachyury target genes in the early sea
urchin embryo isolated by differential macroarray screening. Dev.
Biol. 246,191
-208.[CrossRef][Medline]
Sea Urchin Sequencing Consortium: Sodergren, E., Weinstock, G.
M., Davidson, E. H., Cameron, R. A., Gibbs, R. A., Angerer, R. C., Angerer, L.
M., Arnone, M. I., Burgess, D. R. et al. (2006). The genome
of the sea urchin Strongylocentrotus purpuratus.
Science 314,941
-952.
Smith, M. M., Cruz Smith, L., Cameron, R. A. and Urry, L. A.
(2008). The larval stages of the sea urchin,
Strongylocentrotus purpuratus. J. Morphol.
269,713
-733.[CrossRef][Medline]
Soltysik-Espanola, M., Klinzing, D. C., Pfarr, K., Burke, R. D.
and Ernst, S. G. (1994). Endo16, a large multidomain protein
found on the surface and ECM of endodermal cells during sea urchin
gastrulation, binds calcium. Dev. Biol.
165, 73-85.[CrossRef][Medline]
Stoffers, D. A., Heller, R. S., Miller, C. P. and Habener, J.
F. (1999). Developmental expression of the homeodomain
protein IDX-1 in mice transgenic for an IDX-1 promoter/lacZ
transcriptional reporter. Endocrinology
140,5374
-5381.
Wang, Z., Fang, R., Olds, L. C. and Sibley, E.
(2004). Transcriptional regulation of the lactase-phlorizin
hydrolase promoter by PDX-1. Am J. Physiol. Gastrointest.
Liver Physiol. 287,G555
-G561.
Weiss, J. B., Von Ohlen, T., Mellerick, D. M., Dressler, G.,
Doe, C. Q. and Scott, M. P. (1998). Dorsoventral patterning
in the Drosophila central nervous system: the intermediate
neuroblasts defective homeobox gene specifies intermediate column identity.
Genes Dev. 12,3591
-3602.
Wessel, G. M. and McClay, D. R. (1985).
Sequential expression of germ-layer specific molecules in the sea urchin
embryo. Dev. Biol. 111,451
-463.[CrossRef][Medline]
Wikramanayake, A. H., Peterson, R., Chen, J., Huang, L., Bince,
J. M., McClay, D. R. and Klein, W. H. (2004). Nuclear
beta-catenin-dependent Wnt8 signaling in vegetal cells of the early sea urchin
embryo regulates gastrulation and differentiation of endoderm and mesodermal
cell lineages. Genesis
39,194
-205.[CrossRef][Medline]
Wright, C. V., Schnegelsberg, P. and De Robertis, E. M.
(1989). XlHbox 8, a novel Xenopus homeo
protein restricted to a narrow band of endoderm.
Development 105,787
-794.
Wu, L. H. and Lengyel, J. A. (1998). Role of
caudal in hindgut specification and gastrulation suggests homology between
Drosophila amnioproctodeal invagination and vertebrate blastopore.
Development 125,2433
-2442.[Abstract]
Yuh, C. H., Ransick, A., Martinez, P., Britten, R. J. and
Davidson, E. H. (1994). Complexity and organization of
DNA-protein interactions in the 5'-regulatory region of an
endoderm-specific marker gene in the sea urchin embryo. Mech.
Dev. 47,165
-186.[CrossRef][Medline]
Yuh, C. H., Bolouri, H. and Davidson, E. H.
(1998). Genomic cis-regulatory logic: experimental and
computational analysis of a sea urchin gene. Science
279,1896
-1902.
Yuh, C. H., Dorman, E. R. and Davidson, E. H.
(2005). Brn1/2/4, the predicted midgut regulator of the
endo16 gene of the sea urchin embryo. Dev Biol.
281,286
-298.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ct ; thus, fold
differences greater than ±1.8 (gray) are considered significantly
different and are in bold. Genes of the endomesodermal GRN are presented
first, followed by the two ParaHox genes, genes that were chosen because of
their role in the pancreatic GRN in vertebrates, downstream structural genes
from the echinoderm endomesodermal GRN and, finally, two genes involved in
muscle development. We find no differences in expression of endomesodermal GRN
genes, assumed to be upstream from SpLox, whereas two transcription
factors from the vertebrate pancreas network show altered levels of expression
(isl and myt), as do the endodermal structural genes
(Endo16 and ap) and those involved in muscle formation
(actM and sum1).
