|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 January 2009
doi: 10.1242/dev.025569
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Human Genetics Unit, MRC, Western General Hospital, Edinburgh EH4 2XU,
UK.
2 Center `Bioengineering', 60-let Oktyabrya 7-1, Moscow, 117312, Russian
Federation.
3 Shanghai Biochip Company, No.151 Libing Road, Zhangjiang Hi-Tech Park, Pudong,
Shanghai, 201203, China.
4 Queen's Medical Research Institute, University of Edinburgh, Edinburgh EH16
4TJ, UK.
Author for correspondence (e-mail:
r.meehan{at}hgu.mrc.ac.uk)
Accepted 15 December 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Evolution, Kaiso, MBT, Siamois, Methyl-CpG binding, Xenopus laevis
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Ruzov et al., 2004). xKMO
morphants subsequently die during neurulation with all the hallmarks of
apoptosis (Ruzov et al.,
2004). Differing interpretations exist as to the molecular basis
of the mutant phenotype. Our work suggests that xKaiso regulates general gene
silencing before the mid-blastula transition (MBT) through its ability to bind
methylated DNA via its zinc-finger domains (ZF1-3)
(Ruzov et al., 2004). In this
respect, it is notable that the ectopic gene expression profile in pre-MBT
xKMO embryos corresponds to a subset of genes that are prematurely activated
when levels of the maintenance methyltransferase, xDnmt1, are decreased
(Ruzov et al., 2004). A
different study (using the same xKaiso morpholino) was restricted to the
analysis of potential gastrulation defects (stages 10-12), in which the same
gastrula phenotype, corresponding to developmental delay and an open
blastopore, was observed (Kim et al.,
2004). Here it was suggested that xKaiso could also directly
repress canonical and non-canonical Wnt gene targets (Siamois, Fos, Cyclin-D1,
Myc and xWnt11) based on its ability to bind non-methylated CTGCNA sites that
are present in target promoters (Kim et
al., 2004; Park et al.,
2005). These distinct reports suggested that xKaiso has bimodal
gene regulatory roles during animal development; as a participant in an
embryonic general transcription repression pathway and as a regulator of
canonical and non-canonical Wnt-signalling pathways during gastrulation. These
data also raise questions as to the underlying molecular pathology of the
observed phenotypes. Do they result from Kaiso's role as a component of the
xDnmt1/DNA methylation repression pathway in pre-MBT embryos and subsequent
activation of apoptosis, or are the phenotypes due to its ability to
specifically regulate the expression of genes such as Siamois and xWnt11 via
defined non-methylated DNA binding sequences? One way to discriminate between
these potentially differing roles in X. laevis development is to try
to rescue the mutant phenotype with a Kaiso variant that can only bind
methylated DNA and not CTGCNA-binding sites.
The original DNA-binding site selection experiments with mouse Kaiso under
low stringency conditions identified a non-methylated DNA-binding motif, Hmat,
with a conserved 6 bp core sequence CTGCNA that was first identified in the
promoter of the human matrilysin gene
(Daniel et al., 2002).
Previously we had noted that xKaiso was not as robust as its mammalian
counterparts in binding Hmat (Ruzov et
al., 2004). We therefore undertook a characterisation of the
DNA-binding properties of Kaiso in three species (zebrafish, frog and chicken)
to determine if their methylated and non-methylated DNA-binding functions are
conserved. In this study we demonstrate that the ZF1-ZF2 region of all three
Kaiso homologues is sufficient for binding methylated DNA but that the ability
to bind Hmat is not conserved. Zebrafish Kaiso is unable to bind Hmat or
CTGCNA sequences present in the Siamois and xWnt11 promoters. Despite its
reduced DNA-binding repertoire (compared with frog and human Kaiso),
co-injection of dKaiso mRNA rescues developmental defects associated with xKMO
morphants. This observation suggests that the reported CTGCNA-binding function
of xKaiso does not have a key role during early Xenopus laevis
development. In agreement with this observation, we did not observe ectopic
activation of Siamois or xWnt11 expression in xKMO morphants. A global
analysis of Kaiso occupancy in chromatin derived from human 293 cells also did
not find any evidence for enrichment of CTGCNA-containing sequences. We
propose that the main role of Kaiso in early X. laevis development is
more restricted than previously suggested and intimately linked with the
maintenance of transcriptional silencing before the onset of zygotic
transcription at the MBT (Park et al.,
2005; Ruzov et al.,
2004).
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). The same
region was cloned into a modified pet25A-6xHis-tag expression vector
(Allen et al., 2006). The
xBTB/POZ region (aa 2-120) of xKaiso was cloned into pGEX-4T1. dKaisoZF123 (aa
371-550) and gKaisoZF123 (aa 419-611) were cloned into both pGEX-6P-1 and
pet25A-6xHis-tag. Full-length xKaiso was cloned into pGEX-6P-2. xKaisoZF12 (aa
470-558) and xKaisoZF23 (aa 523-608) were cloned into pGEX-6P-1 and pGEX-6P-3,
respectively. gKaisoZF12 (aa 419-558) and gKaisoZF23 (aa 524-611) were cloned
into the pGEX-6P1 vector. GST-fusion proteins were expressed in Rosetta-gami
cells (Novagen) and purified on GST Sepharose. 6xHis-tag fusions were
expressed in BL21-Codon Plus (DE3)-RIPL (Stratagene) and affinity purified on
Ni-NTA Superflow (Qiagen) according to the manufacturer's instructions. The
mKaiso construct was made by cloning the full-length mKaiso cDNA into the
EcoRI site of the LZRS vector. The HA-tagged dKaiso construct was
made by cloning into the C-terminal polylinker of CMV2-FLAG together with an
HA epitope. The T7-tagged dKaiso and xKaiso expression constructs were made in
pCGT7 by cloning into XbaI-BamHI sites
(Cazalla et al., 2005). These
were expressed in 293T cells and T7-tagged proteins affinity purified
(Cazalla et al., 2005). To
obtain VP16 fusions zinc-finger domains of xKaiso (aa 447-635) and the HMG
domain of xTcf3 were cloned into the EcoRI and XbaI sites
downstream of the VP16 activation domain in pVP16 (Clontech). The -304 to +198
bp region of the mouse Tex19 promoter was cloned into the MluI and
BglII sites of pGL3-basic (Promega) using primers with restriction
site overhangs. S01234 and S constructs were previously described
(Brannon et al., 1997). The
constructs were in vitro methylated according to standard techniques.
Luciferase reporters were transfected (Lipofectamine 2000) into 293T cells and
analysed according to Dunican et al.
(Dunican et al., 2008).
Electrophoretic mobility shift assay (EMSA) experiments
Binding reactions were as described, using 5% PAGE in 0.5 x TBE to
resolve DNA-protein complexes with S (non-methylated), Sm (methylated-Sm)
probes (Prokhortchouk et al.,
2001), the human matrilysin (Hmat) oligo
(Daniel and Reynolds, 1999),
wild-type KCS-Siamois oligo (Park
et al., 2005), wild-type Xenopus Wnt11 oligo
(Kim et al., 2004) and TCFbs
oligo derived from Xenopus Siamois promoter: F
catcagaatcATCAAAGgacctccc, R gggaggtccTTTGATgattctgatg. Purified GST proteins,
6xHis-tag proteins, T7-tagged proteins, Escherichia coli extracts
containing GST-fusion proteins or in vitro translated myc-xTcf3 were used in
EMSAs. After gel scanning on an FLA2000, signal quantification was performed
using AIDA software.
Embryos and microinjections
Xenopus embryos were obtained from in vitro fertilised eggs. They
were grown, staged and microinjected according to standard procedures
(Stancheva and Meehan, 2000).
At the two-cell stage, the embryos were injected into the animal half with
10-40 ng/cell of the xKMO or control morpholino (Gene-Tools), and/or 200-750
pg of sense capped RNA (dKaiso or myc-xKaiso mRNA) synthesized in vitro (T3/T7
Cap-Scribe kit, Boehringer) (Ruzov et al.,
2004). Zebrafish Wik embryos, obtained from in house breeding,
were maintained at 28°C as described previously
(Detrich et al., 1999). Between
5 and 15 ng/embryo of dKaiso morpholino (ATATCAGCTTCAGTTTCGACATGCC) was
injected according to Nasevicius and Ekker
(Nasevicius and Ekker, 2000).
A second MO, TGCAGAGCGACCCGTACAAATCCAC, was also used and gave similar
phenotypes. For the rescue experiment equal volumes of dKMO and dKMO plus
xKaiso mRNA (1 ng/nl) were injected. The phenotypes of surviving embryos (48)
were scored after 24 hours. In experiments on apoptosis inhibition embryos
were placed in 0.1XMMR containing 20 µM caspase-3 inhibitor Z-DEVD-FMK
(R&D Systems) immediately after microinjection. xp53 morpholino was
described in Cordenonsi et al. (Cordenonsi
et al., 2003). All in situ hybridisations were performed according
to published procedures (Hauptmann and
Gerster, 1994). xWnt11 full-length cDNA was cloned into pGEMT-easy
and used as a probe. xID2 probe was provided by Richard Harland
(Liu and Harland, 2003).
Semi-quantitative and real-time RT-PCR
Semi-quantitative RT-PCR was performed as reported before
(Ruzov et al., 2004) using
published primers for xWnt11 (Kim
et al., 2004), Siamois
(Park et al., 2005) and H4
(Ruzov et al., 2004).
Quantitative real-time RT-PCR of xWnt11, Siamois, Caspase7 and
Caspase9 was evaluated as follows
(Houston et al., 2002). Primer
sequences for Caspase7 and Caspase9 are available upon request. Total RNA was
extracted with TriReagent (Sigma). Samples were reverse transcribed using
random primers (Promega) and Superscript II RT (Invitrogen). Products were
detected using SYBR Green PCR Mastermix (Applied Biosystems) and a PTC-200
cycler with a Chromo-4 detection system (MJ Research). Data were normalised
relative to both GAPDH and H4 RNA, with comparable results. Error is expressed
as s.e.m.
Chromatin immunoprecipitation (ChIP) assay and bisulfite sequencing
The chromatin immunoprecipitation (ChIP) assay was performed in an A6
Xenopus cell line according to
(Dunican et al., 2008) using
HA-tagged xKaiso or T7 tagged dKaiso with published ChIP primers for the
Siamois promoter region (Park et
al., 2005) or the Oct91 distal promoter region
(Dunican et al., 2008).
Bisulfite sequencing was performed according to standard procedures
(Dunican et al., 2008).
HEK cells were used for genome-wide ChIP. Anti-HA tag polyclonal antibody
(Bethyl Laboratories), ZFH6 rabbit polyclonal mKaiso antibody
(Prokhortchouk et al., 2001),
IgG or anti-T7 tag antibody (Novagene) were used. The transfection levels were
checked by western blot hybridisation. ChIP DNA was amplified using anWGA4 kit
(Sigma) and sequenced using the Genome Sequencer FLX System (Roche).
Genome-wide ChIP/sequencing data analysis
The ChIP DNA sequences were analysed using Perl, Blast and GS FLX Mapper
software.
Initially PCR primer sequences were excluded from the analysis. Sequences obtained in the same experiment that were 97% or more homologous to each other and had the same 5' end (with not more than 5 bp difference) were regarded as the same sequence that had become amplified during whole-genome amplification (WGA) PCR. All the remaining sequences were mapped on to the human genome (version 36.1) with a homology threshold of at least 95% throughout the whole length of the sequence. Only the unique genomic sequences were selected for further analysis. For all selected sequences the central positions were used as reference points for mapping onto the genome. If less than three such central positions were mapped onto a 1 kb segment of the genome the corresponding sequences were excluded from further analysis. In the case where central sequences positions from four different experiments (using different antibodies) were scored onto the same 1 kb region of the genome, the corresponding sequences were also excluded from the analysis. After this filtration protocol, the numbers of sequences for mKaiso ChIP with ZFH6 antibody, mKaiso ChIP with preimmune serum, dKaiso-HA ChIP with HA antibody and mock transfection with HA antibody experiments were 27,000, 72,000, 55,000 and 28,000, respectively. The 1 kb genomic regions anchored by the central sequences after filtration were analysed for the presence of CpG-rich regions or CTGCNA sites. Raw genome-wide ChIP/sequencing data are available upon request to Egor Prokhortchouk (Prokhortchouk{at}biengi.ac.ru).
CpG island array design
To design the CpG island array, CpG islands were selected from the human
genome sequence (version 36.1) according to the following parameters: CpG
island length >250 bp, expected/observed ratio >0.6, percentage of CpGs
>50. There were 46,957 CpG islands chosen in total. These CpG islands were
used by NimbleGene for the synthesis of 36,7802 isotermic oligonucleotides
(38-70 bp each).
Genome-wide methylation status analysis
The MBD domain of human MBD2 was cloned into EcoRI, SalI
sites of pGEX 4T-1 vector to make MBD2 GST fusion construct. To prepare
MBD2B-GST sepharose the MBD2B-GST fusion was purified on glutathione sepharose
4b (Amersham Biosciences, Piscataway, NJ) without elution. Fifty microlitres
of sepharose saturated with GST-tagged MBD2B were incubated with 200 µl
binding buffer (25 mM Hepes KOH, pH 7.5, 300 mM KCl, 12.5 mM MgCl2,
10% glycerol, 1 mM DTT). ChIP HEK293 genomic DNA, 500 ng fragmented with an
average size of 200-300 bp and ligated with adaptors
(5'-GCGGTGACCCGGGAGATCTGAATTC-3' and
5'-GAATTCAGATC-3'), was used for binding with MBD2-GST-sepharose
using a procedure adapted from Rauch and Pfeifer
(Rauch and Pfeifer, 2005).
Fifty nanograms of DNA was used as an input control. Briefly, DNA was
incubated with MBD2 resin for 2 hours, washed three times with washing buffer
(25 mM Hepes KOH, pH 7.5, 600 mM KCl, 12.5 mM MgCl2, 10% glycerol,
1 mM DTT), eluted with elution buffer (25 mM Hepes KOH, pH 7.5, 1.5 M KCl,
12.5 mM MgCl2, 10% glycerol, 1 mM DTT), purified using Qiaquick PCR
purification kits (Qiagen, Valencia, CA), amplified and Cy3(Cy5) labelled.
Equal amounts of MBD2B-GST bound and input labelled DNA were hybridised with
our NimbleGene CpG island array for 40 hours according to the manufacturer's
instructions. After hybridization, the array was processed with NimbleGene
buffers and washes. The arrays were scanned on a GenePix scanner to measure
Cy3 and Cy5 intensity. To identify signal peaks SignalMap software
(NimbleGene) was used with a threshold 2. The CpG rich sequences obtained in
the genome-wide ChIP/sequencing experiment were analysed for their
correspondence (overlap) with the methylated CpG islands using a ChIP
sequence/CpG island distance thresholds from 500 to 2000 bp.
|
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
The sequence variability in ZF3 is intriguing, as the ZF2-3 modules were
reported to be necessary and sufficient for DNA binding
(Daniel et al., 2002). We
therefore determined the DNA-binding specificity of recombinant Kaiso-ZF1-3
modules in band shift assays. All the Kaiso proteins tested (Xenopus,
zebrafish and chicken) were able to specifically bind the Sm oligo (3 MeCpGs)
but not the S oligo, its non-methylated counterpart
(Fig. 1C). By contrast, gKaiso
had a similar affinity for the non-methylated Hmat sequence as for Sm, whereas
xKaiso had a lower affinity for the Hmat oligo. Remarkably, dKaiso had no
detectable binding to Hmat. This is probably due to sequence differences in
ZF3. The same results were obtained using GST-ZF1-3 fusions (see Fig. S2A in
the supplementary material). For a summary of the binding results see Fig. S2B
in the supplementary material. It is notable that ZF3 in Kaiso proteins that
can bind Hmat contains a core SHIR/KS sequence. This is replaced by THCKQ or
THCKS in zebrafish and fugu, respectively
(Fig. 1A), which may account
for the lack of Hmat binding by dKaiso.
|
). The
mKaiso analysis was based on EMSAs done under reduced stringency conditions
with low amounts of competitor DNA and high amounts of fusion protein
(Daniel et al., 2002). This may
account for our differing conclusions; in our experiments, such EMSA
conditions led to non-specific DNA binding (see
Fig. 3E).
dKaiso is a methylation-specific repressor and is essential for zebrafish development
Apart from expression in X. laevis being limited to the animal
pole, Kaiso mRNAs do not exhibit any regionally restricted expression pattern
that would suggest Kaiso has a specific role in dorsoanterior specification
(see Fig. S3A-C in the supplementary material). Given the unique DNA-binding
properties of dKaiso, we tested whether it can repress transcription in a
methyl-CpG dependent manner. We used a murine
Kaiso/Mecp2/Mbd2-/- recipient cell line, which is
defective in its ability to inhibit expression from methylated reporter
plasmids (Filion et al.,
2006). In these cells the methylated reporter plasmid was
de-repressed to approximately 23% of a control non-methylated plasmid.
Co-transfection of Xenopus, zebrafish or human Kaiso
(hKaiso) expression plasmids resulted in enhanced repression of the
methylated reporter, but not from the non-methylated control
(Fig. 2A). Thus, dKaiso is a
methyl-CpG repressor protein like its amphibian and mammalian counterparts.
Since dKaiso cannot bind the non-methylated Hmat sequence, we determined
whether it was essential for early zebrafish development using used a
fluorescein-labelled morpholino (dKMO), which has the same specificity of
action as its unlabelled counterpart. Embryos microinjected with dKMO at the
1- to 4-cell stage (Nasevicius and Ekker,
2000) were scored for survival and morphology after 24 and 48
hours of development (Fig.
2B,C). The dKMO morphants had significantly higher rates of embryo
mortality at 48 hours: 89% compared with 17% for a non-inhibitory control
morpholino, including any associated microinjection damage. Surviving dKMO
morphants exhibited gross phenotypic defects, including microcephaly, that
were coincident with the presence and dose of the morpholino. All the
surviving control embryos (83%) went on to develop normally compared with only
2.5% of the dKMO morphants. Most of the remaining dKMO survivors at 48 hours
(8.5%) exhibited developmental delay, axial defects and incomplete head
formation. Although 2.5% were normal in appearance, these embryos displayed
abnormal neural responses compared with controls (not shown) and represented a
low-dose phenotype. These features are similar to the phenotypes associated
with xKaiso or xDnmt1 depletion in Xenopus embryos and dDnmt1
depletion in zebrafish (Rai et al.,
2006; Ruzov et al.,
2004; Stancheva and Meehan,
2000). The range of dose-dependent phenotypes could be ameliorated
by co-injection of xKaiso mRNA (Fig.
2D; see Fig. S4A,B in the supplementary material) and we observed
similar phenotypes with a second non-overlapping dKaiso morpholino (not
shown). We conclude that dKaiso is essential for zebrafish development.
|
),
and this feature underlies its essential function in zebrafish development.
However, we could only detect binding by ZF1-3 (Xenopus, zebrafish
and chicken) recombinant proteins to the Sm sequence and not the Siamois- and
xWnt11-derived sequences (Fig.
3A,B; see Fig. S2C,D in the supplementary material), irrespective
of using poly dI-dC or E. coli DNA as a non-specific competitor (data
not shown). No binding to the promoter CTGCNA sequences was observed even with
either a full-length GST-xKaiso fusion (see Fig. S2D in the supplementary
material) or T7-tagged xKaiso or dKaiso
(Fig. 1E). In competition
experiments, unlabelled Sm oligo could efficiently compete with binding to
itself, whereas Hmat was less efficient as a competitor of Sm binding to
xZF1-3 (Fig. 3C,D). The
competition experiments suggest that Hmat is 10-fold less efficient in binding
xKaiso compared with Sm, whereas a 200-fold excess of either the Siamois- or
xWnt11-derived sequences did not interfere with Sm binding
(Fig. 3D). The specificity of
the Kaiso/DNA complex is demonstrated by a supershift with an anti-His tag
antibody (Fig. 3C). As a
further test of stringency, we used a fixed amount of purified xZF1-3 protein
in the presence of decreasing amounts of competitor DNA (2-10 ng) with
labelled Hmat, Siamois, xWnt11 probes or a control duplex oligo with xTcf3-
(non-CTGCNA) binding site. As expected, lowering the amount of competitor DNA
led to increased formation of the xZF1-3/Hmat complex
(Fig. 3E). However, we did not
observe an interaction between Siamois- or xWnt11-derived sequences and xZF1-3
until the competitor was reduced to 10 ng; under these same conditions the
unrelated xTcf3 target oligo also bound
(Fig. 3E). On this basis we
conclude that the Siamois- or xWnt11-derived sequences do not represent
specific xKaiso-binding sites in vitro.
Kaiso preferentially associates with methylated CpGs rich sequences but not with CTGCNA sequences in vivo
To validate our in vitro EMSA results we performed a global analysis of
Kaiso-binding sites in human HEK293 cells that were transiently transfected
with either murine or Danio Kaiso expression plasmids. We sequenced
and mapped chromatin-derived DNA fragments that were bound by these proteins
and found a significant enrichment of CpG-rich sequences in both cases
(Fig. 4A,C). A genome-wide
analysis of DNA methylation in HEK293 cells showed that these CpG sequences
bound by Danio and murine Kaiso are also enriched in methylated CpGs
(see Fig. S5A in the supplementary material; data not shown). By contrast, our
analysis did not detect an enrichment of CTGCNA sites in the chromatin
fraction associated with mKaiso and dKaiso
(Fig. 4B,D). These data do not
exclude the possibility that mKaiso binds to a small number of
CTGCNA-containing sequences in vivo but it does suggest that CTGCNA does not
represent a general consensus sequence for mKaiso binding in vivo. The results
are in remarkable agreement with our EMSA analysis and a ChIP experiment in
which we could not detect any binding of transiently transfected dKaiso or
xKaiso at the Siamois promoter in Xenopus A6 cells
(Fig. 4F). By contrast, we
could detect promoter occupancy by both dKaiso and xKaiso at the methylated
distal promoter region of the Oct91 gene in the A6 cell line
(Fig. 4E,F). An additional
proof of the inability of xKaiso to bind the Siamois promoter in vivo comes
from luciferase reporter assays in which the xKaiso zinc fingers are fused to
the VP16 activator domain (xKaisoZFVP16). xKaisoZFVP16 cannot activate
transcription from a Siamois reporter (Fig.
4G, upper) but can activate transcription from a methylated Tex19
reporter 2.7 times (Fig. 4G,
lower). It is important to note that a VP16 fusion with the xTcf3 DNA-binding
HMG domain activated the Siamois-driven luciferase reporter 5-fold in the same
set of experiments (Fig. 4G).
These experiments support the view that xKaiso has a preference towards
methylated DNA and not for the CTGCNA sequence present in the Siamois
promoter.
|
;
Ruzov et al., 2004). In xKMO
morphants the dorsal lip was less prominent at stage 10 and by stage 12 there
was an extended open blastopore (see also
Fig. 7A). This resulted in
gastrulation delay followed by the characteristic appearance of white
apoptopic cells near the edge of the open blastopore by stage 15
(Fig. 5A, xKMO and
Fig. 7A). This gastrulation
phenotype is identical to that reported by Kim and colleagues (however, they
did not report on later stage phenotypes) with the same morpholino sequence
and dose (Kim et al., 2004)
and can be rescued by co-injection of either xKaiso, dKaiso or hKaiso mRNAs
(Fig. 5B) (A.R. and R.R.M.,
unpublished). We found at stage 14 (neurulation) that a high rate of mortality
(80%) occurred in the xKMO morphants compared with controls
(Fig. 5B), and the embryos were
developmentally arrested with, as noted before, a phenotype resembling that of
xDnmt1-depleted embryos (Ruzov et al.,
2004; Stancheva and Meehan,
2000). Embryos injected at the two-cell stage with dKaiso RNA and
xKMO increased the proportion of normally gastrulating embryos (stage 12),
from just over 10% to more than 45%. By stage 14 (neurulation) the mortality
rate was reduced to 18% compared with more than 80% for xKMO-only injected
embryos (Fig. 5A,B,
xKMO+dKaiso). The presence of dKaiso mRNA enabled nearly half of the morphants
(46%) to successfully complete gastrulation/neurulation compared with none for
the xKMO alone (Fig. 5B). By
tadpole stage, the rate of survival for dKaiso/xKMO-injected embryos was
reduced, but it is notable that a few phenotypically normal embryos could
develop even though the morpholino was still present
(Fig. 5A,B). These rescued
embryos differed in appearance from the few arrested xKMO morphants that
survived to late stages (Fig.
5A). Importantly, the rescuing capacity of dKaiso mRNA was similar
to that observed with wild-type (but not a DNA-binding mutant) hKaiso mRNA,
which binds the Sm and Hmat sequences (Fig.
5B) (Ruzov et al.,
2004). These experiments strongly suggest that the capacity to
bind CTGCNA-containing sequences is not obligatory for rescuing xKMO-injected
embryos; instead, the ability to bind methylated DNA correlates with the
capacity to rescue early developmental deficits. This observation is in line
with the proposed role of Kaiso as a transcriptional silencer in pre-MBT
embryos (Ruzov et al., 2004).
The ability of dKaiso to rescue the xKMO morphants is incompatible with a
model in which a CTGCNA-binding activity is necessary to target the repression
function of Kaiso to Wnt-signalling target genes
(Kim et al., 2004;
Park et al., 2005).
Inhibition of apoptosis in KMO embryos results in their successful gastrulation
xKMO morphants exhibit a developmental delay in closing the blastopore
relative to control morpholino injected or wild-type embryos and subsequently
die during neurulation with all the hallmarks of apoptosis
(Fig. 7A)
(Ruzov et al., 2004). We
reasoned that inhibitors of the apoptotic pathway would reduce the high rates
of lethality associated with the high-dose xKMO morphants. This would allow us
to determine whether the resulting embryos exhibit a phenotype that would be
indicative of ectopic Wnt signalling function. Incubation of wild-type embryos
with the caspase-3 inhibitor, Z-DEVD-FMK, did not interfere with normal
development (Fig. 6A). In
high-dose xKMO morphants, the presence of Z-DEVD-FMK inhibited apoptosis and
allowed up to one-third of embryos to progress through to the equivalent of
tadpole stage (St. 38) (Fig.
6A; see Fig. S6 in the supplementary material). However, even
though these embryos still underwent developmental delay, they gastrulated
successfully but exhibited a short axis phenotype at later stages with obvious
eye defects (Fig. 6A). We also
suppressed the apoptotic effect of xKaiso depletion by directly inhibiting
xp53 function by co-injecting a well-characterised xp53 morpholino (xp53MO)
(Cordenonsi et al., 2003). The
double xKMO/xp53MO morphants also underwent developmental delay but eventually
underwent blastopore closure (Fig.
6B,C). The survival rate of these double morphants was high (90%)
but none developed normally (Fig.
6C; see Fig. S6 in the supplementary material). These morphants
did not exhibit an axis duplication phenotype that might be indicative of
hyperactivation of downstream Wnt-signalling target genes
(Tao et al., 2005). More
importantly, these experiments imply that much of the phenotypic defects
associated with xKaiso depletion are associated with a general failure to
complete proper gastrulation/neurulation along with a concomitant activation
of a p53-mediated cell-death pathway.
|
|
;
Park et al., 2005). Although
xKMO embryos are delayed in gastrulation compared to wild-type embryos
(Fig. 7A), we did not observe
upregulation of Siamois and xWnt11 levels in xKMO morphants by
semi-quantitative RT-PCR (Fig.
7B). Real-time quantitative RT-PCR suggests that Siamois levels
are actually reduced by 30% in xKMO stage 10 morphants, which may reflect the
developmental lag (Fig. 7A,C).
By contrast, there were no significant differences in xWnt11 levels at the
equivalent of stage 12 (Fig.
7C). In the same sets of embryos Caspase-7 and Caspase-9 RNA
levels were increased 2.5-3.5 times in stage 10 and 12 xKMO embryos,
respectively, compared with controls, which is in line with activation of a
programmed cell-death pathway (Fig.
7C). We also used whole-mount RNA in situ analysis to compare the
expression of xWnt11 in wild-type and xKMO pre-MBT embryos. Unlike previous
reports (Kim et al., 2004), we
could not find differences in expression: the maternal xWnt11 transcript was
present at similar levels in both types of embryo
(Fig. 7D; see Fig. S7A in the
supplementary material). A control in situ with xID2, identified in a screen
for genes that are mis-expressed in KMO embryos
(Ruzov et al., 2004), confirms
that it is upregulated in xKMO morphants
(Fig. 7D; see Fig. S7B in the
supplementary material). XWnt11 expression can be induced by the
mesoderm-specific transcriptional activator Xbra
(Tada and Smith, 2000), but we
have not observed ectopic induction of Xbra in xKMO embryos, suggesting that
xKaiso depletion does not result in the direct or indirect activation of
xWnt11 (D.S.D., unpublished). We conclude that it is unlikely that xKaiso
strongly influences the expression of xWnt11 and Siamois either before the MBT
or during subsequent gastrulation.
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). This previous observation may be attributable to
differences in the stringency of the DNA-binding assays employed. However, the
evolutionary conservation of the first two Kaiso ZF domains is in step with
the experimental outcome of our DNA-binding analysis, which indicated that the
methyl-CpG binding function resides in ZF1-2. Two other Kaiso-like proteins
(ZBTB4 and ZBTB38) in mice also have a strong methyl-CpG-binding function, but
only ZBTB4 has a weak affinity for the Hmat sequence, whereas ZBTB38 does not
(Filion et al., 2006). Based
on this, we come to a broad conclusion that the primary DNA-binding activity
of all members of the Kaiso-like family (Kaiso, ZBTB4 and ZBTB38) is for
methyl-CpGs, which can act as ligands in chromatin for the transcription
repression function associated with these proteins
(Filion et al., 2006;
Prokhortchouk et al., 2001;
Ruzov et al., 2004). Our
global analysis of Kaiso-binding sites in HEK293 cells also supports the view
that they are associated with methylated CpGs and not CTGCNA sites. In
addition it has recently been shown that Kaiso represses methylated tumour
suppressor genes and can bind in a methylation-dependent manner to the CDKN2A
gene in human colon cancer cell lines
(Lopes et al., 2008).
The DNA-binding ability of Kaiso is primarily dependent on its three zinc
fingers (ZF1-3), which belong to the C2H2 class. It has been proposed that
each ZF can be regarded as an independent DNA-binding module, and an
additional ZF in an array specifies three base pairs of adjacent, but
discrete, subsites (Choo and Klug,
1997). This would predict a 9 bp binding site for Kaiso if each ZF
bound equally to its respective subsite. An inference of the requirement for
all three ZFs to bind Hmat is that its true recognition sequence may
correspond to a 9 bp sequence and not 6 bp as previously reported
(Daniel et al., 2002). The
requirement for ZF1-2 for binding to the Sm oligo is consistent with a minimum
recognition sequence of 6 bp that contains two methyl-CpGs
(Prokhortchouk et al., 2001).
Comparison of the three CTGCNA substrates used (Hmat, Siamois and xWnt11)
shows that they are flanked by distinct sequences that probably account for
their differential binding to gKaiso and xKaiso. Notably, like xKaiso, gKaiso
cannot bind the CTGCNA-containing sequences in the xWnt11 and Siamois promoter
regions (Fig. 3) despite its
high affinity for Hmat. This suggests that the non-methylated binding ability
of gKaiso is restricted to one or a few unique sequences that have yet to be
identified. Our analysis suggests that CTGCNA sequences in the promoters of
Siamois and xWnt11 are not high-affinity Kaiso-binding sites, which would be
incompatible with the proposed role of xKaiso as a direct repressor of these
genes (Park et al., 2005).
We also show, that like its amphibian counterpart, dKaiso is essential for
early zebrafish development. The phenotypes of dKMO-injected embryos, the
percentages of abnormal embryos and the developmental stages in which these
embryonic defects are detected resemble those of xKMO-injected
Xenopus embryos (Ruzov et al.,
2004). In our previous study we showed that xKaiso is required for
genome-wide transcription silencing in embryos before the MBT. In zebrafish
the MBT begins at cycle 10 and, as in amphibians, is characterised by
cell-cycle lengthening, loss of cell synchrony, appearance of cell motility
and activation of transcription (Kane and
Kimmel, 1993). Noting the similarity of the Danio rerio
and Xenopus Kaiso loss-of-function phenotypes, we can hypothesise
that in both cases mis-regulation of similar mechanisms leads to close
phenotypic abnormalities. Another conclusion from the comparison of zebrafish
and Xenopus KMO embryos and from the dKaiso ability to rescue the
xKMO phenotype, is that the main phenotypical features of xKMO-injected
embryos are not dependent on CTGCNA-binding ability, which is not conserved
between zebrafish and Xenopus. The observation that mice do not have
an extended period of transcriptional silencing during early development may
partly explain the absence of an embryonic lethal phenotype in Kaiso null mice
(Prokhortchouk et al., 2006).
These mutant mice also do not exhibit mis-regulation of candidate target genes
such as Wnt11.
In parallel with the mouse study, we did not observe the reported
mis-regulation of the Wnt signalling pathway in xKMO stage 8 or stage 10
morphants. Indeed, inhibition of the cell death pathway in xKMO morphants by
incubation with apoptotic inhibitors does not uncover any gross axis
duplication phenotypes, which is also indicative that β-catenin
signalling is not ectopically activated under these conditions. A potential
role for xKaiso in Wnt signalling was initially suggested by non-physiological
experiments in which xKaiso and Wnt-signalling components are overexpressed.
This is probably mediated by Kaiso/TCF3 interactions and not via
CTGCNA-binding sites (Kim et al.,
2004; Park et al.,
2005; Ruzov et al.,
2009). In a companion paper, we demonstrate that xKaiso interacts
directly with TCF3/4 and thereby masks their HMG DNA-binding domains
(Ruzov et al., 2009). As a
result, overexpression of xKaiso inhibits the ability of β-catenin to
mediate transcription activation through xTcf3 by displacing it from a target
promoter. This mode of action can account for the inhibition of dorsal axis
formation when Kaiso mRNA is co-injected with β-catenin mRNA into the
ventral marginal region of four-cell-stage embryos
(Park et al., 2005).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/5/729/DC1
|
Footnotes |
|---|
* These authors contributed equally to this work 
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Allen, M. D., Grummitt, C. G., Hilcenko, C., Min, S. Y., Tonkin,
L. M., Johnson, C. M., Freund, S. M., Bycroft, M. and Warren, A. J.
(2006). Solution structure of the nonmethyl-CpG-binding CXXC
domain of the leukaemia-associated MLL histone methyltransferase.
EMBO J. 25,4503
-4512.[CrossRef][Medline]
Brannon, M., Gomperts, M., Sumoy, L., Moon, R. T. and Kimelman,
D. (1997). A beta-catenin/XTcf-3 complex binds to the siamois
promoter to regulate dorsal axis specification in Xenopus. Genes
Dev. 11,2359
-2370.
Cazalla, D., Sanford, J. R. and Caceres, J. F.
(2005). A rapid and efficient protocol to purify biologically
active recombinant proteins from mammalian cells. Protein Expr.
Purif. 42,54
-58.[CrossRef][Medline]
Choo, Y. and Klug, A. (1997). Physical basis of
a protein-DNA recognition code. Curr. Opin. Struct.
Biol. 7,117
-125.[CrossRef][Medline]
Cordenonsi, M., Dupont, S., Maretto, S., Insinga, A., Imbriano,
C. and Piccolo, S. (2003). Links between tumor suppressors:
p53 is required for TGF-beta gene responses by cooperating with Smads.
Cell 113,301
-314.[CrossRef][Medline]
Daniel, J. M. and Reynolds, A. B. (1999). The
catenin p120(ctn) interacts with Kaiso, a novel BTB/POZ domain zinc finger
transcription factor. Mol. Cell. Biol.
19,3614
-3623.
Daniel, J. M., Spring, C. M., Crawford, H. C., Reynolds, A. B.
and Baig, A. (2002). The p120(ctn)-binding partner Kaiso is a
bi-modal DNA-binding protein that recognizes both a sequence-specific
consensus and methylated CpG dinucleotides. Nucleic Acids
Res. 30,2911
-2919.
Detrich, H. W., 3rd, Westerfield, M. and Zon, L. I.
(1999). Overview of the Zebrafish system. Methods Cell
Biol. 59,3
-10.[Medline]
Dunican, D. S., Ruzov, A., Hackett, J. A. and Meehan, R. R.
(2008). xDnmt1 regulates transcriptional silencing in pre-MBT
Xenopus embryos independently of its catalytic function.
Development 135,1295
-1302.
Filion, G. J., Zhenilo, S., Salozhin, S., Yamada, D.,
Prokhortchouk, E. and Defossez, P. A. (2006). A family of
human zinc finger proteins that bind methylated DNA and repress transcription.
Mol. Cell. Biol. 26,169
-181.
Hauptmann, G. and Gerster, T. (1994). Two-color
whole-mount in situ hybridization to vertebrate and Drosophila embryos.
Trends Genet. 10,266
.[CrossRef][Medline]
Houston, D. W., Kofron, M., Resnik, E., Langland, R., Destree,
O., Wylie, C. and Heasman, J. (2002). Repression of organizer
genes in dorsal and ventral Xenopus cells mediated by maternal XTcf3.
Development 129,4015
-4025.
Kane, D. A. and Kimmel, C. B. (1993). The
zebrafish midblastula transition. Development
119,447
-456.[Abstract]
Kim, S. W., Park, J. I., Spring, C. M., Sater, A. K., Ji, H.,
Otchere, A. A., Daniel, J. M. and McCrea, P. D. (2004).
Non-canonical Wnt signals are modulated by the Kaiso transcriptional repressor
and p120-catenin. Nat. Cell Biol.
6,1212
-1220.[CrossRef][Medline]
Liu, K. J. and Harland, R. M. (2003). Cloning
and characterization of Xenopus Id4 reveals differing roles for Id genes.
Dev. Biol. 264,339
-351.[CrossRef][Medline]
Lopes, E. C., Valls, E., Figueroa, M. E., Mazur, A., Meng, F.
G., Chiosis, G., Laird, P. W., Schreiber-Agus, N., Greally, J. M.,
Prokhortchouk, E. et al. (2008). Kaiso contributes to DNA
methylation-dependent silencing of tumor suppressor genes in colon cancer cell
lines. Cancer Res. 68,7258
-7263.
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Park, J. I., Kim, S. W., Lyons, J. P., Ji, H., Nguyen, T. T.,
Cho, K., Barton, M. C., Deroo, T., Vleminckx, K., Moon, R. T. et al.
(2005). Kaiso/p120-catenin and TCF/beta-catenin complexes
coordinately regulate canonical Wnt gene targets. Dev.
Cell 8,843
-854.[CrossRef][Medline]
Prokhortchouk, A., Hendrich, B., Jorgensen, H., Ruzov, A., Wilm,
M., Georgiev, G., Bird, A. and Prokhortchouk, E. (2001). The
p120 catenin partner Kaiso is a DNA methylation-dependent transcriptional
repressor. Genes Dev.
15,1613
-1618.
Prokhortchouk, A., Sansom, O., Selfridge, J., Caballero, I. M.,
Salozhin, S., Aithozhina, D., Cerchietti, L., Meng, F. G., Augenlicht, L. H.,
Mariadason, J. M. et al. (2006). Kaiso-deficient mice show
resistance to intestinal cancer. Mol. Cell. Biol.
26,199
-208.
Rai, K., Nadauld, L. D., Chidester, S., Manos, E. J., James, S.
R., Karpf, A. R., Cairns, B. R. and Jones, D. A. (2006).
Zebra fish Dnmt1 and Suv39h1 regulate organ-specific terminal differentiation
during development. Mol. Cell. Biol.
26,7077
-7085.
Rauch, T. and Pfeifer, G. P. (2005).
Methylated-CpG island recovery assay: a new technique for the rapid detection
of methylated-CpG islands in cancer. Lab. Invest.
9,1172
-1180.
Ruzov, A., Dunican, D. S., Prokhortchouk, A., Pennings, S.,
Stancheva, I., Prokhortchouk, E. and Meehan, R. R. (2004).
Kaiso is a genome-wide repressor of transcription that is essential for
amphibian development. Development
131,6185
-6194.
Ruzov, A., Hackett, J. A., Prokhortchouk, A., Reddington, J. P.,
Madej, M. J., Dunican, D. S., Prokhortchouk, E., Pennings, S. and Meehan, R.
R. (2009). The interaction of xKaiso with xTcf3: a revised
model for integration of epigenetic and Wnt signalling pathways.
Development 136,723
-727.
Stancheva, I. and Meehan, R. R. (2000).
Transient depletion of xDnmt1 leads to premature gene activation in Xenopus
embryos. Genes Dev. 14,313
-327.
Tada, M. and Smith, J. C. (2000). Xwnt11 is a
target of Xenopus Brachyury: regulation of gastrulation movements via
Dishevelled, but not through the canonical Wnt pathway.
Development 127,2227
-2238.[Abstract]
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D.,
Asashima, M., Wylie, C. C., Lin, X. and Heasman, J. (2005).
Maternal wnt11 activates the canonical wnt signaling pathway required for axis
formation in Xenopus embryos. Cell
120,857
-871.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
This article has been cited by other articles:
|
|
 |
|
  P. D. McCrea, D. Gu, and M. S. Balda Junctional Music that the Nucleus Hears: Cell-Cell Contact Signaling and the Modulation of Gene Activity Cold Spring Harb Perspect Biol, October 1, 2009; 1(4): a002923 - a002923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ruzov, J. A. Hackett, A. Prokhortchouk, J. P. Reddington, M. J. Madej, D. S. Dunican, E. Prokhortchouk, S. Pennings, and R. R. Meehan The interaction of xKaiso with xTcf3: a revised model for integration of epigenetic and Wnt signalling pathways Development, March 1, 2009; 136(5): 723 - 727. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
