|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 28 January 2009
doi: 10.1242/dev.027805
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Medicine, Children's Hospital Boston and Department of
Pediatrics, Harvard Medical School, Boston, MA 02115, USA, and Harvard Stem
Cell Institute, Cambridge, MA 02138, USA.
2 Renal Division, Washington University School of Medicine, St Louis, MO 63110,
USA.
3 Center for Cell and Developmental Biology, The Research Institute at
Nationwide Children's Hospital, 700 Children's Drive, Columbus, OH 43205,
USA.
4 Cardiovascular Research Institute, University of California San Francisco, 513
Parnassus Avenue, HSE-201 San Francisco, CA 94143-0130, USA.
¶ Author for correspondence (e-mail: Jordan.Kreidberg{at}childrens.harvard.edu)
Accepted 18 December 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
3β1 integrin, a major laminin receptor involved
in the development of the kidney, and c-Met, the receptor for hepatocyte
growth factor, signal coordinately to regulate the expression of
Wnt7b in the mouse. Wnt signals in turn appear to regulate epithelial
cell survival in the papilla of the developing kidney, allowing for the
elongation of epithelial tubules to form a mature papilla. Together, these
results demonstrate how signals from integrins and growth factor receptors can
be integrated to regulate the expression of an important family of signaling
molecules so as to regulate morphogenetic events.
Key words: Integrins, Signal transduction, Wnt genes, Receptor tyrosine kinase
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
From the very first stages of embryogenesis, cells establish interactions with
the ECM that are essential for proper differentiation and tissue organization
(Hogan, 1999;
Hynes, 1999). Upon interaction
with the ECM, integrin-mediated signal transduction elicits behavioral
responses that include cell proliferation, survival and differentiation, and
migration (Boudreau and Bissell,
1998; Giancotti and Ruoslahti,
1999; Howe et al.,
1998; Huang and Ingber,
1999; Miranti and Brugge,
2002; Ruoslahti,
1999; Schwartz and Baron,
1999). Integrins signal through multiple biochemical pathways;
however, there is limited information relating distinct pathways to specific
biological processes in tissues and organs. Nevertheless, genetic studies have
demonstrated the importance of integrin-mediated signaling during the
development of invertebrates and mammals (for a review, see
Danen and Sonnenberg, 2003).
For example, in nematodes and flies, integrin-mediated cell adhesion and
signaling can regulate development of the muscular system, central nervous
system and gut (for a review, see Hynes
and Zhao, 2000). Similarly, integrin-mediated signaling can
regulate organ development in mammals. In mice, inactivation of the β1
integrin gene, which eliminates expression of the entire class of β1
integrins, results in very early embryonic lethality
(Fassler et al., 1996;
Fassler and Meyer, 1995;
Stephens et al., 1995).
Furthermore, mutation of distinct subunits that heterodimerize with
β1 has provided information about the function of different integrin
heterodimers in development. For example, loss of 5β1 integrin
(Goh et al., 1997;
Taverna et al., 1998;
Yang et al., 1993), or of
4β1 integrin (Yang et al.,
1995), leads to mesodermal or to placental and cardiac defects,
respectively. The 6-containing integrins 6β1 and
6β4 have been found to play important roles in development of the
skin and nervous system (Georges-Labouesse
et al., 1998;
Georges-Labouesse et al.,
1996; Gorski and Olsen,
1998), whereas 1β1- and 2β1-deficient mice
show no apparent developmental defects. Mutation of the 3 integrin gene
leads to defects in development of the kidney, skin, brain and salivary glands
(Anton et al., 1999;
DiPersio et al., 1997;
Kreidberg et al., 1996;
Menko et al., 2001).
Wnts are secreted signaling molecules that have been implicated in a wide
array of biological processes including morphogenesis, cell proliferation,
survival and tumorigenesis (Wodarz and
Nusse, 1998). In the developing kidney, Wnt9b is expressed in the
ureteric bud and is essential for inducing the metanephric mesenchyme to form
nephrons (Carroll et al.,
2005). Wnt4, which is expressed in the pretubular aggregates, is
required for the mesenchymal-to-epithelial transformation of these aggregates
into the simple tubules that develop into nephrons
(Kispert et al., 1998;
Stark et al., 1994). Wnt11 is
expressed at the tip of the ureteric buds, where it appears to have a role in
modulating branching morphogenesis of the derivatives of the ureteric bud
(Kispert et al., 1996;
Majumdar et al., 2003). Wnt7b
is expressed in ureteric bud stalks and collecting ducts
(Kispert et al., 1996). Mice
deficient in Wnt7b have lung hemorrhages caused by vascular smooth muscle
defects, and lung hypoplasia resulting from impaired branching morphogenesis,
mesenchyme proliferation and epithelial differentiation
(Shu et al., 2002), but the
Wnt7b kidney phenotype is unreported.
3β1 integrin has been best characterized as a receptor for
certain isoforms of laminin, including laminin 5, 10 and 11. Our recent work
(Chattopadhyay et al., 2003)
also ascribes a role for 3β1 integrin in cell-cell interaction as
a component of the E-cadherin adhesion complex. In 3β1-deficient
mice, several abnormalities of epithelial development are evident, including
malformation of the papilla in the developing kidney
(Kreidberg et al., 1996). The
papilla is a cone-shaped collection of densely packed epithelial tubules that
includes collecting ducts and loops of Henle. Although its formation is not
completely understood, it clearly involves several rounds of branching
morphogenesis, followed by tubular extension, differentiation and tissue
remodeling (Cebrian et al.,
2004; Osathanondh and Potter,
1963). In 3β1 integrin-deficient kidneys, although
differentiated collecting ducts are present, the papilla is much smaller and
does not extend out as a projection from the main body of the kidney. These
observations suggest that 3β1 integrin might be involved in
regulating the patterning that results in the formation of the mature
papilla.
In our previous study we observed increased levels of β-catenin in the
presence of 3β1 integrin
(Chattopadhyay et al., 2003).
Although higher levels of β-catenin might be a consequence of
3β1 integrin stimulation of cadherin-mediated cell-cell adhesion,
it is also possible that higher levels of β-catenin might reflect
increased Wnt signaling through the canonical Wnt pathway. Here we report that
3β1 integrin, acting in coordination with the hepatocyte growth
factor (Hgf) receptor c-Met (also known as Met), regulates expression of two
of the three Wnt7b transcripts expressed in the developing papilla.
Furthermore, the expression of Wnt7b appears to regulate cell
survival. Thus, these results demonstrate how integrin-receptor tyrosine
kinase complexes may regulate the expression of signaling molecules involved
in pattern formation during development.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
3 integrin antibody (Invitrogen, Carlsbad, USA), anti-PI3K
antibody (4292, Cell Signaling), anti-phospho PI3K p85(Thr458)/p55(Thr199)
antibody (Cell Signaling), anti-phospho-AKT (Thr308) antibody (9275, Cell
Signaling), ImmunoPure immobilized Protein G (20398, Pierce), ImmunoPure
immobilized Protein A (20333, Pierce), protease-free BSA (A3059, Sigma),
anti-phosphotyrosine antibody 4G10 (05-321, Upstate Biotech, Lake Placid,
USA), ApopTag Plus Fluorescein In Situ Apoptosis Detection Kit (S7111,
Chemicon, Temecula, USA), Lipofectamine reagent (11668-019, Invitrogen) and
DMEM/F12 media (10-092-CV, Cellgro). Axin, Fz8CRD and Dkk1 plasmid expression constructs and a control construct expressing only the Fc region of the Fz8CRD construct were obtained from Xi He (Children's Hospital, Boston, MA, USA).
Conditional allele of the 3 integrin gene
A vector to target a conditional mutation to the 3 integrin gene was
constructed using the pDELBOY vector. LoxP sites flank exon 3, and a
Frt-NeoR-Frt cassette was placed downstream of exon 2 (see Fig. S1 in the
supplementary material). Deletion of exon 3 creates translational termination
codons in exon 4. After homologous recombination in embryonic stem cells and
derivation of mice containing this allele, the Frt-NeoR-Frt cassette was
excised by mating these mice with mice expressing FlpE in the germ line
(obtained from Dr Susan Dymecki, Harvard Medical School, Boston, MA, USA).
This left a single Frt site between exon 2 and the loxP site upstream of exon
3. Further details of the construction and genotyping are available upon
request. For conditional mutation of the 3 integrin gene, mice were
mated with HoxB7-Cre/GFP mice (Zhao et
al., 2004).
Laminin mutant mice
Lama5-null mice have been described
(Miner and Li, 2000).
Cell culture
Generation and maintenance of wild-type (WT), 3 integrin knockout
(KO), 3 and 6 integrin stalk and laminin binding mutant cells
have been described previously
(Chattopadhyay et al., 2003;
Wang et al., 1999). For the
present studies, WT and KO cells were generated a second time from E18
papillae of mice carrying a temperature-sensitive T-antigen and the results
obtained with the previously and newly developed cell lines were identical.
Cells were routinely cultured on Matrigel-coated plates (Becton Dickinson).
Hgf stimulation experiments involved a 16-hour incubation in serum-free medium
followed by the addition of medium containing 50 ng/ml Hgf. To study the
effect of the Hgf-neutralizing antibody with cell lines, WT cells were treated
either with 10 µg/ml Hgf-neutralizing antibody or 10 µg/ml
IGF-neutralizing antibody (as control) for 12 hours. To study the effect of
Wnt3a, HEK293T cells were transfected with plasmids expressing the Wnt
inhibitors Fz8CRD (or control IgG) or Dkk1 using Lipofectamine (Invitrogen)
and incubated for 24 hours. After 16 hours, the medium was collected and
replaced with fresh DMEM/F12. After an additional 36 hours incubation, the
conditioned medium was collected, centrifuged, and used to incubate kidney
papillae for 24 hours (or to treat cells in the experiments shown in the
supplementary figures).
Organ culture
To analyze apoptosis in organ cultures, kidney papillae were isolated from
E18.5 mouse embryos using fine-needle microdissection to remove the papilla
from the cortex and outer medulla. The kidney papillae were then kept under
standard organ culture conditions on Nuclepore membranes for 24 hours in
DMEM/10% FCS in the presence of inhibitors or activators as described. The
preparation of Wnt- or inhibitor-conditioned medium was as described above. To
study the effect of Hgf, kidney papillae were treated for 24 hours in the
presence of 20 µg/ml Hgf-neutralizing antibody or IGF-neutralizing antibody
or 50 ng/ml Hgf prior to fixation. After 24 hours in culture, the kidneys were
snap frozen in OCT (Sakura, Torrance, USA) to provide frozen sections for
TUNEL and DAPI staining.
Wnt reporter staining
Mice carrying a Tcf/β-catenin-responsive luciferase reporter were
obtained from Dr Benjamin Allman (University of Toronto, Ontario, Canada).
Frozen sections were stained for β-galactosidase expression as described
(Sanes et al., 1986).
RT-PCR
Specific isoforms of Wnt7b were measured using semi-quantitative
RT-PCR, as the PCR reactions required to define specific transcripts result in
PCR products that are too long for use in real-time PCR assays. Cycle number
for each reaction was minimized to assure that amplification was in the linear
range for each assay. Total RNA was isolated from cells as described
(Chomczynski and Sacchi, 1987).
Seven micrograms of total RNA was used for the reverse transcription reaction
using the Superscript III First-Strand cDNA Synthesis Kit (Invitrogen). The
resulting cDNA was subjected to PCR using the following primers (shown
5' to 3'). For Wnt7b, AAGCACCCACGTAGGTAACG (primer i),
AAACCAAGTGACCACCAAGC (ii), AGGTGTCTCTTTGGAGCCG (iii), TCTATTGCCCGCAGATCTTT
(iv), GCGACAGGAGGAGCATACTT (v), CTTCACGTAGAGGACGCCAA (vi),
CTCTCGACTCCCTACTCGGA (vii); and for Wnt4, GGCGTAGCCTTCTCACAGTC and
AGCACGTCTTTACCTCGCAG. PCR products were cloned using the PCR-II-TOPO Cloning
Kit (Invitrogen) and sequenced before preparing in situ hybridization
probes.
Quantitative PCR
Quantitative PCR to detect all Wnt7b transcripts was performed
using a Cephiad Smart Cycler II. Primers (shown 5' to 3') were:
forward, TTTGGCGTCCTCTACGTGAAG and reverse, CCCGACTCCCCACTTTGAG. Cycles:
94°C for 30 seconds; 40 cycles of 94°C for 15 seconds, 58°C for 30
seconds, 72°C for 30 seconds; a final 72°C for 120 seconds. All
reactions were validated by examining a melt curve for a single peak between
58°C and 95°C. Results were normalized to 18S rRNA.
In situ hybridization
Mouse kidneys were fixed in 4% PFA overnight and cryopreserved in 30%
sucrose. Kidneys were then fixed in OCT and sectioned. Frozen kidney sections
(10 µm) were refixed in 4% PFA and treated with 15 µg/ml proteinase K.
After refixing and acetylation, sections were hybridized with 500 ng/ml
digoxigenin-labeled probes (sense and antisense) in 1.3x SSC buffer.
Sections were then washed extensively, blocked in sheep serum and reacted with
alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche). The signals
were detected using BM Purple alkaline phosphatase substrate.
|
For the c-Met phosphorylation assay, cells were incubated in 1 mM sodium orthovanadate for 30 minutes, washed with ice-cold PBS and lysed. All the buffers used for cell lysis contained 2 mM sodium orthovanadate. Cellular protein (100 mg) was subjected to immunoprecipitation with anti-c-Met antibody and Protein G-agarose. The immunoprecipitate was separated on a 7.5% SDS-PAGE gel and transferred to nitrocellulose membranes. The membranes were blocked with 5% protease-free BSA, and then probed with an anti-phosphotyrosine antibody (4G10).
To reprobe the blot, the membrane was stripped using 62.5 mM Tris-HCl pH 6.7, 2% SDS, 0.7% β-mercaptoethanol, then reblocked and probed with specific antibody.
TUNEL assay
The fluorescent TUNEL assay was used to determine apoptosis in cells,
following the manufacturer's protocol (Chemicon).
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
3β1 integrin-dependent Wnt signaling in mouse kidney epithelial cells), without
the need for any additional branching within the papilla during subsequent
development of the kidney. Rather, the enlargement of the papilla is due to
tubular elongation (Cebrian et al.,
2004), maturation of the epithelia in collecting ducts that
involves significant apical-basal lengthening, and the penetration of loops of
Henle from nephrons located in the cortex down into the medulla and
papilla.
At E15.5, wild-type (WT) and 3 integrin mutant (KO) embryonic
kidneys were indistinguishable with regard to branching morphogenesis
(Fig. 1A,B). However, by E18.5,
there was a marked difference between the WT and KO kidneys, primarily
reflected in the failure of papillary outgrowth
(Fig. 1C,D). The failure of
papillary outgrowth was completely penetrant and observed in all 3
integrin KO kidneys examined (n>6).
The malformation of the papilla in 3β1 integrin-deficient
embryonic kidneys may relate to the role of this integrin as a laminin
receptor (Elices et al.,
1991), or to its recently described role in the E-cadherin
cell-cell adhesion complex (Chattopadhyay
et al., 2003). Genetic tools are not presently available to test
the role of 3β1 integrin in cell-cell adhesion in vivo. However,
it is possible to examine papillary development in embryonic kidneys from mice
carrying a mutation in the 5 laminin gene (Lama5), 5
being the subunit of laminin 10 that contains the 3β1 integrin
binding site (Kikkawa et al.,
1998). Similar to kidneys of 3 integrin KO embryos, kidneys
of 5 laminin-null mutant embryos
(Miner and Li, 2000) also had
malformed papillae at E16.5 (Fig.
1B); these embryos did not survive to E18.5. Although these
results do not exclude a role for 3β1 integrin stimulation of
E-cadherin-mediated cell-cell adhesion in formation of the papilla, they do
support the possibility that the integrin-laminin interaction is required for
normal papillary development.
|
3β1 integrin-deficient kidneys
(Kreidberg et al., 1996).
Glomeruli are also highly abnormal, raising the question of whether the
papillary phenotype could be secondary to glomerular dysfunction, which could
expose the tubules of the developing papillae to a protein-rich filtrate that
affects its development. To exclude this possibility, we used the
HoxB7-Cre/GFP mouse (Zhao et al.,
2004) to conditionally delete the 3 integrin gene in the
derivatives of the ureteric bud, which include the collecting duct epithelia
of the papilla (see Fig. S1 in the supplementary material). Although variable
in phenotype, some neonatal and adult conditional mutant mice were observed in
which the kidney papillae were largely absent, and the majority of
conditionally mutant kidneys had abnormal papillae
(Fig. 1C,
Table 1). For those conditional
mutant kidneys in which some degree of papillary formation occurred, this
might be due to non-cell-autonomous rescue of 3β1
integrin-deficient cells by Wnt7b expression (see below) from cells that
retained expression of 3β1 integrin.
|
3β1 integrin
(Chattopadhyay et al., 2003).
To examine whether this might reflect an increase in signaling through the
canonical Wnt pathway, the TOPFLASH vector containing a luciferase reporter
gene under control of a Tcf/β-catenin-responsive promoter was transfected
into immortalized WT and 3β1 integrin-deficient (KO) collecting
duct epithelial cell lines (Chattopadhyay
et al., 2003; Wang et al.,
1999). Luciferase activity was several fold higher in WT than in
KO cells or in cells expressing a mutant form of the 3 subunit that is
unable to bind laminin (Zhang et al.,
2003). The elevated luciferase activity in WT cells was sensitive
to Wnt signaling blockade with Dkk1, Fz8CRD (a truncated form of frizzled 8
that contains only the Wnt-association domain) or Axin (see Fig. S2A,B in the
supplementary material).
In our previous study we demonstrated that an interaction of the 3
integrin subunit `stalk' domain with the tetraspanin Cd151 was required to
stimulate E-cadherin-mediated cell-cell interaction
(Chattopadhyay et al., 2003).
However, TOPFLASH luciferase activity was not affected by the interaction of
3β1 integrin with Cd151 (see Fig. S2A in the supplementary
material). We then examined whether Wnt/β-catenin activity was affected
in the absence of 3β1 integrin in vivo, utilizing embryos
containing a Tcf-responsive lacZ transgene
(Cheon et al., 2002) that were
homozygous for the 3 integrin-null allele. Abundant
β-galactosidase expression was observed in collecting ducts of papillae
from WT E17.5 embryos (WT/Tcf-lacZ in
Fig. 2), whereas greatly
diminished β-galactosidase staining was apparent in the collecting ducts
of KO papillae (KO/Tcf-lacZ in
Fig. 2). Thus, canonical Wnt
signaling, as reflected by β-catenin levels, indeed appeared to be
decreased in the absence of 3β1 integrin and dependent on the
interaction with laminin. That higher levels of Wnt signaling could be
observed in both cell lines and in vivo in the presence of 3β1
integrin suggested that it might be a cell-autonomous feature of
3β1-expressing cells, rather than being due to a heterotypic
interaction between the epithelial tubules and the adjacent stroma, which is
known to express additional Wnt genes
(Itaranta et al., 2006). This
hypothesis was supported by additional in vitro experiments in which TOPFLASH
activity was rescued in KO cells that were exposed to conditioned media from
WT cells; this rescue could be blocked by addition of the Wnt blockers Dkk1 or
Fz8CRD (see Fig. S3A,B in the supplementary material).
Differential regulation of Wnt7b expression by 3β1 integrin
Our studies then focused on Wnt7b, which is known to be expressed
in the derivatives of the ureteric bud
(Kispert et al., 1996) that
form the epithelia of the papilla. Wnt7b expression was decreased
several fold in 3 integrin KO cells or in a cell line expressing the
laminin binding mutant of the 3 integrin subunit
(Zhang et al., 2003) in place
of the wild-type subunit, and also in papillae of both 3 integrin KO
kidneys and laminin 5 mutant kidneys
(Fig. 3A). Three mammalian
Wnt7b transcripts are described in the Ensembl database and in recent
publications (Rajagopal et al.,
2008): RTH, MHR and MLL (here designated by the first three amino
acids of the putative peptides). RTH and MHR [recently published as Wnt7b-1
(Rajagopal et al., 2008)]
share a common first exon, although the transcription start site of the RTH
mRNA has been reported to be upstream of the MHR mRNA. Additionally, the
predicted peptide from this first exon differs between the RTH and MHR
isoforms owing to the use of different splice donor sites at the end of exon 2
that require the use of different translational start sites in exon 1 to
maintain an open reading frame through exon 4. The third isoform, MLL
[recently published as Wnt7b-2 (Rajagopal
et al., 2008)], is encoded by an entirely different first exon
from the other two isoforms, but shares common exons 2, 3 and 4 with RTH and
MHR, and the same reading frame as MHR beginning in exon 2
(Fig. 3B).
|
|
100 bp upstream of the MHR transcript.
3β1 integrin-dependent expression was observed for the RTH and MLL
isoforms, whereas the level of MHR transcript did not appear to differ between
the WT and 3 integrin KO kidney papillae. There was a similar pattern
of decreased Wnt7b isoform expression in kidneys of 5
laminin-mutant embryos (Fig.
3D).
In situ hybridization confirmed the 3β1 integrin-dependent
expression of the Wnt7b transcripts in the developing papillae. The
MLL transcript of Wnt7b was less abundant in
3β1-deficient kidney papillae, and a probe recognizing both RTH
and MHR mRNAs also demonstrated decreased expression in the absence of
3β1 integrin (Fig.
3E). These results indicate that 3β1 integrin
differentially regulates the expression of Wnt7b isoforms in the
developing kidney.
The expression of a second Wnt gene expressed in the papilla, Wnt4
(Itaranta et al., 2006), was
also examined. When assessed by RT-PCR or in situ hybridization
(Fig. 4), Wnt4
expression also appeared to be decreased in the absence of 3β1
integrin.
Coordinate signaling between 3β1 integrin and a receptor tyrosine kinase
Integrins and growth factor receptors signal coordinately to integrate
signaling by soluble growth factors and the ECM. In some instances, a physical
association between integrins and growth factor receptors has been identified
(Comoglio et al., 2003;
Eliceiri, 2001). Therefore, we
investigated whether 3β1 integrin interacts with a growth factor
receptor to stimulate Wnt gene expression and thus regulate kidney
morphogenesis. Among the growth factor receptors known to be expressed in the
developing kidney and to potentially regulate branching morphogenesis, the Hgf
receptor c-Met was detected in immortalized collecting duct epithelial cell
lines by western blotting irrespective of the presence or absence of
3β1 integrin (Fig.
5Aa). Two other related growth factor receptors, c-Ret and c-Ron
(Mst1r - Mouse Genome Informatics), were not present in these cells (not
shown). Although Hgf has been reported to induce branching morphogenesis in
vitro with MDCK cells (Jeffers et al.,
1996; Montesano et al.,
1991; Stoker et al.,
1987; Zhang and Vande Woude,
2003), no kidney defects were reported in c-Met or
Hgf mutant kidneys (Birchmeier and
Gherardi, 1998; Schmidt et
al., 1995; Uehara et al.,
1995). However, c-Met- and Hgf-deficient embryos die of hepatic
failure prior to the time when defects are observed in 3β1
integrin-deficient kidneys, potentially obscuring later defects in kidney
development owing to the absence of c-Met or Hgf. It was possible to
co-immunoprecipitate 3β1 integrin and c-Met, indicating that there
may indeed be coordinate signaling by these receptors
(Fig. 5Ab,c).
A previous study has demonstrated a requirement for 3β1
integrin and its associated tetraspanin CD151 for activation of c-MET in cells
derived from human salivary gland carcinomas
(Klosek et al., 2005). As a
first determination of whether 3β1 integrin has a modulatory
effect on signaling by c-Met that could relate to the 3 integrin mutant
kidney phenotype, tyrosine phosphorylation of c-Met in response to Hgf was
examined in WT and 3β1-deficient (KO) cells. Hgf treatment induced
higher levels of tyrosine phosphorylation of several proteins in WT cells as
compared with KO cells (Fig.
5B). Moreover, a c-Met immunoprecipitate, blotted with
anti-phosphotyrosine, also detected increased tyrosine phosphorylation and
additional bands not present in KO cells
(Fig. 5B), suggesting that
multi-molecular complexes that are assembled upon activation of c-Met are
dependent on the presence of 3β1 integrin.
In many cell types, c-Met has been found to signal through a complex that
includes Gab1, which recruits phosphatidyl inositol-3-kinase (PI3K; Pik3) and
signals to activate AKT (Akt1) (reviewed by
Vivanco and Sawyers, 2002). To
determine whether 3β1 integrin augmented signaling through PI3K
and AKT, we studied the association of Gab1 and PI3K with the
c-Met-3β1 complex. Gab1 (Fig.
5C) and PI3K (Fig.
5B) could be co-immunoprecipitated with c-Met only in the presence
of 3β1 integrin. Gab1 could also be directly immunoprecipitated
with 3β1 integrin (Fig.
5D), demonstrating that the association of Gab1 with c-Met does
not occur in a complex that is distinct from that containing 3β1
and c-Met.
Activation of PI3K leads to phosphorylation of AKT, which results in the
activation or deactivation of diverse biological responses
(Vivanco and Sawyers, 2002). A
similar amount of AKT was present in WT and KO cells
(Fig. 5Ea), but AKT was more
highly phosphorylated at the threonine 308 residue in response to Hgf in WT
cells (Fig. 5Eb). Together,
these results suggest that signaling through the c-Met/PI3K/AKT pathway is
dependent on an interaction with 3β1 integrin.
|
3β1 and c-Met
regulates the expression of Wnt genes in the papilla, WT cells were treated
with a Hgf-neutralizing antibody. This completely blocked the expression of
the RTH, MHR and MLL Wnt7b isoforms, as detected by RT-PCR
(Fig. 6A). By contrast, a
similarly prepared neutralizing antibody that blocks Igf1 function had no
effect on the expression of these Wnt7b mRNAs. The discrepancy
between the effect of the Hgf-neutralizing antibody, which blocks expression
of all Wnt7b isoforms, and the absence of 3β1 integrin,
which only blocks two out of the three isoforms, might indicate an absolute
requirement for signals downstream of c-Met that are augmented by association
with 3β1 integrin. In contrast to Wnt7b, Wnt4 expression
by immortalized cell lines was not sensitive to c-Met blockade with the
Hgf-neutralizing antibody (Fig.
6B).
|
3β1 integrin-deficient kidneys, those tubules present displayed
normal morphology (Fig. 1A).
Cell survival is known to require integrin engagement, particularly in
epithelial cells. Therefore, we examined whether increased apoptosis could
have a role in the failure of papillary outgrowth in 3β1
integrin-deficient kidneys. Indeed, TUNEL staining of papillae showed
significantly more apoptosis in 3 integrin KO than in WT kidneys
(Fig. 7A).
Wnt signaling has been found to prevent apoptosis in various cell types
(Chen et al., 2001;
Hwang et al., 2004). To
examine whether Wnts are required for regulating apoptosis in vivo, 3
integrin KO papillae were placed in culture for 24 hours with conditioned
medium from Wnt3a-expressing HEK293 cells. This treatment prevented apoptosis
in these kidney papillae, suggesting a potential role of Wnt proteins in
maintaining cell survival. In addition, treatment of WT kidney papillae with
Wnt inhibitors (Fz8CRD and Dkk1) induced apoptosis in WT kidneys
(Fig. 7B), further supporting
the role of Wnts in preventing apoptosis. As shown in
Fig. 7, the number of obviously
apoptotic cells was low, and may not completely account for the failure of
papillary outgrowth, although TUNEL staining is a relatively late marker of
apoptosis and these results might underestimate the total amount of apoptosis
that will occur between E18.5 and P0. (For lower-magnification images of these
organ cultures, see Fig. S4 in the supplementary material.)
To determine whether Hgf-mediated Wnt expression was involved in regulating
apoptosis, WT kidney papillae were treated with the Hgf-neutralizing antibody.
This treatment also induced apoptosis in kidney papillae
(Fig. 7C). By contrast,
treatment with Hgf could not prevent apoptosis in 3β1
integrin-deficient kidney papillae (Fig.
7D), consistent with the previous results indicating that c-Met is
largely unresponsive to Hgf in the absence of 3β1 integrin.
Together, these results suggest that Hgf and laminin signaling through c-Met
and 3β1 integrin can regulate cell survival via stimulation of Wnt
gene expression, and that this is dependent on the presence of the
3β1 integrin. Thus, these results suggest a novel role of
3β1 integrin: acting coordinately with c-Met to regulate Wnt gene
expression, which in turn can regulate cell survival and contribute to the
proper patterning of the renal papilla.
Cell proliferation was also examined in WT and 3 integrin KO
kidneys. There is little proliferation at the tip of the papilla in WT
kidneys. Instead, most proliferation is found at the mid-papilla and extending
into the cortex. The frequency of proliferating cells within the collecting
ducts appeared similar in WT and KO kidneys (see Fig. S5 in the supplementary
material).
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
3β1
integrin and the receptor tyrosine kinase c-Met signal coordinately to
regulate a morphogenetic event. Secondly, that coordinate signals by integrins
and receptor tyrosine kinases can regulate the expression of Wnt genes. That
Wnt signals can act to maintain cell survival has been demonstrated
previously. Here, we place this function within a developmental context
downstream of signals from diffusible growth factors and the ECM. These
findings also underscore that it is important to consider the ECM, and not
only diffusible growth factors, as biological information that groups of cells
integrate to produce morphogenetic events.
Mice deficient in 3β1 integrin die during the neonatal period
with multiple developmental defects, including abnormal development of the
renal glomerulus and the papillary region of the kidney
(Kreidberg et al., 1996).
Although it is more likely that the observed neonatal death is due to
glomerular dysfunction, the papillary defects are nonetheless informative with
regard to integrin and receptor tyrosine kinase function in the regulation of
Wnt gene expression and epithelial morphogenesis. The present study
establishes an important role for integrins in maintaining epithelial cell
survival in vivo.
Wnt signaling is transduced through several biochemical pathways, which are
categorized as canonical and non-canonical
(Pandur et al., 2002). In
non-mammalian species, it has been possible to relate specific biochemical
pathways to morphogenetic processes. These relationships are less well defined
in mammals. For example, tubular extension during development of the papilla
of the embryonic kidney involves cell proliferation, cell survival and
vectorial tubular extension. Proliferation and cell survival are likely to be
consequences of canonical Wnt signaling. This is supported by our observations
using β-catenin/Tcf reporter transgenes. Wnt7b is the most likely
candidate to mediate cell proliferation and survival. A role in proliferation
was recently demonstrated in the developing lung
(Rajagopal et al., 2008). By
contrast, vectorial tubular extension may be related to planar cell polarity
(PCP) pathways (Fischer et al.,
2006), which are generally thought to be a consequence of
non-canonical Wnt signaling. In this model, tubular extension results in
elongation of tubules that maintain a constant diameter. If PCP pathways were
non-functional, one prediction is that cysts would form instead of tubules as
a consequence of random rather than ordered cell divisions
(Fischer et al., 2006). Wnt4
has been suggested to be involved in non-canonical Wnt pathways
(Cohen et al., 2002;
Lim et al., 2005;
Osafune et al., 2006), but
this does not exclude a role in canonical Wnt signaling. Indeed, it remains
unclear whether it is possible to strictly classify specific Wnts into
exclusively canonical or non-canonical signaling ligands. Whether Wnt4 is
responsible for PCP signaling in the developing kidney is unknown. However,
the observation that those tubules that are present, albeit fewer in number,
appear normal and without cysts, suggests that PCP pathways might be intact.
Possibly, there is sufficient Wnt4 to maintain PCP, even though levels appear
to be diminished. It is also possible that Wnt7b regulates the pattern of
proliferation in the developing papilla and this might be the focus of future
studies.
|
) and of c-Met
(Ishibe et al., 2009) in the
kidney.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/5/843/DC1
|
Footnotes |
|---|
* These authors contributed equally to this work 
Present address: Joslin Diabetes Institute, Boston, MA 02215, USA
Present address: Genzyme, Framingham, MA 01701, USA
Present address: University of South Florida, Tampa, FL 33620, USA
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Anton, E. S., Kreidberg, J. A. and Rakic, P.
(1999). Distinct functions of alpha3 and alpha(v) integrin
receptors in neuronal migration and laminar organization of the cerebral
cortex. Neuron 22,277
-289.[Medline]
Birchmeier, C. and Gherardi, E. (1998).
Developmental roles of HGF/SF and its receptor, the c-Met tyrosine kinase.
Trends Cell Biol. 8,404
-410.[CrossRef][Medline]
Boudreau, N. and Bissell, M. J. (1998).
Extracellular matrix signaling: integration of form and function in normal and
malignant cells. Curr. Opin. Cell Biol.
10,640
-646.[CrossRef][Medline]
Carroll, T. J., Park, J. S., Hayashi, S., Majumdar, A. and
McMahon, A. P. (2005). Wnt9b plays a central role in the
regulation of mesenchymal to epithelial transitions underlying organogenesis
of the mammalian urogenital system. Dev. Cell
9, 283-292.[CrossRef][Medline]
Cebrian, C., Borodo, K., Charles, N. and Herzlinger, D. A.
(2004). Morphometric index of the developing murine kidney.
Dev. Dyn. 231,601
-608.[CrossRef][Medline]
Chattopadhyay, N., Wang, Z., Ashman, L. K., Brady-Kalnay, S. M.
and Kreidberg, J. A. (2003). alpha3beta1 integrin-CD151, a
component of the cadherin-catenin complex, regulates PTPmu expression and
cell-cell adhesion. J. Cell Biol.
163,1351
-1362.
Chen, S., Guttridge, D. C., You, Z., Zhang, Z., Fribley, A.,
Mayo, M. W., Kitajewski, J. and Wang, C. Y. (2001). Wnt-1
signaling inhibits apoptosis by activating beta-catenin/T cell factor-mediated
transcription. J. Cell Biol.
152, 87-96.
Cheon, S. S., Cheah, A. Y., Turley, S., Nadesan, P., Poon, R.,
Clevers, H. and Alman, B. A. (2002). beta-Catenin
stabilization dysregulates mesenchymal cell proliferation, motility, and
invasiveness and causes aggressive fibromatosis and hyperplastic cutaneous
wounds. Proc. Natl. Acad. Sci. USA
99,6973
-6978.
Chomczynski, P. and Sacchi, N. (1987).
Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162,156
-159.[Medline]
Cohen, E. D., Mariol, M. C., Wallace, R. M., Weyers, J.,
Kamberov, Y. G., Pradel, J. and Wilder, E. L. (2002). DWnt4
regulates cell movement and focal adhesion kinase during Drosophila ovarian
morphogenesis. Dev. Cell
2, 437-448.[CrossRef][Medline]
Comoglio, P. M., Boccaccio, C. and Trusolino, L.
(2003). Interactions between growth factor receptors and adhesion
molecules: breaking the rules. Curr. Opin. Cell Biol.
15,565
-571.[CrossRef][Medline]
Danen, E. H. and Sonnenberg, A. (2003).
Integrins in regulation of tissue development and function. J.
Pathol. 201,632
-641.[CrossRef][Medline]
DiPersio, C. M., Hodivala-Dilke, K. M., Jaenisch, R., Kreidberg,
J. A. and Hynes, R. O. (1997). alpha3beta1 Integrin is
required for normal development of the epidermal basement membrane.
J. Cell Biol. 137,729
-742.
Eliceiri, B. P. (2001). Integrin and growth
factor receptor crosstalk. Circ. Res.
89,1104
-1110.
Elices, M. J., Urry, L. A. and Hemler, M. E.
(1991). Receptor functions for the integrin VLA-3: fibronectin,
collagen, and laminin binding are differentially influenced by Arg-Gly-Asp
peptide and by divalent cations. J. Cell Biol.
112,169
-181.
Fassler, R. and Meyer, M. (1995). Consequences
of lack of beta 1 integrin gene expression in mice. Genes
Dev. 9,1896
-1908.
Fassler, R., Georges-Labouesse, E. and Hirsch, E.
(1996). Genetic analyses of integrin function in mice.
Curr. Opin. Cell Biol.
8, 641-646.[CrossRef][Medline]
Fischer, E., Legue, E., Doyen, A., Nato, F., Nicolas, J. F.,
Torres, V., Yaniv, M. and Pontoglio, M. (2006). Defective
planar cell polarity in polycystic kidney disease. Nat.
Genet. 38,21
-23.[CrossRef][Medline]
Georges-Labouesse, E., Messaddeq, N., Yehia, G., Cadalbert, L.,
Dierich, A. and Le Meur, M. (1996). Absence of integrin alpha
6 leads to epidermolysis bullosa and neonatal death in mice. Nat.
Genet. 13,370
-373.[CrossRef][Medline]
Georges-Labouesse, E., Mark, M., Messaddeq, N. and Gansmuller,
A. (1998). Essential role of alpha 6 integrins in cortical
and retinal lamination. Curr. Biol.
8, 983-986.[CrossRef][Medline]
Giancotti, F. G. and Ruoslahti, E. (1999).
Integrin signaling. Science
285,1028
-1032.
Goh, K. L., Yang, J. T. and Hynes, R. O.
(1997). Mesodermal defects and cranial neural crest apoptosis in
alpha5 integrin-null embryos. Development
124,4309
-4319.[Abstract]
Gorski, J. P. and Olsen, B. R. (1998).
Mutations in extracellular matrix molecules. Curr. Opin. Cell
Biol. 10,586
-593.[CrossRef][Medline]
Hogan, B. L. (1999). Morphogenesis.
Cell 96,225
-233.[CrossRef][Medline]
Howe, A., Aplin, A. E., Alahari, S. K. and Juliano, R. L.
(1998). Integrin signaling and cell growth control.
Curr. Opin. Cell Biol.
10,220
-231.[CrossRef][Medline]
Huang, S. and Ingber, D. E. (1999). The
structural and mechanical complexity of cell-growth control. Nat.
Cell Biol. 1,E131
-E138.[CrossRef][Medline]
Hwang, S. G., Ryu, J. H., Kim, I. C., Jho, E. H., Jung, H. C.,
Kim, K., Kim, S. J. and Chun, J. S. (2004). Wnt-7a causes
loss of differentiated phenotype and inhibits apoptosis of articular
chondrocytes via different mechanisms. J. Biol. Chem.
279,26597
-26604.
Hynes, R. O. (1992). Integrins: versatility,
modulation, and signaling in cell adhesion. Cell
69, 11-25.[CrossRef][Medline]
Hynes, R. O. (1999). Cell adhesion: old and new
questions. Trends Cell Biol.
9, M33-M37.[CrossRef][Medline]
Hynes, R. O. and Zhao, Q. (2000). The evolution
of cell adhesion. J. Cell Biol.
150,F89
-F96.[CrossRef][Medline]
Ishibe, S., Karihaloo, A., Ma, H., Zhang, J., Marlier, A.,
Mitobe, M., Togawa, A., Schmitt, R., Czyczk, J., Kashgarian, M., Geller, D.
S., Thorgeirsson, S. S. and Cantley, L. G. (2009). Met and
the epidermal growth factor receptor act cooperatively to regulate final
nephron number and maintain collecting duct morphology.
Development 136,337
-345.
Itaranta, P., Chi, L., Seppanen, T., Niku, M., Tuukkanen, J.,
Peltoketo, H. and Vainio, S. (2006). Wnt-4 signaling is
involved in the control of smooth muscle cell fate via Bmp-4 in the medullary
stroma of the developing kidney. Dev. Biol.
293,473
-483.[CrossRef][Medline]
Jeffers, M., Rong, S. and Vande Woude, G. F.
(1996). Enhanced tumorigenicity and invasion-metastasis by
hepatocyte growth factor/scatter factor-met signalling in human cells
concomitant with induction of the urokinase proteolysis network.
Mol. Cell. Biol. 16,1115
-1125.[Abstract]
Kikkawa, Y., Sanzen, N. and Sekiguchi, K.
(1998). Isolation and characterization of laminin-10/11 secreted
by human lung carcinoma cells. laminin-10/11 mediates cell adhesion through
integrin alpha3 beta1. J. Biol. Chem.
273,15854
-15859.
Kispert, A., Vainio, S., Shen, L., Rowitch, D. H. and McMahon,
A. P. (1996). Proteoglycans are required for maintenance of
Wnt-11 expression in the ureter tips. Development
122,3627
-3637.[Abstract]
Kispert, A., Vainio, S. and McMahon, A. P.
(1998). Wnt-4 is a mesenchymal signal for epithelial
transformation of metanephric mesenchyme in the developing kidney.
Development 125,4225
-4234.[Abstract]
Klosek, S. K., Nakashiro, K., Hara, S., Shintani, S., Hasegawa,
H. and Hamakawa, H. (2005). CD151 forms a functional complex
with c-Met in human salivary gland cancer cells. Biochem. Biophys.
Res. Commun. 336,408
-416.[CrossRef][Medline]
Kreidberg, J. A., Donovan, M. J., Goldstein, S. L., Rennke, H.,
Shepherd, K., Jones, R. C. and Jaenisch, R. (1996). Alpha 3
beta 1 integrin has a crucial role in kidney and lung organogenesis.
Development 122,3537
-3547.[Abstract]
Lim, J., Norga, K. K., Chen, Z. and Choi, K. W.
(2005). Control of planar cell polarity by interaction of DWnt4
and four-jointed. Genesis
42,150
-161.[CrossRef][Medline]
Majumdar, A., Vainio, S., Kispert, A., McMahon, J. and McMahon,
A. P. (2003). Wnt11 and Ret/Gdnf pathways cooperate in
regulating ureteric branching during metanephric kidney development.
Development 130,3175
-3185.
Menko, A. S., Kreidberg, J. A., Ryan, T. T., Van Bockstaele, E.
and Kukuruzinska, M. A. (2001). Loss of alpha3beta1 integrin
function results in an altered differentiation program in the mouse
submandibular gland. Dev. Dyn.
220,337
-349.[CrossRef][Medline]
Miner, J. H. and Li, C. (2000). Defective
glomerulogenesis in the absence of laminin alpha5 demonstrates a developmental
role for the kidney glomerular basement membrane. Dev.
Biol. 217,278
-289.[CrossRef][Medline]
Miranti, C. K. and Brugge, J. S. (2002).
Sensing the environment: a historical perspective on integrin signal
transduction. Nat. Cell Biol.
4, E83-E90.[CrossRef][Medline]
Montesano, R., Matsumoto, K., Nakamura, T. and Orci, L.
(1991). Identification of a fibroblast-derived epithelial
morphogen as hepatocyte growth factor. Cell
67,901
-908.[CrossRef][Medline]
Osafune, K., Takasato, M., Kispert, A., Asashima, M. and
Nishinakamura, R. (2006). Identification of multipotent
progenitors in the embryonic mouse kidney by a novel colony-forming assay.
Development 133,151
-161.
Osathanondh, V. and Potter, E. L. (1963).
Development of the human kidney as shown by microdissection II. Renal pelvis,
calyces, and papillae. Arch. Pathol.
76, 53-65.
Pandur, P., Maurus, D. and Kuhl, M. (2002).
Increasingly complex: new players enter the Wnt signaling network.
BioEssays 24,881
-884.[CrossRef][Medline]
Rajagopal, J., Carroll, T. J., Guseh, J. S., Bores, S. A.,
Blank, L. J., Anderson, W. J., Yu, J., Zhou, Q., McMahon, A. P. and Melton, D.
A. (2008). Wnt7b stimulates embryonic lung growth by
coordinately increasing the replication of epithelium and mesenchyme.
Development 135,1625
-1634.
Ruoslahti, E. (1999). Fibronectin and its
integrin receptors in cancer. Adv. Cancer Res.
76, 1-20.[Medline]
Sanes, J. R., Rubenstein, J. L. and Nicolas, J. F.
(1986). Use of a recombinant retrovirus to study
post-implantation cell lineage in mouse embryos. EMBO
J. 5,3133
-3142.[Medline]
Schmidt, C., Bladt, F., Goedecke, S., Brinkmann, V., Zschiesche,
W., Sharpe, M., Gherardi, E. and Birchmeier, C. (1995).
Scatter factor/hepatocyte growth factor is essential for liver development.
Nature 373,699
-702.[CrossRef][Medline]
Schwartz, M. A. and Baron, V. (1999).
Interactions between mitogenic stimuli, or, a thousand and one connections.
Curr. Opin. Cell Biol.
11,197
-202.[CrossRef][Medline]
Shu, W., Jiang, Y. Q., Lu, M. M. and Morrisey, E. E.
(2002). Wnt7b regulates mesenchymal proliferation and vascular
development in the lung. Development
129,4831
-4842.[Medline]
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P.
(1994). Epithelial transformation of metanephric mesenchyme in
the developing kidney regulated by Wnt-4. Nature
372,679
-683.[CrossRef][Medline]
Stephens, L. E., Sutherland, A. E., Klimanskaya, I. V.,
Andrieux, A., Meneses, J., Pedersen, R. A. and Damsky, C. H.
(1995). Deletion of beta 1 integrins in mice results in inner
cell mass failure and peri-implantation lethality. Genes
Dev. 9,1883
-1895.
Stoker, M., Gherardi, E., Perryman, M. and Gray, J.
(1987). Scatter factor is a fibroblast-derived modulator of
epithelial cell mobility. Nature
327,239
-242.[CrossRef][Medline]
Taverna, D., Disatnik, M. H., Rayburn, H., Bronson, R. T., Yang,
J., Rando, T. A. and Hynes, R. O. (1998). Dystrophic muscle
in mice chimeric for expression of alpha5 integrin. J. Cell
Biol. 143,849
-859.
Uehara, Y., Minowa, O., Mori, C., Shiota, K., Kuno, J., Noda, T.
and Kitamura, N. (1995). Placental defect and embryonic
lethality in mice lacking hepatocyte growth factor/scatter factor.
Nature 373,702
-705.[CrossRef][Medline]
Vivanco, I. and Sawyers, C. L. (2002). The
phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat.
Rev. Cancer 2,489
-501.[CrossRef][Medline]
Wang, Z., Symons, J. M., Goldstein, S. L., McDonald, A., Miner,
J. H. and Kreidberg, J. A. (1999). (Alpha)3(beta)1 integrin
regulates epithelial cytoskeletal organization. J. Cell
Sci. 112,2925
-2935.[Abstract]
Wodarz, A. and Nusse, R. (1998). Mechanisms of
Wnt signaling in development. Annu. Rev. Cell Dev.
Biol. 14,59
-88.[CrossRef][Medline]
Yang, J. T., Rayburn, H. and Hynes, R. O.
(1993). Embryonic mesodermal defects in alpha 5
integrin-deficient mice. Development
119,1093
-1105.[Abstract]
Yang, J. T., Rayburn, H. and Hynes, R. O.
(1995). Cell adhesion events mediated by alpha 4 integrins are
essential in placental and cardiac development.
Development 121,549
-560.[Abstract]
Yu, J., Carroll, T. J., Rajagopal, J., Kobayashi, A., Ren, Q.
and McMahon, A. P. (2009). A Wnt7b-dependent pathway
regulates the orientation of epithelial cell division and establishes the
cortico-medullary axis of the mammalian kidney.
Development 136,161
-171.
Zhang, F., Tom, C. C., Kugler, M. C., Ching, T. T., Kreidberg,
J. A., Wei, Y. and Chapman, H. A. (2003). Distinct ligand
binding sites in integrin alpha3beta1 regulate matrix adhesion and cell-cell
contact. J. Cell Biol.
163,177
-188.
Zhang, Y. W. and Vande Woude, G. F. (2003).
HGF/SF-met signaling in the control of branching morphogenesis and invasion.
J. Cell. Biochem. 88,408
-417.[CrossRef][Medline]
Zhao, H., Kegg, H., Grady, S., Truong, H. T., Robinson, M. L.,
Baum, M. and Bates, C. M. (2004). Role of fibroblast growth
factor receptors 1 and 2 in the ureteric bud. Dev.
Biol. 276,403
-415.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
This article has been cited by other articles:
|
|
 |
|
  X. Zhang, G. Mernaugh, D.-H. Yang, L. Gewin, M. B. Srichai, R. C. Harris, J. M. Iturregui, R. D. Nelson, D. E. Kohan, D. Abrahamson, et al. {beta}1 integrin is necessary for ureteric bud branching morphogenesis and maintenance of collecting duct structural integrity Development, October 1, 2009; 136(19): 3357 - 3366. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Mitchell, C. Szekeres, V. Milano, K. B. Svenson, M. Nilsen-Hamilton, J. A. Kreidberg, and C. M. DiPersio {alpha}3{beta}1 integrin in epidermis promotes wound angiogenesis and keratinocyte-to-endothelial-cell crosstalk through the induction of MRP3 J. Cell Sci., June 1, 2009; 122(11): 1778 - 1787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Stanco, C. Szekeres, N. Patel, S. Rao, K. Campbell, J. A. Kreidberg, F. Polleux, and E. S. Anton Netrin-1-{alpha}3{beta}1 integrin interactions regulate the migration of interneurons through the cortical marginal zone PNAS, May 5, 2009; 106(18): 7595 - 7600. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
