|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 23, 2009
doi: 10.1242/10.1242/dev.027748
1 Gene Expression Laboratory, The Salk Institute for Biological Studies, 10010
N. Torrey Pines Road, La Jolla, CA 92037, USA.
2 Stem Cell Institute, University of Minnesota, 2001 6th SE, Minneapolis, MN.
55455, USA.
3 Department of Genetics, Cell Biology and Development, 6-160 Jackson Hall, 321
Church St. SE, Minneapolis, MN 55455, USA.
4 Developmental Biology Center, University of Minnesota, 321 Church St. SE,
Minneapolis, MN 55455, USA.
5 Division of Integrative Cell Biology, Institute of Molecular Embryology and
Genetics, Global COE `Cell Fate Regulation Research and Education Unit',
Kumamoto University, Kumamoto, Japan 860-0811.
6 Department of Neuroscience, University of Minnesota, 321 Church St. SE,
Minneapolis, MN 55455, USA.
7 Center of Regenerative Medicine in Barcelona, Doctor Aiguader, 88, 08003
Barcelona, Spain.
8 Laboratory of Genetics and Development, Institut de Recherches Cliniques de
Montréal (IRCM), Université de Montréal, 110 avenue des
Pins Ouest, H2W 1R7, Montréal, Quebec, Canada.
9 Department of Neurobiology, University of Pittsburgh, Pittsburgh, PA 15261,
USA.
* Author for correspondence (e-mail: belmonte{at}salk.edu)
Accepted 8 December 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Sall, Townes-Brocks syndrome, Hox, Limb development, Shh, Eph, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Niswander, 2003;
Tabin and Wolpert, 2007).
Numerous studies have identified several secreted cell-cell signaling
molecules, such as members of the Wnt, fibroblast growth factor
(Fgf) and hedgehog gene families, responsible for a variety of
processes during limb development. For example, embryonic and genetic studies
have demonstrated the role of the Wnt family in the initiation of
limb development (Kawakami et al.,
2001), the role of Fgf genes as an instructive factor for
proximal-distal patterning (Mariani et
al., 2008), and the role of sonic hedgehog (Shh) in
anterior-posterior patterning (Riddle et
al., 1993).
These signaling pathways cooperate with one another to sustain limb
outgrowth. For instance, Shh, produced in the zone of the polarizing activity
(ZPA), regulates gremlin 1 (Grem1) expression in the posterior
mesenchyme (Capdevila et al.,
1999; Panman et al.,
2006). Grem1-mediated BMP antagonism is crucial for maintenance of
the expression of Fgfs in the apical ectodermal ridge (AER)
(Khokha et al., 2003;
Michos et al., 2004). FGF
proteins, secreted from the AER, act on underlying mesenchyme to promote cell
survival (Dudley et al.,
2002), and in the posterior mesenchyme to maintain Shh
expression (Laufer et al.,
1994). Such a feedback loop mediates distal outgrowth, and, thus,
proper formation of the autopod (Scherz et
al., 2004). Shh-mediated counteraction of the Gli3 repressor also
regulates the anterior-posterior patterning of digits
(Litingtung et al., 2002;
te Welscher et al., 2002).
Although numerous studies have focused on the role of such signaling pathways
and their interactions, the specific mechanisms that regulate region-specific
morphogenesis, which leads to a stereotyped morphology of each limb skeletal
element, remain elusive.
Human syndromes provide an opportunity to identify novel genes involved in
limb development and have indeed given us invaluable clues in understanding
the molecular and genetic bases of limb development
(Wilkie, 2003). One such gene
identified from human diseases is the SALL1 gene, one of the four
SALL genes in humans and mice, which are related to the Drosophila
spalt gene. SALL1 encodes a multi-zinc finger domain
transcription factor (Nishinakamura and
Osafune, 2006; Sweetman and
Munsterberg, 2006), and mutations in the SALL1 gene cause
Townes-Brocks syndrome (TBS) (Kohlhase et
al., 1998). Individuals with TBS exhibit multiple defects,
including limb alterations. The human TBS disorders are mainly due to a
dominant-negative action of the truncated SALL1 protein, though milder
phenotypes have been reported from haploinsufficiency of SALL1
(Borozdin et al., 2006;
Kohlhase, 2000). In mice, no
limb defects are reported in Sall1 knockout or heterozygous mice
(Nishinakamura et al., 2001).
Conversely, two mouse models producing truncated Sall1 protein have shown some
TBS-like phenotypes in the limb (Kiefer et
al., 2003; Kiefer et al.,
2008). These reports, together with a biochemical analysis
demonstrating that truncated Sall1 protein can form complexes with all Sall
proteins (Kiefer et al.,
2003), suggest that the truncated Sall1 protein inhibits other
Sall family proteins, leading to the TBS phenotypes. However, no limb
phenotype has been reported to date in mice lacking other Sall genes by
conventional knockout approaches. Sall2 is dispensable for embryonic
development (Sato et al.,
2003). Sall3-null mice exhibit a cleft palate, but no
limb defects are observed (Parrish et al.,
2004). Sall4 mutants die at the peri-implantation stage,
making it difficult to evaluate its role in organogenesis
(Elling et al., 2006;
Sakaki-Yumoto et al., 2006;
Warren et al., 2007).
Interestingly, a genetic interaction between Sall1 and Sall4
is needed for the proper development of several organs
(Sakaki-Yumoto et al., 2006),
suggesting functional redundancy between Sall genes.
Recent reports suggest a functional interaction between Sall and Hox genes
during development in invertebrates. For example, spalt, the
invertebrate homolog of Sall, acts in combination with Hox genes in
Drosophila embryos to specify segmental identities
(Copf et al., 2006). During
wing/haltere development, spalt is regulated by a Hox gene,
Ubx (Galant et al.,
2002). In C. elegans, a spalt homolog,
sem-4, directly regulates the expression of Hox genes, elg-5
and lin-39, in touch receptor specification and vulval development,
respectively (Grant et al.,
2000; Toker et al.,
2003). In the crustacean Artemia, spalt represses a Hox
gene during the morphogenesis of trunk segments
(Copf et al., 2006).
Therefore, functional interactions between spalt and Hox genes have
important roles in many aspects of invertebrate development.
In vertebrates, Hox proteins are crucial for limb development (reviewed by
Zakany and Duboule, 2007). Hox
genes encode transcription factors and in the mammalian genome the 39 genes
are organized as 13 paralogs into four clusters (Hoxa, Hoxb, Hoxc and
Hoxd) (Pearson et al.,
2005), of which Hoxa and Hoxd are crucial for
proper limb development (Kmita et al.,
2005). Hoxa and Hoxd genes, which are located at
the 5' extremity of their respective clusters (so called 5' Hox
genes) are necessary for proper development of digits
(Zakany et al., 1997). Human
mutations have also highlighted the importance of HOX genes in human limb
development. Hand-foot-genital syndrome is caused by mutations in the
HOXA13 gene, and synpolydactyly type II is caused by mutations in the
HOXD13 gene (Goodman,
2002; Lappin et al.,
2006). In gene targeting experiments, Hoxa13 and
Hoxd13 mutant mice each exhibit distinct phenotypes affecting autopod
development (Fromental-Ramain et al.,
1996). Mice with compound mutations in the Hoxa13 and
Hoxd13 genes exhibit complex and more severe phenotypes, suggesting
distinct and redundant functions of these two crucial Hox13
paralogous genes. Furthermore, misexpression experiments in chick and mouse
embryos have demonstrated that Hoxa13 and Hoxd13 regulate
region-specific morphogenesis of cartilage elements in the autopod
(Goff and Tabin, 1997;
Williams et al., 2006;
Yokouchi et al., 1995).
Despite all of these advances, our understanding of how Hox genes specifically
control region-specific morphogenesis in the limb is still unclear.
Based on the human TBS limb phenotypes and on the lack of limb defects in mice with individual Sall knockouts, we speculated that during limb development, Sall genes might have redundant activities that can only be identified by the study of compound mutants. We have analyzed Sall1;Sall3 allelic series, and demonstrate that Sall1 and Sall3 have partially redundant activity. Our analyses suggest that Sall genes are involved in the Shh signaling, as well as in Shh-independent processes. We further show evidence that Sall and Hox activities are mutually antagonistic in the autopod, and that this antagonism may contribute to a fine-tuning of local Hox activity that leads to proper morphogenesis of each cartilage element of the vertebrate autopod.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Parrish et al., 2004). As
Sall1/Sall3 double heterozygous mice were almost infertile when
assessed by natural mating; all of the progeny were obtained by in vitro
fertilization, which lead to the efficient production of compound mutant
embryos. Hoxa13 and Hoxd13 mutants have been described
previously (Fromental-Ramain et al.,
1996; Kmita et al.,
2000). Shh mutants
(Chiang et al., 1996),
Gli3 mutants (Buscher et al.,
1998) and Tbx5 mutants
(Bruneau et al., 2001) have
been previously described. Skeletal samples were examined as described
(McLeod, 1980).
In situ hybridization
Whole-mount in situ hybridization was performed following a standard
protocol (Wilkinson,
1993).
Electrophoretic mobility shift assay (EMSA)
HA-Sall1, Flag-Hoxa13 and Flag-Hoxd13 were cloned into
pcDNA3.1 (Invitrogen, Carlsbad, CA) and translated in vitro by using the TNT
T7 system (Promega, Madison, WI.) according the manufacturers' instruction.
The double-strand probes corresponding to -2028 to -2001 (transcription
starting site as 1 with the NM_007936 as cDNA sequence) of the mouse
Epha4 gene contains the following sequences: wt probe,
CGCGGTTATTTTTAATAATTTATGCACA; mutant 1, CGCGGTTATTTTTAATcATTgATGCACA; mutant
2, CGCGGggcgTTTTAATAATTTATGCACA; mutant 3, CGCGGggcgTTccgATcAcTgATGCACA.
(Lower case letters indicate mutations.)
EMSA was performed following a standard protocol
(Yoh and Privalsky, 2001).
Anti-HA (Covance, 16B12, Emeryville, CA) and anti-Flag (Sigma, M2, St Louis,
MO) antibodies were used.
Luciferase reporter assay
A mouse Epha4 upstream region (-2110 to -1980) that contains the
sequence analyzed in the EMSA assay was subcloned into pGL3 (Promega) with the
thymidine kinase promoter (TK). pRL-TK (Promega) was used as an internal
control. NIH3T3 cells were transfected with the Epha4-TK-Luciferase, pRL-TK
and various combinations of expression plasmids carrying Sall1,
Hoxa13 or Hoxd13 by using Fugene6 (Roche, Indianapolis, IN),
according to the manufacturer's instructions. Forty-eight hours after
transfection, cells were subjected to analysis using the Dual-Luciferase
Reporter Assay System (Promega). Results were expressed as fold increase
compared with samples with an empty vector. Experiments were performed in
triplicate, and statistical significance is analyzed by ANOVA followed by
Tukey's comparison.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). The
fact that no limb defects are reported in mice lacking Sall1, Sall2,
Sall3 or Sall4 suggested a functional redundancy between Sall
genes (Nishinakamura et al.,
2001; Parrish et al.,
2004; Sato et al.,
2003). Among those Sall genes expressed in limb buds
(Buck et al., 2001;
Kohlhase et al., 2002;
Ott et al., 2001), we focused
on Sall1 and Sall3 double mutants, as early lethality of
Sall4-/- embryos prevented the analysis of limb
development in absence of Sall4 function. To gain insights into the respective contribution of Sall1 and Sall3 genes, we generated Sall1/Sall3 allelic series and analyzed skeletons at E15.5. We did not obtain Sall1-/-;Sall3-/- embryos at older stages, probably because loss of both Sall1 and Sall3 leads to lethality. The reason for the lethality is unknown at this point; however, E15.5 skeletons provided us with information to investigate the requirement of Sall1 and Sall3 during mouse limb development. Although the stylopod and zeugopod of all Sall1;Sall3 mutants appear normal, we observed defects in the autopod both in the forelimb and hindlimb at E15.5 (Fig. 1; data not shown). We observed a fusion or lack of carpal elements, as well as fusion of metacarpal elements. Sall1-/-;Sall3+/+ mutants show a mild fusion phenotype between metacarpal elements for digit4 and digit5 at a very proximal region (Fig. 1E). Sall1-/-;Sall3+/- mutants exhibit a more severe phenotype, as shown by the gross fusion in the metacarpal elements for digit2 and digit3, and those for digit4 and digit5, in addition to a loss of digit1 (Fig. 1F). Finally, Sall1-/-;Sall3-/- mutants exhibit further small carpal elements, more severe metacarpal fusion and a loss of digit1, and loss or fusion of digit2 and digit3 (Fig. 1G). Conversely, in the Sall1+/-;Sall3+/- and Sall1+/-;Sall3-/- mutants, we did not observe these defects (Fig. 1B,D), indicating that a single allele of the Sall1 gene is sufficient for proper limb development.
|
Expression of Sall1 and Sall3 is regulated by the Shh-Gli3 pathway in the developing limb
The Sall1-/-;Sall3-/- mutant limb exhibited
defects in the autopod. Progression of limb development and formation of the
autopod requires Shh-mediated counteraction of Gli3
(Litingtung et al., 2002;
te Welscher et al., 2002).
Previous experiments in chicks suggested that Sall1 might be involved
in distal limb patterning and that this putative function involves Shh
signaling (Capdevila et al.,
1999; Farrell and Munsterberg,
2000). Furthermore, it has been recently shown that reduced
Shh signaling preferentially affects the formation of digit3
(Scherz et al., 2007;
Zhu et al., 2008). In our
study, we also observed that Sall1;Sall3 inactivation predominantly
disrupted the formation of digit3 (Fig.
1), consistent with the possibility that the function of
Sall1 and Sall3 is linked to Shh signaling. As several
factors involved in the Shh pathway are regulated by Shh signaling itself
(Zuniga et al., 1999), we
first analyzed whether Sall1 and Sall3 expression is
regulated by Shh and Gli3. The endogenous expression of Sall1 and
Sall3 at E10.5 is restricted to the distal mesenchyme and is
posteriorly biased (Fig. 2A,D).
In the Shh-/- limb, both genes are severely downregulated
(Fig. 2B,E), indicating that
Shh signaling is required for expression of Sall1 and Sall3.
By contrast, expression of both genes is expanded towards the anterior in the
Gli3-/- limb (Fig.
2C,F), indicating that Gli3 signaling negatively regulates
expression of Sall1 and Sall3. These results suggest that
the Shh-Gli3 pathway impacts upon Sall1 and Sall3 expression
at early stages of limb development.
Reduced Shh signaling in the Sall1;Sall3 mutant limb
To further examine whether Sall activity is involved in Shh signaling, we
monitored the expression of several key genes downstream of Shh that
are required for normal limb outgrowth. Although Shh expression in
the ZPA and Fgf8 expression in the AER appear normal at E10.5 (see
Fig. S1 in the supplementary material), we observed an alteration in
Grem1 expression (Fig.
3A,B), which is known to be regulated by the Shh-BMP pathway in
the posterior mesenchyme (Capdevila et al.,
1999; Merino et al.,
1999; Nissim et al.,
2006; Panman et al.,
2006). We detected wild-type Grem1 expression in a wide
region of the posterior mesenchyme. By contrast, Grem1 expression was
weaker and restricted to a smaller region in the
Sall1-/-;Sall3-/- limb
(Fig. 3A,B). This was also
evident in the E11.5 mutant limb (Fig.
3C,D). These results suggest reduced Shh signaling in the absence
of Sall1 and Sall3. Despite these changes, it seems that
Sall activity is not required in the entire limb mesenchyme, as the skeletal
phenotype is restricted to the autopod
(Fig. 1), consistent with
Sox9 expression at E11.5 (Fig.
3E,F). Reflecting the defects at E15.5, we observed loss of digit1
and fusion of digit2 and digit3 primordia at E11.5
(Fig. 3E,F). Segregation of
digit4 and digit5 primordia was also delayed. Correlating with the defects,
the anterior and posterior margin of the Fgf8 expression domain in
the AER is shorter in the mutant than in the control limb at E11.5
(Fig. 3G,H), which is
associated with a smaller autopod area. Given that digit1 develops in the
absence of Shh (Chiang et al.,
2001; Kraus et al.,
2001), these results suggest that, in addition to reduced Shh
signaling, other mechanisms also contribute to the
Sall1-/-;Sall3-/- limb phenotype.
|
|
). As digit1 is also affected in the
Sall1-/-;Sall3-/- autopod, this raised the
possibility that the phenotype observed in the
Sall1-/-;Sall3-/- autopod could be due to the
altered expression of Sall4, Tbx5 (or Tbx4). However, we did
not observe a significant alteration in the expression of these genes in the
Sall1-/-;Sall3-/- limb bud (see Fig. S2 in the
supplementary material). These results indicate that Sall1 and
Sall3 do not regulate the expression of Sall4, Tbx5 and
Tbx4.
Conversely, we examined the possibility that Sall1 and
Sall3 act downstream of Tbx5, similar to the case of
Sall4 in the forelimb bud (Harvey
and Logan, 2006;
Koshiba-Takeuchi et al.,
2006). Although a clear downregulation of Sall4 is
reported in Tbx5+/- limb buds, we did not observe a
significant alteration of Sall1 and Sall3 expression in the
limb buds between Tbx5+/- and wild-type littermates at
E11.0 and E11.5 (see Fig. S3 in the supplementary material; data not shown).
These results indicate that the expression of Sall1 and
Sall3 is not regulated by Tbx5 function. As it has been
recently demonstrated that Tbx5 is required for forelimb initiation,
but not for skeletal patterning (Hasson et
al., 2007), our data collectively suggest that anterior autopod
defects in the Sall1-/-;Sall3-/- limb are not
directly linked to the function of the Tbx5-Sall4
interaction.
Normal expression of region-specific Hox genes in the absence of Sall1 and Sall3
Studies in invertebrates have suggested that the function of spalt
is closely associated with that of Hox genes in several developmental contexts
(Copf et al., 2006;
Galant et al., 2002;
Toker et al., 2003). In
vertebrates, Hox genes play crucial roles during limb development (reviewed by
Zakany and Duboule, 2007).
Specifically, Hoxa13 and Hoxd13 are required for proper
autopod development in mice
(Fromental-Ramain et al.,
1996). Other Hox genes also cooperate with these Hox13
paralogous genes (Kmita et al.,
2002; Tarchini et al.,
2006). Thus, it is possible that altered Hox expression may
account for the Sall1-/-;Sall3-/- limb
phenotype. To examine this possibility, we analyzed the expression of Hoxa and
Hoxd genes, which are known to be important for the development of the
autopod. We observed similar expression of Hoxa11, Hoxa13, Hoxd11,
Hoxd12 and Hoxd13 in the control and the
Sall1-/-;Sall3-/- limbs (see Fig. S4 in the
supplementary material). Slightly smaller expression domains of Hoxa13,
Hoxd12 and Hoxd13 were detectable in
Sall1-/-;Sall3-/- mutant limbs. However, as
morphological alterations are visible at E11.5
(Fig. 3E,F), the minimal
changes observed in Hox gene expression are likely to be the consequence, but
not the cause, of the morphological alterations. These results indicate that
abrogating Sall activity does not affect the regulation of 5' Hoxa and
Hoxd genes during autopod development.
Expression of the Hox target Epha3 and Epha4 is altered in the absence of Sall1 and Sall3
Although the expression pattern of Hox genes does not change in the
Sall1-/-;Sall3-/- mutant limbs, it remains
possible that the function of Hox proteins is altered. To examine this
possibility, we first sought to identify an in vivo readout of Hox activity. A
previous comprehensive study has identified several genes regulated by
Hoxd13 (Cobb and Duboule,
2005). Epha3 is one of the genes characterized as a
downstream target of Hoxd13. It is not known, however, whether
Epha3 expression is also regulated by Hoxa13. We
demonstrate, by in situ hybridization analysis, that Epha3 expression
is altered in both Hoxa13-/- and
Hoxd13-/- mutant limbs
(Fig. 4A-C). This change
includes not only an upregulation of expression but is also an expansion of
the expression domain from the anterior edge to the distal middle region.
Furthermore, we found that Epha4 was also mis-expressed in
Hox13 mutants, making this gene a likely Hox gene target. Similar to
the case of Epha3, Epha4 expression is upregulated in both
Hoxa13-/- and Hoxd13-/- mutant limbs.
These results indicate that Hoxa13 and Hoxd13 repress
Epha3 and Epha4 expression, and that the expression of
Epha3 and Epha4 is a bona fide indicator of Hoxa13 and
Hoxd13 activity in the limb bud.
|
|
Hox represses Sall expression
Our results suggest a relationship between Hox activity and Sall activity.
We hypothesized that Hox activity represses the expression of Sall1
and Sall3, resulting in downregulation of Epha3 and
Epha4 expression. To test this possibility, we analyzed the
expression of Sall1 and Sall3 in Hox mutants.
Normal expression of Sall1 and Sall3 starts to regress from
the most distal mesenchyme in the E11.5 hindlimb
(Fig. 6A,E)
(Buck et al., 2001;
Ott et al., 2001). Expression
of Sall1 and Sall3 in the Hoxa13-/-
mutant limb is slightly stronger than that of a wild-type E11.5 littermate
hindlimbs (Fig. 6B,F). In the
Hoxd13-/- mutant limb, the expression of Sall1
and Sall3 is upregulated, and the expression was prolonged in the
most distal region when compared with a wild-type littermate
(Fig. 6C,G). In the
Hoxa13-/-;Hoxd13-/- mutant limb, the expression
of Sall1 and Sall3 is stronger and more expanded in the
large region of the distal mesenchyme when compared with single
Hoxa13 or Hoxd13 mutant limbs
(Fig. 6D,H). These results
indicate a synergistic activity of Hoxa13 and Hoxd13 in repressing
Sall1 and Sall3 expression.
Sall and Hox compete for a target sequence
As Hox expression is not affected in the absence of Sall1
and Sall3 (see Fig. S4 in the supplementary material), the possible
gain of Hox function in
Sall1-/-;Sall3-/- limbs might be by
post-transcriptional regulation. A possible mechanism for such regulation
could be that Sall and Hox compete for regulatory elements of common target
genes such as Epha3 and Epha4. In an effort to address this,
we found that the mouse Epha4 gene has an AT-rich stretch in the
upstream region. At -2028 bp from the transcription start position, we found
two recently identified, tandemly positioned, AT-rich Sall1 consensus
sequences (Lauberth et al.,
2007; Yamashita et al.,
2007).
As Hox proteins have preferential binding to AT-rich sequences
(Pearson et al., 2005), these
proteins may act antagonistically in the upstream region for the
transcriptional regulation of Epha4. Therefore, we analyzed whether
Sall1, Hoxa13 and Hoxd13 can recognize the AT-rich Sall1 consensus sequence
upstream of the Epha4 gene by EMSA. As shown in
Fig. 7A, in vitro translated
HA-tagged Sall1 binds to the wild-type probe (arrow). The specificity is
confirmed by the supershift induced by the anti-HA antibody (asterisk). With a
probe carrying two types of mutations in distinct domains, the binding clearly
became weaker. The binding was more affected by introducing two-point
mutations on the 3' side (M1 probe) than four-point mutations on the
5' side (M2 probe). With a probe containing multiple mutations that
disrupted the AT-rich sequence (M3 probe), the binding was completely
abolished. Conversely, when these wild-type and mutant probes are used as
excess amount of cold competitors, we observed complementary results. These
results demonstrate that Sall1 binds to the AT-rich sequence in the upstream
region of the Epha4 gene.
|
The results obtained from DNA-binding assays suggest that the competition for a common binding sequence could be one of the mechanisms for the antagonistic function between Sall and Hox. We tested this possibility by examining the relationship between Sall1 and Hox13 for a common binding sequence in vitro. Sall1, Hoxa13 and Hoxd13 bind to the wild-type probe (Fig. 7A-C), and when Sall1 was present together with Hox13, the binding of Hox13 to the probe was reduced (Fig. 7D). The Sall1-DNA complex also became weaker. This suggests that Sall1 and Hoxa13 (or Hoxd13) compete for the target sequence and that such a mechanism could contribute to the mutual antagonistic function between Sall and Hox proteins.
We further examined whether such a competition could functionally
contribute to the regulation of Hox activity. For this purpose, we set up a
luciferase reporter assay by using an Epha4 upstream region that
contains the Sall-Hox binding site. Hoxd13 activated reporter
activity, whereas Hoxa13 and Sall1 did not activate this
element. Importantly, co-expression of Sall1 significantly reduced
Hoxd13-dependent reporter activation. Although Hoxa13 and
Hoxd13 show different functional contributions to this specific
upstream element, similar to the autopod development in vivo
(Fromental-Ramain et al.,
1996), our data support the idea that DNA binding competition
could contribute to the functional antagonism between Sall and Hox13.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). The absence of limb phenotypes in mice mutant for
individual Sall gene is most likely due to functional redundancy
between the different members of the Sall gene family. The autopod
phenotype of Sall1-/-;Sall3-/- mutant confirmed
that functional redundancy exists between Sall1 and Sall3,
though their functional activity is not equivalent. Based on the skeletal
phenotypes of the Sall1;Sall3 allelic series, Sall1 appears
to have a more important contribution than does Sall3. Indeed,
Sall1-/-;Sall3-/- mutants showed the strongest
phenotype, and milder phenotypes were apparent with the addition of
Sall3 functional alleles
(Sall1-/-;Sall3+/+ mutants exhibit a milder
phenotype than do Sall1-/-;Sall3+/- mutants).
No limb alterations were observed in mice with other genotypes such as
Sall1+/-;Sall3-/-,
Sall1+/-;Sall3+/-
(Fig. 1). Given that mice
expressing truncated Sall1 exhibit loss of digit1 and several carpal
elements (Kiefer et al.,
2003), our data indicate that the dominant-negative action of a
truncated Sall1 might inhibit not only Sall1 but also Sall3 function. Overall,
the findings described here support the concept that Sall1 and
Sall3 have partially redundant activity. Such redundant activity
among members of the Sall gene family is also observed in
Drosophila, where loss of spalt and spalt-related
genes cause defects in multiple organs
(Dong et al., 2003). Thus, the
idea that Sall genes function cooperatively in organogenesis seems to be a
conserved feature in vertebrates and invertebrates.
Mouse genetic studies shown here, as well as previous studies by others,
suggest an organ-specific requirement for different SALL genes in relation to
the TBS. The kidney agenesis appears to be caused mainly by a loss of
Sall1 (Nishinakamura et al.,
2001), the anal and heart phenotypes are probably due to
inhibition of both Sall4 and Sall1 function
(Sakaki-Yumoto et al., 2006),
and the limb phenotype seems to be caused by a reduction of Sall1 and
Sall3 function (this study). Sall2 appears to be dispensable
for limb development, as the
Sall1-/-;Sall2-/-;Sall3-/- triple
mutant limb was indistinguishable from that of
Sall1-/-;Sall3-/- mutant limb (data not shown).
As Sall4 is also expressed in the limb mesenchyme, it is possible
that Sall4 acts together with Sall1 and Sall3. As
Sall4-/- embryos die soon after implantation
(Elling et al., 2006;
Sakaki-Yumoto et al., 2006;
Warren et al., 2007), the
generation of a Sall4 conditional allele is necessary to investigate
this issue.
|
). Our analyses suggest that the expression of Sall1
and Sall3 is not regulated by Tbx5, and that the
Sall1-/-;Sall3-/- autopod phenotype is unlikely
to be linked to Sall4 and Tbx5 (see Fig. S2 in the
supplementary material). The Sall4 gene trap allele would generate a
truncated form of Sall4 that might act as a dominant negative, similar to the
truncated SALL1 in individuals with TBS. Thus, the observed phenotype in the
Sall4GT/+;Tbx5+/- limb might involve reduced
activity of Sall1 and Sall3 by a dominant-negative action of the truncated
Sall4, in addition to Sall4 haploinsufficiency. Further investigation
of the Sall4 loss-of-function phenotype, alone and in combination
with Sall1 and Sall3, will be of particular interest for a
comprehensive analysis of the function and contribution of the Sall gene
family during limb development.
Sall and Shh signaling
Sall activity appears to be part of Shh pathway. Both Shh and
Gli3 signaling have an impact on Sall1 and Sall3
expression (Fig. 2).
Experiments in chicks have demonstrated that Sall1 expression in limb
buds is regulated by Shh and Fgf, which suggested a possible involvement of
Sall1 in distal limb bud patterning
(Farrell and Munsterberg,
2000). The reduced expression of Grem1, a Shh-signaling
target gene in distal/posterior mesenchyme suggest that Sall function acts to
maintain proper levels of Shh signaling in the limb mesenchyme
(Fig. 3). Abrogating
Shh function at various time points during limb development revealed
that digit3 formation is the most sensitive to the loss of Shh
(Scherz et al., 2007;
Zhu et al., 2008).
Interestingly, the Sall1;Sall3 mutation affects primarily the
formation of digit3 (Fig. 1).
Such similarity further supports the idea that Sall1-Sall3 contribution to Shh
signaling. However, the fact that digit5, a second digit sensitive to the loss
of Shh activity, developed in the
Sall1-/-;Sall3-/- mutant limb suggests that
Sall1-Sall3 activity is not a major player in Shh signaling events. Our
observation that Grem1 expression is not abolished but is partially
downregulated (Fig. 3) also
supports this idea. It is conceivable that Sall4, which is expressed
in the distal mesenchyme of the developing limb
(Kohlhase et al., 2002),
partially compensates for the loss of Sall1 and Sall3.
Besides a possible redundancy between Sall1, Sall3 and
Sall4, the loss of digit1, a Shh-independent digit, in the
Sall1-/-;Sall3-/- mutant suggests that
Sall1-/-;Sall3-/- phenotype is not
exclusively due to reduced Shh signaling.
Epha3 and Epha4 as targets of Hox activity
Genetic lineage tracing experiments have demonstrated that digit1, which is
missing in the Sall1-/-;Sall3-/- mutant
autopod, is developed independently of Shh activity
(Ahn and Joyner, 2004;
Harfe et al., 2004).
Furthermore, digit1 develops in the absence of Shh function
(Chiang et al., 2001;
Kraus et al., 2001). Thus, the
loss of digit 1 in the Sall1-/-;Sall3-/- mutant
limb most probably involves a Shh-independent process. Several lines of
evidence led us to examine the possible role of Hox genes in this phenotype:
(1) in invertebrates, the function of spalt gene has been closely
associated with the functions of Hox genes in several developmental contexts
(Copf et al., 2006); (2) mice
with compound mutations in the 5' Hoxd genes, such as Hoxd11,
Hoxd12 and Hoxd13, show defects in carpal and metacarpal
elements (Davis and Capecchi,
1996), which are also observed in the
Sall1-/-;Sall3-/- limb; (3) mice with compound
mutations in Hoxa13 and Hoxd13 exhibit complex autopod
phenotypes, such as abnormal condensation and fusion of cartilage elements,
demonstrating that correct levels of Hoxa13 and Hoxd13
function is important for autopod development
(Fromental-Ramain et al.,
1996); (4) a recent analysis demonstrated that differences in the
local level of Hox transcripts specifically regulates digit1 morphogenesis
(Montavon et al., 2008). Thus,
given that Sall genes encode transcription factors, they might be part of the
mechanisms that control Hox gene expression in limbs, which would explain, at
least in part, the Sall mutant phenotype. However, we did not observe
alteration in the expression of 5' Hox genes in Sall1/Sall3 mutants (see
Fig. S4 in the supplementary material). An alternative possibility is that
Sall proteins have an impact on Hox function at a post-transcriptional level.
Recent analyses have identified several genes regulated by 5' Hoxd genes
(Cobb and Duboule, 2005). One
such gene is Epha3, the expression of which is negatively regulated
by 5' Hoxd genes. Our genetic analyses further uncovered that
Epha4 is also regulated by Hoxa13 and Hoxd13
(Fig. 4). As such,
Epha3 and Epha4 can be used as bona fide indicators of
Hoxa13 and Hoxd13 activity. Even though Hox mutant phenotypes appear to
involve complex processes and numerous target genes, analysis of
Epha3 and Epha4 expression allowed us to evaluate the
activities of Hoxa13 and Hoxd13, and revealed that Hox13 and Sall proteins
compete for binding on common target sequences.
It is not completely understood how Hox regulates limb morphogenesis.
Studies have suggested that Hoxa13 regulates cell surface affinity,
which affects region-specific cell-cell aggregation and segregation
(Stadler et al., 2001;
Yokouchi et al., 1995). In
these studies, it is suggested that Hoxa13-mediated boundary formation may be
an important process for morphogenesis of cartilage elements, and further
suggested that the Eph-ephrin system might be involved in the regulation of
cell surface affinity and morphogenesis. Eph encodes a receptor tyrosine
kinase and ephrin encodes a transmembrane or
glycosylphosphatidylinositol-anchored membrane protein. Their interaction is
known to regulate cell-cell repulsion as well as attraction, and discrete
spatial expression of Ephs and ephrins is known to be important for boundary
formation during tissue morphogenesis
(Holder and Klein, 1999;
Klein, 2004;
Poliakov et al., 2004).
Interestingly, ectopic expression of ephrin A2 in the developing chick limb,
which caused the formation of abnormal ephrin A2 expression boundaries,
resulted in abnormal chondrogenic progenitor segregation, leading to a
disruption of cartilage morphology (Wada
et al., 2003). Furthermore, inactivation of ephrin B1, which
causes mosaic expression of the X-linked ephrin B1 in heterozygous mice,
generated ectopic ephrin B1-EphB interactions and abnormal digit formation
(Compagni et al., 2003). These
studies link Hox activity and cell-cell interaction in the control of skeletal
elements formation. Hox genes regulate the Eph-ephrin system in other organs
(Bruhl et al., 2004;
Shaut et al., 2007) and might
be important during development of other organs. Thus, studying compound
mutants with Eph and ephrin genes in the future could contribute to
understanding the role of cell-cell interaction for cartilage
morphogenesis.
Sall modulates Hox activity in the limb
Our analysis suggests that Sall and Hox have antagonistic
functions during autopod development. By using the expression of
Epha3 and Epha4 as a marker of Hox function, we
have found that Hox and Sall have an opposite impact on their expression.
Furthermore, our genetic analysis clearly demonstrates that Hoxa13
and Hoxd13 repress expression of Sall1 and Sall3 in
the autopod. In turn, Sall proteins antagonize Hox function at a
post-transcriptional level. Our EMSA assays demonstrated that Sall1, Hoxa13
and Hoxd13 bind to a sequence upstream of the Epha4 gene, suggesting
that they might directly regulate Epha4 expression. Moreover, when
co-incubated together, Sall1 competes with Hox13 for binding on the target DNA
sequence (Fig. 7D).
Luciferase-reporter assay experiments further supported that such competition
could contribute to modulating transcriptional activity
(Fig. 7E). Hoxd13
activated the reporter with the Epha4-upstream element, whereas
genetic evidence has demonstrated Hoxd13 as a repressor. Such a
context-dependent activator/repressor conversion has been known to occur with
several transcription factors, including Hox
(Fry and Farnham, 1999;
Svingen and Tonissen, 2006).
Importantly, co-expressed Sall1 repressed Hoxd13-dependent
reporter activation, whereas Sall1 alone did not show an effect on
this reporter (Fig. 7E). The
reason that Hoxa13 did not show significant activation of this
reporter is unclear. As the expression of Epha4 is more affected in
the Hoxd13-/- limb than in the
Hoxa13-/- limb (Fig.
4), the contribution of Hoxd13 to the regulation of
Epha4 expression might be more significant than that by
Hoxa13, and reporter activation in vitro might reflect such a
difference. Alternatively, such a reporter assay might not completely
recapitulate in vivo functions. Nonetheless, our data demonstrate that Sall
and Hox can compete for a common target sequence and such competition could
contribute to functional modulation. Such competition might, at least in part,
contribute to their possible antagonistic function.
Target recognition by Hox proteins is not very strict, favoring a four-base
AT-rich core sequence (Pearson et al.,
2005). Therefore, depending on the molecular partners that might
affect stringency and affinity to target sequences
(Svingen and Tonissen, 2006),
Hox proteins might bind to a variety of regulatory elements. Contrary to Hox,
target recognition by Sall1 is rather stringent
(Lauberth et al., 2007;
Yamashita et al., 2007). Thus,
antagonism by Sall proteins might serve to add local and developmentally timed
specific modulation of Hox activity in the autopod. In turn, such antagonistic
interactions between Hox and Sall in the autopod might contribute to
fine-tuning local cell-cell affinity, leading to segregation or aggregation of
chondrogenic progenitors, and thus contribute to generating the complex
cartilage architecture of the vertebrate autopod.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/4/585/DC1
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Ahn, S. and Joyner, A. L. (2004). Dynamic
changes in the response of cells to positive hedgehog signaling during mouse
limb patterning. Cell
118,505
-516.[CrossRef][Medline]
Borozdin, W., Steinmann, K., Albrecht, B., Bottani, A.,
Devriendt, K., Leipoldt, M. and Kohlhase, J. (2006).
Detection of heterozygous SALL1 deletions by quantitative real time PCR proves
the contribution of a SALL1 dosage effect in the pathogenesis of Townes-Brocks
syndrome. Hum. Mutat.
27,211
-212.[Medline]
Bruhl, T., Urbich, C., Aicher, D., Acker-Palmer, A., Zeiher, A.
M. and Dimmeler, S. (2004). Homeobox A9 transcriptionally
regulates the EphB4 receptor to modulate endothelial cell migration and tube
formation. Circ. Res.
94,743
-751.
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F.,
Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C.
E. et al. (2001). A murine model of Holt-Oram syndrome
defines roles of the T-box transcription factor Tbx5 in cardiogenesis and
disease. Cell 106,709
-721.[CrossRef][Medline]
Buck, A., Kispert, A. and Kohlhase, J. (2001).
Embryonic expression of the murine homologue of SALL1, the gene mutated in
Townes-Brocks syndrome. Mech. Dev.
104,143
-146.[CrossRef][Medline]
Buscher, D., Grotewold, L. and Ruther, U.
(1998). The XtJ allele generates a Gli3 fusion transcript.
Mamm. Genome 9,676
-678.[CrossRef][Medline]
Capdevila, J. and Izpisua Belmonte, J. C.
(2001). Patterning mechanisms controlling vertebrate limb
development. Annu. Rev. Cell Dev. Biol.
17, 87-132.[CrossRef][Medline]
Capdevila, J., Tsukui, T., Rodriquez Esteban, C., Zappavigna, V.
and Izpisua Belmonte, J. C. (1999). Control of vertebrate
limb outgrowth by the proximal factor Meis2 and distal antagonism of BMPs by
Gremlin. Mol. Cell 4,839
-849.[CrossRef][Medline]
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J.
L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and
defective axial patterning in mice lacking Sonic hedgehog gene function.
Nature 383,407
-413.[CrossRef][Medline]
Chiang, C., Litingtung, Y., Harris, M. P., Simandl, B. K., Li,
Y., Beachy, P. A. and Fallon, J. F. (2001). Manifestation of
the limb prepattern: limb development in the absence of sonic hedgehog
function. Dev. Biol.
236,421
-435.[CrossRef][Medline]
Cobb, J. and Duboule, D. (2005). Comparative
analysis of genes downstream of the Hoxd cluster in developing digits and
external genitalia. Development
132,3055
-3067.
Compagni, A., Logan, M., Klein, R. and Adams, R. H.
(2003). Control of skeletal patterning by ephrinB1-EphB
interactions. Dev. Cell
5, 217-230.[CrossRef][Medline]
Copf, T., Rabet, N. and Averof, M. (2006).
Knockdown of spalt function by RNAi causes de-repression of Hox genes and
homeotic transformations in the crustacean Artemia franciscana.
Dev. Biol. 298,87
-94.[CrossRef][Medline]
Davis, A. P. and Capecchi, M. R. (1996). A
mutational analysis of the 5' HoxD genes: dissection of genetic
interactions during limb development in the mouse.
Development 122,1175
-1185.[Abstract]
Dong, P. D., Todi, S. V., Eberl, D. F. and Boekhoff-Falk, G.
(2003). Drosophila spalt/spalt-related mutants exhibit
Townes-Brocks' syndrome phenotypes. Proc. Natl. Acad. Sci.
USA 100,10293
-10298.
Dudley, A. T., Ros, M. A. and Tabin, C. J.
(2002). A re-examination of proximodistal patterning during
vertebrate limb development. Nature
418,539
-544.[CrossRef][Medline]
Elling, U., Klasen, C., Eisenberger, T., Anlag, K. and Treier,
M. (2006). Murine inner cell mass-derived lineages depend on
Sall4 function. Proc. Natl. Acad. Sci. USA
103,16319
-16324.
Farrell, E. R. and Munsterberg, A. E. (2000).
csal1 is controlled by a combination of FGF and Wnt signals in developing limb
buds. Dev. Biol. 225,447
-458.[CrossRef][Medline]
Fromental-Ramain, C., Warot, X., Messadecq, N., LeMeur, M.,
Dolle, P. and Chambon, P. (1996). Hoxa-13 and Hoxd-13 play a
crucial role in the patterning of the limb autopod.
Development 122,2997
-3011.[Abstract]
Fry, C. J. and Farnham, P. J. (1999).
Context-dependent transcriptional regulation. J. Biol.
Chem. 274,29583
-29586.
Galant, R., Walsh, C. M. and Carroll, S. B.
(2002). Hox repression of a target gene:
extradenticle-independent, additive action through multiple monomer binding
sites. Development 129,3115
-3126.
Goff, D. J. and Tabin, C. J. (1997). Analysis
of Hoxd-13 and Hoxd-11 misexpression in chick limb buds reveals that Hox genes
affect both bone condensation and growth. Development
124,627
-636.[Abstract]
Goodman, F. R. (2002). Limb malformations and
the human HOX genes. Am. J. Med. Genet.
112,256
-265.[CrossRef][Medline]
Grant, K., Hanna-Rose, W. and Han, M. (2000).
sem-4 promotes vulval cell-fate determination in Caenorhabditis elegans
through regulation of lin-39 Hox. Dev. Biol.
224,496
-506.[CrossRef][Medline]
Harfe, B. D., Scherz, P. J., Nissim, S., Tian, H., McMahon, A.
P. and Tabin, C. J. (2004). Evidence for an expansion-based
temporal Shh gradient in specifying vertebrate digit identities.
Cell 118,517
-528.[CrossRef][Medline]
Harvey, S. A. and Logan, M. P. (2006). sall4
acts downstream of tbx5 and is required for pectoral fin outgrowth.
Development 133,1165
-1173.
Hasson, P., Del Buono, J. and Logan, M. P.
(2007). Tbx5 is dispensable for forelimb outgrowth.
Development 134,85
-92.
Holder, N. and Klein, R. (1999). Eph receptors
and ephrins: effectors of morphogenesis. Development
126,2033
-2044.[Abstract]
Kawakami, Y., Capdevila, J., Buscher, D., Itoh, T., Rodriguez
Esteban, C. and Izpisua Belmonte, J. C. (2001). WNT signals
control FGF-dependent limb initiation and AER induction in the chick embryo.
Cell 104,891
-900.[CrossRef][Medline]
Khokha, M. K., Hsu, D., Brunet, L. J., Dionne, M. S. and
Harland, R. M. (2003). Gremlin is the BMP antagonist required
for maintenance of Shh and Fgf signals during limb patterning. Nat.
Genet. 34,303
-307.[CrossRef][Medline]
Kiefer, S. M., Ohlemiller, K. K., Yang, J., McDill, B. W.,
Kohlhase, J. and Rauchman, M. (2003). Expression of a
truncated Sall1 transcriptional repressor is responsible for Townes-Brocks
syndrome birth defects. Hum. Mol. Genet.
12,2221
-2227.
Kiefer, S. M., Robbins, L., Barina, A., Zhang, Z. and Rauchman,
M. (2008). SALL1 truncated protein expression in
Townes-Brocks syndrome leads to ectopic expression of downstream genes.
Hum. Mutat. 29,1133
-1140.[CrossRef][Medline]
Klein, R. (2004). Eph/ephrin signaling in
morphogenesis, neural development and plasticity. Curr. Opin. Cell
Biol. 16,580
-589.[CrossRef][Medline]
Kmita, M., Kondo, T. and Duboule, D. (2000).
Targeted inversion of a polar silencer within the HoxD complex re-allocates
domains of enhancer sharing. Nat. Genet.
26,451
-454.[CrossRef][Medline]
Kmita, M., Fraudeau, N., Herault, Y. and Duboule, D.
(2002). Serial deletions and duplications suggest a mechanism for
the collinearity of Hoxd genes in limbs. Nature
420,145
-150.[CrossRef][Medline]
Kmita, M., Tarchini, B., Zakany, J., Logan, M., Tabin, C. J. and
Duboule, D. (2005). Early developmental arrest of mammalian
limbs lacking HoxA/HoxD gene function. Nature
435,1113
-1116.[CrossRef][Medline]
Kohlhase, J. (2000). SALL1 mutations in
Townes-Brocks syndrome and related disorders. Hum.
Mutat. 16,460
-466.[CrossRef][Medline]
Kohlhase, J., Wischermann, A., Reichenbach, H., Froster, U. and
Engel, W. (1998). Mutations in the SALL1 putative
transcription factor gene cause Townes-Brocks syndrome. Nat.
Genet. 18,81
-83.[CrossRef][Medline]
Kohlhase, J., Heinrich, M., Liebers, M., Frohlich Archangelo,
L., Reardon, W. and Kispert, A. (2002). Cloning and
expression analysis of SALL4, the murine homologue of the gene mutated in
Okihiro syndrome. Cytogenet. Genome Res.
98,274
-277.[CrossRef][Medline]
Koshiba-Takeuchi, K., Takeuchi, J. K., Arruda, E. P., Kathiriya,
I. S., Mo, R., Hui, C. C., Srivastava, D. and Bruneau, B. G.
(2006). Cooperative and antagonistic interactions between Sall4
and Tbx5 pattern the mouse limb and heart. Nat. Genet.
38,175
-183.[CrossRef][Medline]
Kraus, P., Fraidenraich, D. and Loomis, C. A.
(2001). Some distal limb structures develop in mice lacking Sonic
hedgehog signaling. Mech. Dev.
100, 45-58.[CrossRef][Medline]
Lappin, T. R., Grier, D. G., Thompson, A. and Halliday, H.
L. (2006). HOX genes: seductive science, mysterious
mechanisms. Ulster Med. J.
75, 23-31.[Medline]
Lauberth, S. M., Bilyeu, A. C., Firulli, B. A., Kroll, K. L. and
Rauchman, M. (2007). A phosphomimetic mutation in the Sall1
repression motif disrupts recruitment of the nucleosome remodeling and
deacetylase complex and repression of Gbx2. J. Biol.
Chem. 282,34858
-34868.
Laufer, E., Nelson, C. E., Johnson, R. L., Morgan, B. A. and
Tabin, C. (1994). Sonic hedgehog and Fgf-4 act through a
signaling cascade and feedback loop to integrate growth and patterning of the
developing limb bud. Cell
79,993
-1003.[CrossRef][Medline]
Litingtung, Y., Dahn, R. D., Li, Y., Fallon, J. F. and Chiang,
C. (2002). Shh and Gli3 are dispensable for limb skeleton
formation but regulate digit number and identity.
Nature 418,979
-983.[CrossRef][Medline]
Mariani, F. V., Ahn, C. P. and Martin, G. R.
(2008). Genetic evidence that FGFs have an instructive role in
limb proximal-distal patterning. Nature
453,401
-405.[CrossRef][Medline]
McLeod, M. J. (1980). Differential staining of
cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S.
Teratology 22,299
-301.[CrossRef][Medline]
Merino, R., Rodriguez-Leon, J., Macias, D., Ganan, Y.,
Economides, A. N. and Hurle, J. M. (1999). The BMP antagonist
Gremlin regulates outgrowth, chondrogenesis and programmed cell death in the
developing limb. Development
126,5515
-5522.[Abstract]
Michos, O., Panman, L., Vintersten, K., Beier, K., Zeller, R.
and Zuniga, A. (2004). Gremlin-mediated BMP antagonism
induces the epithelial-mesenchymal feedback signaling controlling metanephric
kidney and limb organogenesis. Development
131,3401
-3410.
Montavon, T., Le Garrec, J. F., Kerszberg, M. and Duboule,
D. (2008). Modeling Hox gene regulation in digits: reverse
collinearity and the molecular origin of thumbness. Genes
Dev. 22,346
-359.
Nishinakamura, R. and Osafune, K. (2006).
Essential roles of Sall family genes in kidney development. J.
Physiol. Sci. 56,131
-136.[CrossRef][Medline]
Nishinakamura, R., Matsumoto, Y., Nakao, K., Nakamura, K., Sato,
A., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Scully, S., Lacey, D. L.
et al. (2001). Murine homolog of SALL1 is essential for
ureteric bud invasion in kidney development.
Development 128,3105
-3115.
Nissim, S., Hasso, S. M., Fallon, J. F. and Tabin, C. J.
(2006). Regulation of Gremlin expression in the posterior limb
bud. Dev. Biol. 299,12
-21.[CrossRef][Medline]
Niswander, L. (2003). Pattern formation: old
models out on a limb. Nat. Rev. Genet.
4, 133-143.[CrossRef][Medline]
Ott, T., Parrish, M., Bond, K., Schwaeger-Nickolenko, A. and
Monaghan, A. P. (2001). A new member of the spalt like zinc
finger protein family, Msal-3, is expressed in the CNS and sites of
epithelial/mesenchymal interaction. Mech. Dev.
101,203
-207.[CrossRef][Medline]
Panman, L., Galli, A., Lagarde, N., Michos, O., Soete, G.,
Zuniga, A. and Zeller, R. (2006). Differential regulation of
gene expression in the digit forming area of the mouse limb bud by SHH and
gremlin 1/FGF-mediated epithelial-mesenchymal signalling.
Development 133,3419
-3428.
Parrish, M., Ott, T., Lance-Jones, C., Schuetz, G.,
Schwaeger-Nickolenko, A. and Monaghan, A. P. (2004). Loss of
the Sall3 gene leads to palate deficiency, abnormalities in cranial nerves,
and perinatal lethality. Mol. Cell. Biol.
24,7102
-7112.
Pearson, J. C., Lemons, D. and McGinnis, W.
(2005). Modulating Hox gene functions during animal body
patterning. Nat. Rev. Genet.
6, 893-904.[CrossRef][Medline]
Poliakov, A., Cotrina, M. and Wilkinson, D. G.
(2004). Diverse roles of eph receptors and ephrins in the
regulation of cell migration and tissue assembly. Dev.
Cell 7,465
-480.[CrossRef][Medline]
Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C.
(1993). Sonic hedgehog mediates the polarizing activity of the
ZPA. Cell 75,1401
-1416.[CrossRef][Medline]
Sakaki-Yumoto, M., Kobayashi, C., Sato, A., Fujimura, S.,
Matsumoto, Y., Takasato, M., Kodama, T., Aburatani, H., Asashima, M., Yoshida,
N. et al. (2006). The murine homolog of SALL4, a causative
gene in Okihiro syndrome, is essential for embryonic stem cell proliferation,
and cooperates with Sall1 in anorectal, heart, brain and kidney development.
Development 133,3005
-3013.
Sato, A., Matsumoto, Y., Koide, U., Kataoka, Y., Yoshida, N.,
Yokota, T., Asashima, M. and Nishinakamura, R. (2003). Zinc
finger protein sall2 is not essential for embryonic and kidney development.
Mol. Cell. Biol. 23,62
-69.
Scherz, P. J., Harfe, B. D., McMahon, A. P. and Tabin, C. J.
(2004). The limb bud Shh-Fgf feedback loop is terminated by
expansion of former ZPA cells. Science
305,396
-399.
Scherz, P. J., McGlinn, E., Nissim, S. and Tabin, C. J.
(2007). Extended exposure to Sonic hedgehog is required for
patterning the posterior digits of the vertebrate limb. Dev.
Biol. 308,343
-354.[CrossRef][Medline]
Shaut, C. A., Saneyoshi, C., Morgan, E. A., Knosp, W. M.,
Sexton, D. R. and Stadler, H. S. (2007). HOXA13 directly
regulates EphA6 and EphA7 expression in the genital tubercle vascular
endothelia. Dev. Dyn.
236,951
-960.[CrossRef][Medline]
Stadler, H. S., Higgins, K. M. and Capecchi, M. R.
(2001). Loss of Eph-receptor expression correlates with loss of
cell adhesion and chondrogenic capacity in Hoxa13 mutant limbs.
Development 128,4177
-4188.
Svingen, T. and Tonissen, K. F. (2006). Hox
transcription factors and their elusive mammalian gene targets.
Heredity 97,88
-96.[CrossRef][Medline]
Sweetman, D. and Munsterberg, A. (2006). The
vertebrate spalt genes in development and disease. Dev.
Biol. 293,285
-293.[CrossRef][Medline]
Tabin, C. and Wolpert, L. (2007). Rethinking
the proximodistal axis of the vertebrate limb in the molecular era.
Genes Dev. 21,1433
-1442.
Tarchini, B., Duboule, D. and Kmita, M. (2006).
Regulatory constraints in the evolution of the tetrapod limb
anterior-posterior polarity. Nature
443,985
-988.[CrossRef][Medline]
te Welscher, P., Zuniga, A., Kuijper, S., Drenth, T., Goedemans,
H. J., Meijlink, F. and Zeller, R. (2002). Progression of
vertebrate limb development through SHH-mediated counteraction of GLI3.
Science 298,827
-830.
Toker, A. S., Teng, Y., Ferreira, H. B., Emmons, S. W. and
Chalfie, M. (2003). The Caenorhabditis elegans spalt-like
gene sem-4 restricts touch cell fate by repressing the selector Hox gene egl-5
and the effector gene mec-3. Development
130,3831
-3840.
Wada, N., Tanaka, H., Ide, H. and Nohno, T.
(2003). Ephrin-A2 regulates position-specific cell affinity and
is involved in cartilage morphogenesis in the chick limb bud. Dev.
Biol. 264,550
-563.[CrossRef][Medline]
Warren, M., Wang, W., Spiden, S., Chen-Murchie, D., Tannahill,
D., Steel, K. P. and Bradley, A. (2007). A Sall4 mutant mouse
model useful for studying the role of Sall4 in early embryonic development and
organogenesis. Genesis
45, 51-58.[CrossRef][Medline]
Wilkie, A. O. (2003). Why study human limb
malformations? J. Anat.
202, 27-35.[CrossRef][Medline]
Wilkinson, D. G. (1993). Whole mount in situ
hybridization of vertebrate embryos. In In Situ
Hybridization. Oxford, UK: Oxford University Press.
Williams, M. E., Lehoczky, J. A. and Innis, J. W.
(2006). A group 13 homeodomain is neither necessary nor
sufficient for posterior prevalence in the mouse limb. Dev.
Biol. 297,493
-507.[CrossRef][Medline]
Yamashita, K., Sato, A., Asashima, M., Wang, P. C. and
Nishinakamura, R. (2007). Mouse homolog of SALL1, a causative
gene for Townes-Brocks syndrome, binds to A/T-rich sequences in pericentric
heterochromatin via its C-terminal zinc finger domains. Genes
Cells 12,171
-182.
Yoh, S. M. and Privalsky, M. L. (2001).
Transcriptional repression by thyroid hormone receptors. A role for receptor
homodimers in the recruitment of SMRT corepressor. J. Biol.
Chem. 276,16857
-16867.
Yokouchi, Y., Nakazato, S., Yamamoto, M., Goto, Y., Kameda, T.,
Iba, H. and Kuroiwa, A. (1995). Misexpression of Hoxa-13
induces cartilage homeotic transformation and changes cell adhesiveness in
chick limb buds. Genes Dev.
9,2509
-2522.
Zakany, J. and Duboule, D. (2007). The role of
Hox genes during vertebrate limb development. Curr. Opin. Genet.
Dev. 17,359
-366.[CrossRef][Medline]
Zakany, J., Fromental-Ramain, C., Warot, X. and Duboule, D.
(1997). Regulation of number and size of digits by posterior Hox
genes: a dose-dependent mechanism with potential evolutionary implications.
Proc. Natl. Acad. Sci. USA
94,13695
-13700.
Zhu, J., Nakamura, E., Nguyen, M. T., Bao, X., Akiyama, H. and
Mackem, S. (2008). Uncoupling Sonic hedgehog control of
pattern and expansion of the developing limb bud. Dev.
Cell 14,624
-632.[CrossRef][Medline]
Zuniga, A., Haramis, A. P., McMahon, A. P. and Zeller, R.
(1999). Signal relay by BMP antagonism controls the SHH/FGF4
feedback loop in vertebrate limb buds. Nature
401,598
-602.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
