|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 6, 2009
doi: 10.1242/10.1242/dev.027565
-dependent hepatic steatosis and liver degeneration caused by mutation of zebrafish s-adenosylhomocysteine hydrolase
1 Division of Gastroenterology, Hepatology, and Nutrition, The Children's
Hospital of Philadelphia and Department of Pediatrics, University of
Pennsylvania School of Medicine, Philadelphia, PA 19104, USA.
2 Department of Medicine, University of Pennsylvania School of Medicine,
Philadelphia, PA 19104, USA.
3 Centers for Cancer Pharmacology and Excellence in Environmental Toxicology and
University of Pennsylvania School of Medicine, Philadelphia, PA 19104,
USA.
4 Department of Cell and Developmental Biology, University of Pennsylvania
School of Medicine, Philadelphia, PA 19104, USA.
* Author for correspondence (e-mail: mpack{at}mail.med.upenn.edu)
Accepted 31 December 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
. Although
heterozygous dtp larvae had no discernible phenotype, hepatic
steatosis was present in heterozygous adult dtp fish and in wild-type
adult fish treated with an Ahcy inhibitor. These data argue that AHCY
polymorphisms and AHCY inhibitors, which have shown promise in treating
autoimmunity and other disorders, may be a risk factor for steatosis,
particularly in patients with diabetes, obesity and liver disorders such as
hepatitis C infection. Supporting this idea, hepatic injury and steatosis have
been noted in patients with recently discovered AHCY mutations.
Key words: Lipid metabolism, Liver disease, Methionine metabolism, Methylation, TNF alpha, Zebrafish
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Several pathogenic mechanisms appear to contribute to the development of
hepatic steatosis and steatohepatitis, and it has been proposed that multiple
`hits' are required for disease progression. Hepatocytes accumulate lipid when
its synthesis, uptake, secretion and/or utilization are altered
(Browning and Horton, 2004
;
Fromenty et al., 2004).
Although the events that initiate most steatotic disorders are now beginning
to be more clearly defined, it has been recognized for many years that
methionine metabolism, which is altered in patients with alcoholic liver
disease and other chronic liver disorders associated with steatosis, may play
a contributory role (Diehl,
2005; Duong et al.,
2006; Esfandiari et al.,
2005; Innis and Hasman,
2006; Kharbanda,
2007; Lu et al.,
2002; Mato et al.,
2008; Wortham et al.,
2008; Zhu et al.,
2003). Mitochondrial dysfunction, endoplasmic reticulum stress,
sensitization to cytokine-induced liver injury and reduced methyltransferase
activities have all been implicated in mediating the effects of methionine
metabolism defects in the mammalian liver.
The recessive lethal zebrafish mutant ducttrip (dtp) was
recovered in a screen for exocrine pancreas mutants
(Yee et al., 2005). Initial
phenotypic analysis showed normal differentiation of early dtp
exocrine progenitors, whereas their proliferation, terminal differentiation
and survival were disrupted at later stages
(Yee et al., 2005). Subsequent
experiments, described in this report, reveal hepatic steatosis, mitochondrial
dysfunction and liver degeneration in all dtp larvae, as well as a
milder phenotype in adult heterozygous dtp carriers. Positional
cloning identified a causative mutation in the gene encoding
S-adenosylhomocysteine hydrolase (Ahcy), the enzyme that hydrolyzes
S-adenosylhomocysteine (SAH) to homocysteine and adenosine, a pathway that has
been linked to mitochondrial dysfunction
(Song et al., 2007) and
hepatic steatosis. These findings argue that a heritable reduction in Ahcy
activity may be a predisposing genetic risk factor for hepatic steatosis.
Consistent with such a role for AHCY in humans, steatosis and liver injury
were reported in hypermethioninemic patients recently shown to carry
homozygous AHCY mutations (Baric
et al., 2005; Baric et al.,
2004; Buist et al.,
2006).
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
Heterozygous adult males were used for all studies of dtp carriers;
fish were identified by genotyping (details available upon request). Wild-type
TLF strain fish were used for all morpholino injections and drug
treatments.
Genetic mapping and positional cloning of the dtp locus
To generate larvae for mapping, dtp carriers were mated with
wild-type WIK zebrafish, and their progeny were subsequently mated to screen
for mutant dtp hybrids. Standard Z-markers were used to perform
coarse mapping of dtp to chromosome 6. Available in silico sequences
were used to derive closer dinucleotide repeat markers. Primer sequences for
ahcy, chmp4b and eif2s2 were obtained from in silico
sequences
(www.sanger.ac.uk)
and individual exons were sequenced. The marker within ahcy reflects
the actual mutation, which takes advantage of the T-to-C mutation that removes
an NlaIII (CATG) site in exon 8. This polymorphism is the zero
recombinant polymorphism. For the wild-type mRNA, a full-length EST was
obtained
(www.openbiosystems.com)
and engineered into pCS2(+); mRNA was then synthesized using mMessage mMachine
(Ambion). For the mutant mRNA, the mutation was introduced using site-directed
mutagenesis and the mRNA was synthesized identically to that of the wild
type.
Mass spectroscopy
Whole larvae were snap-frozen in a dry-ice bath prior to mass spectroscopy
for SAM, SAH and AHCY. For SAM and SAH, a mixture of internal standards (250
ng/ml each of [2H3]-SAM and [13C5]-SAH) was added to the
tube containing larvae. Larvae were resuspended in ascorbic acid, sonicated
and protein isolated by methanol precipitation. An aliquot of the supernatant
was analyzed by mass spectrometer (TSQ 7000, Thermo Finnigan), with
chromatography on a YMC ODS S-3 column (Waters, Milford, MA, USA) on a linear
gradient of water and acetonitrile at 4°C. The ratio of peak area for the
analyte to its stable isotope internal standard was used to calculate the
concentrations of SAM and SAH. Data for each time point and condition
represent means of at least three pairs of larvae measured separately, with
s.e.m. indicated.
Tissue preparation and staining
Adult male genotyped heterozygotes, drug-treated fish or control were
prepared as indicated elsewhere in the text. Livers were removed immediately
following sacrifice, fixed in paraformaldehyde, and then processed. Portions
of the livers were also saved for RNA isolation or mitochondrial preparation
for GSH determination. Larvae and livers were stained using Hematoxylin and
Eosin in accordance with standard methodology. Staining with Oil Red O was
performed by first washing sections in 60% triethyl phosphate, then staining
in 1% Oil Red O in triethyl phosphate, followed by rinsing and counterstaining
in Celestin Blue
(www.ebsciences.com/histology/gma_oilredo.htm).
Larvae for sectioning were obtained and processed in glycol methacrylate as
described (Wallace and Pack,
2003), except that tissue was processed directly in glycol
methacrylate following fixation to avoid lipid extraction. RNA was isolated
using Trizol (Invitrogen) and RNAeasy (Qiagen) as described previously for
larval zebrafish (Matthews et al.,
2004).
In situ hybridization and Ahcy immunostaining
In situ hybridizations were performed on staged embryos and larvae as
described (Matthews et al.,
2004). Genotyped embryos were used for the TNF rescue
experiments. An anti-human AHCY antibody (Abcam) was used for
immunohistochemistry following standard procedures.
Adult 3-deaza-adenosine treatment, mitochondrial preparation and GSH determination
Adult TLF siblings were treated with 2.5 mg/ml 3-deaza-adenosine in system
water for the times indicated. Mitochondria were isolated from whole larvae or
adult livers using the Mitochondrial Isolation Kit (Sigma). Glutathione
concentrations were determined spectrophotometrically using the Glutathione
Assay Kit (Sigma).
Morpholino and mRNA injections
Morpholinos (Gene-Tools) were (5' to 3'):
AHCY-5',CATGTTGACGTTGTGCTGTCTGGTA; AHCY-IE8, CTCAAAGTGTCTTTAAAACACACAC;
TNF-5', AGCTTCATAATTGCTGTATGTCTTA; TNF-IE4,
TTGATTCAGAGTTGTATCCACTAGG. Morpholinos to ahcy and tnfa were
injected into the yolk at 2 dpf, as described previously
(Stenkamp and Frey, 2003).
Injection of the ahcy AUG morpholino or splice donor (exon 8)
morpholino had similar effects. Injection of the tnfa AUG morpholino
or splice donor (exon 5) morpholino also had similar effects. Knockdown was
confirmed using the antibody directed against Ahcy or TNF described
above.
Injections of mRNA (10 pg) were performed at the 1-cell stage, as described
previously (Matthews et al.,
2005). mRNA of wild-type or mutant ahcy was synthesized
using standard methods. Injection of azacytidine (azaC) was performed at 2, 3
and 4 dpf by injecting 1 mg/ml azaC (in water) into the yolk in volumes
comparable to the morpholino injections.
Western blots and methylcytosine staining
Protein and genomic DNA extractions were performed on midsections of 5-dpf
larvae using standard protocols. Western blotting was performed using a
standard protocol; antibodies were obtained from Abcam.
For the immuno-slot blot, genomic DNA was denatured and applied to nitrocellulose paper on a slot filtration apparatus (Bio-Rad), and hybridized following the Bio-Rad protocol. Methylcytosine staining was performed using an anti-methylcytosine antibody (GeneTex, Abcam) and the remainder of the protocol was identical to a standard western blotting protocol, except for the use of Tris-buffered saline. Genomic DNA was counterstained with Methylene Blue. Quantification was performed using ImageJ or Adobe Photoshop, which produced identical results.
Quantitative PCR
Real-time quantitative PCR was performed on 4-dpf midsections, as described
(Matthews et al., 2004).
Primer pairs used for amplification were as published
(Lorent et al., 2004;
Matthews et al., 2004) or as
follows (5' to 3'): tnfa-F3, GAGCCTGAATCTGAAAATCTGTGG; tnfa-B5,
CAGTCTGTCTCCTTCTCGTAAATGG; srebp1-F2, GGAGAACCTGACACTGAAGATGGC; srebp1-B1,
TGACTCTACACAGAAACACACACGG; pparg-F1, TGAAAAATGCCCTGCCTGATG; pparg-B1,
GGAAAAAACCCTGAGATGTCTGG; gpx-le1, GCTGTTCAGCCTGGACTTTT; gpx-ri1,
CGTTGCTGAGTTTGGACTTTT; trx-le1, CTTCGACAACGCCCTAA AAA; trx-ri1,
ATTTAAAGTACGGCCCGATG. Data points represent the mean of at least three sets of
4-5 pooled midsections, with s.e.m. indicated. Statistical significance was
determined using Student's t-test.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Homozygous
dtp larvae, which survive to 9-10 days post-fertilization (dpf), have
minimal exocrine tissue but show normal endocrine development
(Yee et al., 2005). Subsequent
work identified severe liver defects in all homozygous dtp larvae
beginning at 3 dpf. Histological analyses showed a small, necrotic-appearing
liver in 5-dpf mutants, although initial changes in hepatocyte appearance were
manifest at 3 dpf (Fig. 1A-J).
Ultrastructural examination of 5-dpf dtp hepatocytes revealed
condensation of mitochondrial cristae, with widening and rarefication of the
matrix between the inner mitochondrial membrane and the cristae, and an
accumulation of lipid globules (Fig.
1M-P). Oil Red O staining of dtp livers confirmed the
presence of neutral lipid in the cytoplasm of 5-dpf mutant hepatocytes
(Fig. 1K,L). TUNEL and Acridine
Orange stainings of 4-dpf and 5-dpf dtp larvae were negative (not
shown), suggesting non-apoptotic cell death in the mutant liver. These data
show that the dtp mutation causes progressive liver and exocrine
pancreas degradation during the developmental period when cells in both
tissues are normally rapidly proliferating. Furthermore, the dtp
mutation is associated with hepatic steatosis and mitochondrial defects.
Positional cloning of the dtp locus identifies mutation of a conserved residue in the s-adenosylhomocysteine hydrolase gene
A positional cloning strategy was used to identify the targeted gene
responsible for the dtp phenotype. High-resolution meiotic mapping of
the dtp locus defined a 200 kb region on zebrafish chromosome 6 that
delimited three candidate genes (Fig.
2A), one of which, ahcy, was favored because of its
established role in methionine metabolism and steatosis. Sequencing of cDNAs
derived from dtp larvae did not identify mutations in the coding
regions of the chromatin-modifying protein 4B (chmp4b) or eukaryotic
translation initiation factor 2B β2 subunit (eif2s2) genes (data
not shown). By contrast, a C-to-T transition was present in exon 8 of
ahcy cDNA recovered from homozygous dtp larvae, but not
their wild-type siblings (not shown). This missense mutation was predicted to
substitute threonine for a methionine residue that is conserved in eukaryotic
and prokaryotic Ahcy proteins (Fig.
2B). The methionine residue targeted by the dtp mutation
resides in the NAD-binding domain (Hu et
al., 1999; Hu et al.,
2001; Tanaka et al.,
2004; Turner et al.,
1998), a region of the Ahcy protein that is crucial for enzyme
activation (Li et al., 2007).
For this reason, we predicted that Ahcy activity was reduced in dtp
mutants.
|
). SAH is a potent inhibitor of methyltransferases
(Chiang, 1998;
Chiang et al., 1996). Given
its important role in methionine metabolism, ahcy is predicted to be
an essential gene in zebrafish, as suggested by studies in mammals
(Miller et al., 1994). As with
many zebrafish mutants, survival during early development is most likely
explained by maternally supplied ahcy mRNA and Ahcy protein, which
were both identifiable in zebrafish embryos at 3 hours post-fertilization
(hpf) (Fig. 2D,H). Examination
of older embryos revealed widespread ahcy expression through 24 hpf,
but by 48 hpf expression was limited to liver, intestine, pancreas and
discrete areas within the brain and eye
(Fig. 2B-G). These areas
correspond to regions of active cell proliferation, consistent with an
essential role of Ahcy in metabolically active cells targeted by the
dtp mutation. Injection of morpholino antisense oligonucleotides
directed against ahcy resulted in larval hepatic steatosis, although
milder than in dtp (see Fig. S1 in the supplementary material) and
without significant hepatocyte degeneration (data not shown). Together, tight
genetic linkage of ahcy to the dtp locus, partial
dtp phenocopy induced by ahcy morpholino knockdown, and the
established role of methionine metabolism in mammalian hepatic lipid
steatosis, strongly support the identification of ahcy as the
causative gene.
Methionine metabolism is disrupted in dtp larvae
Since reduced Ahcy activity is predicted to increase SAH levels and
secondarily inhibit a large number of methylation reactions, we hypothesized
that the dtp liver phenotype might arise from impaired methylation.
To explore this hypothesis, we first measured total SAM and SAH levels in
dtp embryos and larvae and their wild-type siblings using mass
spectrometry. In wild-type embryos and larvae, SAH levels were relatively
stable between 2 and 5 dpf, while SAM levels increased modestly
(Fig. 3A,B, blue lines). By
contrast, levels of SAH and SAM were increased in dtp mutants during
these stages (Fig. 3A,B, red
lines), while the SAM:SAH ratio was reduced. Elevated SAM associated with Ahcy
inhibition has been reported previously, and is thought to be secondary to
reduced SAM utilization associated with SAH-mediated inhibition of
methyltransferases (Chiang et al.,
1996). The elevated SAH and SAM levels and the reduced SAM:SAH
ratio in 2-dpf dtp mutants were rescued by injection of mRNA encoding
wild-type, but not dtp, Ahcy protein, confirming that the mutant Ahcy
is either inactive or has greatly reduced activity
(Fig. 3C,D). Microinjected
ahcy mRNA did not rescue the methionine metabolism defect, hepatic
steatosis or hepatic degeneration of 5-dpf dtp larvae when injected
into 1-cell stage embryos or the yolk at 2 dpf (data not shown), most likely
because of the short half-life of the mRNA.
|
), rather than a lack of Pemt inhibition. This finding is
important because a reduced PC:PE ratio causes severe steatohepatitis in mice
(Zhu et al., 2003), and
therefore it might be expected to be reduced in dtp mutants.
The expression of lipogenic genes, of genes responsive to oxidative stress and of tnfa is increased in dtp larvae
Microarray analyses have been used to identify gene expression patterns
altered in patients and rodent models with hepatic steatosis
(Chung et al., 2005;
Deaciuc et al., 2004;
Esfandiari et al., 2005;
Younossi et al., 2005). These
studies have reported changes in the expression of genes involved in lipid
metabolism, inflammation and fibrosis, and in genes encoding cytokines and
proteins activated in response to oxidative stress. We compared the expression
of some of these genes in dtp mutants and their wild-type siblings
using real-time quantitative PCR. As in the other steatosis models, we found
elevated expression of the lipogenic genes pparg and srebp1,
the reactive oxygen species (ROS)-responsive gene gpx and the
cytokine tnfa (NM 212859.2) in dtp larvae, although the
elevation of srebp1 only approached statistical significance
(Fig. 4A-C). Interestingly,
pparg also functions as an anti-inflammatory gene, but its role in
hepatic steatosis is likely to be related to its lipogenic functions.
Expression of a second zebrafish tnf gene, tnfb (NM
1024447.1) was unchanged between wild type and dtp (data not shown).
Western analysis confirmed a 3-fold elevation of Tnf protein levels in
dtp larvae (Fig. 4D)
and whole-mount RNA in situ hybridization experiments showed increased
tnfa expression in the liver, intestine and swim bladder of most
dtp larvae examined (Fig.
4E,F).
Tnf mediates hepatic steatosis and degeneration in dtp larvae
To assess the effect of elevated Tnf in dtp mutants, we
assayed the effect of tnfa knockdown induced by antisense
morpholinos. Injection of a tnfa morpholino into the yolk of 2-dpf
dtp larvae decreased Tnf protein expression
(Fig. 4E), demonstrating the
effectiveness of morpholino-mediated knockdown at later embryonic stages, as
previously reported (Stenkamp and Frey,
2003). The livers of the morpholino-injected dtp larvae
were significantly larger than those of sibling dtp mutants injected
with vehicle control (Fig.
4H,I), and the histological appearance of the hepatocytes more
closely resembled wild-type hepatocytes, thus confirming rescue of the hepatic
phenotype [Fig. 4J,K; rescue
was present in 13 of 17 genotyped dtp-/- larvae analyzed
by transferrin a (tfa) in situ or tissue staining].
Ultrastructural analysis showed reduced steatosis in the hepatocytes of
morpholino-injected dtp larvae and an improvement in the appearance
of the mitochondria (Fig. 4L).
Injection of tnfa morpholino into wild-type larvae had no effect on
liver size, histology or ultrastructure (data not shown). These data confirm a
central role for Tnf in the dtp phenotype.
|
; Tomita et
al., 2006). The gut microbiota is believed to activate
TNF in these cells (Thakur et
al., 2007). To determine whether an innate immune response to
endotoxin derived from Gram-negative gut bacteria plays a role in the
dtp mutant phenotype, we measured tnfa gene expression and
liver morphology in dtp larvae reared under germ-free conditions
(Rawls et al., 2004;
Bates et al., 2006).
tnfa expression remained elevated in gnotobiotic dtp larvae
and the hepatic phenotype appeared unchanged, based on tfa RNA in
situ hybridization (see Fig. S3 in the supplementary material) and histology
(not shown).
Having excluded a role for the gut microbiota in tnfa activation,
we sought to determine whether reduced DNA methylation at tnfa
regulatory elements could account for increased Tnf levels in
dtp mutants. We treated zebrafish larvae with 5-azacytidine (azaC), a
nucleoside analog that reversibly inhibits DNA methyltransferases
(Jones and Taylor, 1980). AzaC
treatment inhibits methylation of hemimethylated cytidine residues in the DNA
of replicating cells. Surprisingly, azaC injection into the yolk of 2- to
4-dpf zebrafish had little effect on larval morphology, even though DNA
methylation levels were halved (see Fig. S4 in the supplementary material). In
addition to their normal gross liver morphology, histological analysis of the
azaC-injected larvae revealed no evidence of hepatic steatosis or of liver
degeneration, nor was there any ultrastructural evidence of mitochondrial
defects (see Fig. S4 in the supplementary material). Furthermore, quantitative
RT-PCR showed no increase in tnfa expression in azaC-treated larvae
(see Fig. S4 in the supplementary material). Finally, analysis of
tnfa regulatory elements within 4 kb upstream to 1 kb downstream of
the transcription start site did not identify any CpG islands (Sanger Centre
zebrfish genome sequence version 7.0; data not shown). Together, these data
argue against the idea that elevated tnfa levels in dtp
larva arise from reduced DNA methylation at tnfa regulatory
elements.
Steatosis and reduced mitochondrial antioxidants in adult zebrafish treated with the Ahcy inhibitor 3-deaza-adenosine
Mitochondrial glutathione (mGSH) acts as a scavenger of ROS, and depletion
of mGSH is associated with several models of hepatic steatosis and
steatohepatitis (Garcia-Ruiz and
Fernandez-Checa, 2006). mGSH depletion also sensitizes hepatocytes
to injury and cell death caused by TNF
(Mari et al., 2006). Given
that the ultrastructural analyses suggest mitochondrial dysfunction in
dtp hepatocytes, we attempted to measure mGSH levels in liver
mitochondria derived from dtp larvae. Reduced liver size limited the
recovery of sufficient mitochondria to perform this assay. A sufficient number
of liver mitochondria were however recovered from adult zebrafish treated with
the Ahcy inhibitor 3-deaza-adenosine (deazaA)
(Guranowski et al., 1981).
DeazaA treatment for 7 days increased liver tnfa expression and
caused hepatic steatosis (Fig.
5). Although these fish had only mild hepatocyte mitochondrial
ultrastructural defects (data not shown), a modest yet highly significant
reduction of mGSH was evident (Fig.
5D).
|
|
; Deaciuc et al.,
2004; Esfandiari et al.,
2005; Younossi et al.,
2005). In contrast to heterozygous adults, hepatic steatosis was
not detected in 5-dpf heterozygous dtp larvae (not shown). |
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Multiple lines of evidence described in this report support
the identification of ahcy as the dtp gene. These include
tight genetic linkage, mutation of a highly conserved methionine residue in a
functional domain of the Ahcy protein, altered levels of methionine
metabolites that were not rescued by ahcydtp mRNA
injections (indicating reduced function of the dtp Ahcy protein), and
partial phenocopy of dtp by ahcy knockdown and Ahcy
inhibition. In addition to these findings, no mutations were identified in the
coding regions of other genes in the critical interval surrounding the
dtp locus.
|
). SAM
depletion and/or a reduced SAM:SAH ratio are important consequences of altered
methionine metabolism, as evidenced by the ability of SAM or its metabolic
precursor, betaine, to delay disease progression in animal liver disease
models and in patients with alcoholic liver disease
(Lu et al., 2001;
Villanueva and Halsted, 2004).
SAM depletion in chronic liver conditions arises from nutritional deficiencies
coupled with reduced activity of the methionine metabolism enzyme methionine
synthase (MAT1A) and reduced BHMT gene expression
(Kharbanda, 2007;
Lu et al., 2002). This reduces
SAM synthesis, elevates cellular SAH (because hydrolysis of SAH by Ahcy is
reversible), and reduces the SAM:SAH ratio. By contrast, SAM and SAH are both
elevated in dtp, but the SAM:SAH ratio is reduced because the rise in
SAM is proportionately less than that in SAH. Increased SAH in dtp is
a direct effect of reduced Ahcy activity, whereas SAM levels increase in
dtp because of SAH-mediated inhibition of methyltransferases.
Association of methionine metabolism defects, mitochondrial dysfunction and changes in methylation potential in dtp mutants
Regardless of the cause, methionine metabolism defects induce a complex set
of cellular responses that disrupt hepatocyte lipid metabolism and, in some
instances, activate apoptotic or non-apoptotic cell death pathways.
Mitochondrial dysfunction is one of the more commonly reported defects.
Cytosolic SAM is imported into mitochondria by a specific transporter that is
inhibited by high levels of cytosolic SAH
(Agrimi et al., 2004;
Horne et al., 1997;
Song et al., 2007). Reduced
mitochondrial SAM caused by elevated SAH is predicted to disrupt mitochondrial
function through a variety of mechanisms arising from altered methylation
potential [discussed by Song et al. (Song
et al., 2007)]. Although the transporter that imports GSH into
mitochondria has not been identified, it is known that reduced SAM:SAH alters
mitochondrial membrane fluidity (Colell et
al., 1997), thereby disrupting the import of GSH, an important
antioxidant. Reduced mGSH leads to the oxidation of mitochondrial proteins,
lipid and DNA by ROS that are normally quenched by GSH. These oxidative
modifications cause mitochondrial dysfunction, which in turn increases ROS
production and causes further mitochondrial damage. Ultimately, this decreases
hepatocyte lipid utilization, which contributes to steatosis.
Although we did not directly assess the effect of elevated SAH on
mitochondrial SAM transport, several lines of evidence show that mitochondrial
dysfunction is important to the development of liver steatosis and
degeneration in dtp mutants. First, all homozygous dtp
larvae had pronounced liver mitochondrial ultrastructural defects. Second,
mGSH levels were reduced in the liver of deazaA-treated adult fish that had
steatosis. Third, mitochondrial ultrastructure improved in dtp larvae
rescued by tnfa knockdown. The latter finding is noteworthy because
TNF inhibition improves mitochondrial function in mammalian steatosis
models (Garcia-Ruiz et al.,
2006).
In addition to causing mitochondrial dysfunction, methionine metabolism
defects are predicted to alter total cellular methylation potential, as a
reduced SAM:SAH ratio and/or elevated SAH inhibit a wide range of cytosolic
and nuclear methyltransferases (Chiang et
al., 1996). Up to 75% of all mammalian transmethylation reactions
occur in the liver (Xue and Snoswell,
1986), and elevated liver SAH has been shown to inhibit the
methylation of histones, DNA and lipids in a dose-dependent fashion
(Duerre and Briske-Anderson,
1981). Mat1, Pemt and Gnmt knockout mice all
develop steatosis, as do human patients with GNMT deficiency
(Li et al., 2006;
Lu et al., 2001;
Luka et al., 2006;
Martinez-Chantar et al., 2008;
Zhu et al., 2003). Elevated
SAH also causes steatosis and liver degeneration in murine adenosine kinase
deficiency [a model of neonatal hepatitis
(Boison et al., 2002)].
Together, these data suggest that the dtp liver phenotype is caused
by reduced methylation potential. This is likely to arise from a combined
effect on mitochondrial function and, as discussed below, of enhanced
tnfa expression.
|
-induced hepatic steatosis and liver degeneration in hepatic steatosis is well established. Serum
TNF is increased in patients with chronic and acute liver failure
(Felver et al., 1990;
Manco et al., 2007;
Streetz et al., 2000) and
anti-TNF treatment rescues hepatic steatosis and inflammation in animal
models (Barbuio et al., 2007;
Endo et al., 2007;
Garcia-Ruiz et al., 2006;
Koca et al., 2007). TNF
can disrupt lipid metabolism through a variety of mechanisms including
perturbation of mitochondrial function
(Anstee and Goldin, 2006;
Garcia-Ruiz et al., 2006),
activation of lipogenic gene expression, and enhanced uptake of circulating
lipid by the liver (reviewed by Anstee and
Goldin, 2006). TNF can also induce hepatocyte cell death,
particularly in the setting of mitochondrial dysfunction, such as that caused
by elevated SAH (Anstee and Goldin,
2006; Bradham et al.,
1998; Garcia-Ruiz et al.,
2003; Garcia-Ruiz and
Fernandez-Checa, 2006; Song et
al., 2004). Our data point to an effect of Tnf on
mitochondrial function, hepatocyte degeneration and, possibly, lipogenic gene
expression in dtp mutants. We speculate that Tnf might also
enhance the uptake of yolk-derived lipid in dtp larvae.
Given the importance of TNF in mammalian steatosis, we were
interested in identifying the stimulus that activates tnfa expression
in dtp. Reduced clearance of gut bacteria that enter the portal
circulation, coupled with enhanced sensitivity to endotoxin derived from these
resident microbiota, are considered the principal mechanisms of TNF
activation in patients with alcoholic liver disease and NASH
(Bode and Bode, 2005;
Mathurin et al., 2000;
Wigg et al., 2001).
ahcy is strongly expressed in the intestine of zebrafish larvae, and
for this reason we initially thought that altered permeability of the
intestinal epithelium to the gut microbiota might activate tnfa
expression in dtp mutants. However, tnfa expression was
unchanged in gnotobiotic dtp larvae, indicating that there was a
different cause for the enhanced expression.
Because of the known effects of Ahcy inhibition on methylation, we
speculated that an epigenetic mechanism, such as reduced DNA methylation at
the tnfa or another gene locus, could activate tnfa
expression in dtp, such as occurs during hematopoietic stem cell
differentiation (Sullivan et al.,
2007). However, our analysis of the putative tnfa
promoter region in the zebrafish genome database did not identify any CpG
islands, and reduced DNA methylation caused by azaC did not activate
tnfa expression in zebrafish larvae. Thus, we considered changes in
DNA methylation an unlikely cause of enhanced tnfa expression.
Global methylated lysine was also reduced in dtp, raising the
possibility that changes in histone methylation might epigenetically activate
tnfa expression. Supporting this idea, reduced levels of the
inhibitory mark dimethyl-H3K9 correlate with increased TNF expression
in endotoxin-stimulated human mononuclear cells
(El Gazzar et al., 2007). A
reduction in the number of inhibitory trimethyl-H3K27 marks also correlates
with activation of gene expression during development, differentiation and
response to immune stimuli (Agger et al.,
2007; Cloos et al.,
2008; Jepsen et al.,
2007; Lan et al.,
2007). In contrast to these studies suggesting that tnfa
expression can be activated by the removal of inhibitory methyl marks, Ara and
colleagues recently reported that lipopolysaccharide-induced activation of
Tnf expression in mouse macrophages is associated with increased
levels of an activating methyl mark, trimethyl-H3K4, and that this was
inhibited by SAH (Ara et al.,
2008). We speculate that these conflicting data are likely to be
attributable to stimulus- and cell type-dependent changes in methylation
potential, and that Ahcy inhibition in dtp alters the balance between
methylation and demethylation of histone H3 lysine residues associated with
the tnfa promoter, or tnfa regulatory loci, in liver
mononuclear immune cells (Kupffer cells), or possibly even hepatocytes, as
suggested by the tnfa expression pattern in dtp larvae.
Consistent with this model, pharmacological inhibition of Ahcy causes cell
type-specific changes in gene expression in cancer cells and T-cell subsets
(Lawson et al., 2007;
Tan et al., 2007). A related
epigenetic mechanism of gene regulation has also been reported in mouse ES
cells (Pasini et al.,
2008).
In summary, extensive evidence from human liver disease patients, animal
liver disease models and in vitro systems indicates a causative role for
altered methionine metabolism in steatosis, steatohepatitis and liver
degeneration. Our analyses of dtp mutants, adult heterozygous
dtp fish and adult fish treated with the Ahcy inhibitor deazaA extend
these observations to zebrafish. As summarized in
Fig. 7, our data suggest that
tnfa overexpression and mitochondrial dysfunction are the principal
causes of the dtp liver phenotype. This model of TNF-mediated
steatosis is novel as there are no previous reports of altered methylation
potential activating tnfa gene expression. However, as pointed out in
Fig. 7, we cannot exclude the
possibility that other factors contribute to the dtp phenotype.
Relationship of the zebrafish and human Ahcy deficiency phenotypes
Clinical manifestations of human AHCY deficiency have been reported in only
three patients (Baric et al.,
2005; Baric et al.,
2004; Buist et al.,
2006). Motor and neurological defects were the prominent
presenting symptoms in two siblings that are compound heterozygotes for two
hypomorphic AHCY alleles. The first-identified patient also
demonstrated biochemical hepatitis and mitochondrial abnormalities on liver
biopsy at the age of 12 months (Baric et
al., 2004), whereas the second patient had no demonstrable liver
abnormalities, presumably because of an earlier diagnosis at age 3 months
(Baric et al., 2005). A third,
26-year-old patient had comparable motor and neurological symptoms, in
addition to hepatic steatosis and mitochondrial abnormalities evident on liver
electron micrographs (Buist et al.,
2006). It is intriguing that within this group of three
AHCY-deficient patients, there appears to be a progression of mild to moderate
liver disease with age, similar to our findings with the dtp
heterozygotes. By contrast, pronounced hepatic steatosis and degeneration in
homozygous dtp larvae most likely result from the combined effect of
more severe Ahcy deficiency coupled with the rapid rate of hepatic metabolism
of yolk-derived lipid nutrients in zebrafish larvae.
Steatosis in dtp heterozygotes suggest that AHCY polymorphisms might be heritable risk factors for steatosis in liver disease patients
Although heterozygous dtp larvae are indistinguishable from
homozygous wild-type siblings and develop normally with no apparent reduction
in fecundity or lifespan, as adults these fish develop pronounced hepatic
steatosis. Surprisingly, liver SAH levels were not significantly elevated and
SAM levels were elevated 
2-fold, raising the SAM:SAH ratio in these fish.
Comparable SAM and SAH levels were noted in deazaA-treated adult fish that
also developed steatosis. These findings were unexpected, as reduced Ahcy
activity is expected to increase SAH levels and decrease the SAM:SAH ratio. We
speculate that these biochemical findings result from either variable
sensitivity of hepatic methyltransferases to SAH or increasing metabolism of
homocysteine via betaine homocysteine methyltransferase (Bhmt) (see Fig. S5 in
the supplementary material).
Regardless of the mechanism that accounts for the observed SAM and SAH
levels in dtp heterozygous and deazaA-treated adult fish, hepatic
steatosis in these fish raises the question of whether human AHCY
polymorphisms that have only mild effects on methionine metabolism might be a
risk factor for the development of steatosis associated with obesity, alcohol
consumption and other conditions, such as chronic hepatitis C infection or
drug-induced steatosis. Polymorphisms in the methionine metabolism gene
MTHFR and hyperhomocysteinemia have been reported to promote
steatosis and fibrosis in chronic hepatitis C patients
(Adinolfi et al., 2005), and
human AHCY polymorphisms that alter protein thermostability have
already been described (Fumic et al.,
2007). Given the potentially beneficial effects of AHCY inhibitors
in treating cancer and autoimmune diseases
(Hermes et al., 2008;
Lawson et al., 2007;
Tan et al., 2007), the
population of patients that may benefit from AHCY genotyping could
increase significantly in the near future. Molecular analysis of other
zebrafish mutations that cause hepatic steatosis
(Sadler et al., 2005) might
identify additional heritable risk factors.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/5/865/DC1
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Adinolfi, L. E., Ingrosso, D., Cesaro, G., Cimmino, A., D'Anto,
M., Capasso, R., Zappia, V. and Ruggiero, G. (2005).
Hyperhomocysteinemia and the MTHFR C677T polymorphism promote steatosis and
fibrosis in chronic hepatitis C patients. Hepatology
41,995
-1003.[CrossRef][Medline]
Agger, K., Cloos, P. A., Christensen, J., Pasini, D., Rose, S.,
Rappsilber, J., Issaeva, I., Canaani, E., Salcini, A. E. and Helin, K.
(2007). UTX and JMJD3 are histone H3K27 demethylases involved in
HOX gene regulation and development. Nature
449,731
-734.[CrossRef][Medline]
Agrimi, G., Di Noia, M. A., Marobbio, C. M., Fiermonte, G.,
Lasorsa, F. M. and Palmieri, F. (2004). Identification of the
human mitochondrial S-adenosylmethionine transporter: bacterial expression,
reconstitution, functional characterization and tissue distribution.
Biochem. J. 379,183
-190.[CrossRef][Medline]
Anstee, Q. M. and Goldin, R. D. (2006). Mouse
models in non-alcoholic fatty liver disease and steatohepatitis research.
Int. J. Exp. Pathol. 87,1
-16.[CrossRef][Medline]
Ara, A. I., Xia, M., Ramani, K., Mato, J. M. and Lu, S. C.
(2008). S-adenosylmethionine inhibits lipopolysaccharide-induced
gene expression via modulation of histone methylation.
Hepatology 47,1655
-1666.[CrossRef][Medline]
Barbuio, R., Milanski, M., Bertolo, M. B., Saad, M. J. and
Velloso, L. A. (2007). Infliximab reverses steatosis and
improves insulin signal transduction in liver of rats fed a high-fat diet.
J. Endocrinol. 194,539
-550.
Baric, I., Fumic, K., Glenn, B., Cuk, M., Schulze, A.,
Finkelstein, J. D., James, S. J., Mejaski-Bosnjak, V., Pazanin, L., Pogribny,
I. P. et al. (2004). S-adenosylhomocysteine hydrolase
deficiency in a human: a genetic disorder of methionine metabolism.
Proc. Natl. Acad. Sci. USA
101,4234
-4239.
Baric, I., Cuk, M., Fumic, K., Vugrek, O., Allen, R. H., Glenn,
B., Maradin, M., Pazanin, L., Pogribny, I., Rados, M. et al.
(2005). S-Adenosylhomocysteine hydrolase deficiency: a second
patient, the younger brother of the index patient, and outcomes during
therapy. J. Inherit. Metab. Dis.
28,885
-902.[CrossRef][Medline]
Bates, J. M., Mittge, E., Kuhlman, J., Baden, K. N., Cheesman,
S. E. and Guillemin, K. (2006). Distinct signals from the
microbiota promote different aspects of zebrafish gut differentiation.
Dev. Biol. 297,374
-386.[CrossRef][Medline]
Bode, C. and Bode, J. C. (2005). Activation of
the innate immune system and alcoholic liver disease: effects of ethanol per
se or enhanced intestinal translocation of bacterial toxins induced by
ethanol? Alcohol Clin. Exp. Res.
29,166S
-171S.[CrossRef][Medline]
Boison, D., Scheurer, L., Zumsteg, V., Rulicke, T., Litynski,
P., Fowler, B., Brandner, S. and Mohler, H. (2002). Neonatal
hepatic steatosis by disruption of the adenosine kinase gene. Proc.
Natl. Acad. Sci. USA 99,6985
-6990.
Bradham, C. A., Qian, T., Streetz, K., Trautwein, C., Brenner,
D. A. and Lemasters, J. J. (1998). The mitochondrial
permeability transition is required for tumor necrosis factor alpha-mediated
apoptosis and cytochrome c release. Mol. Cell. Biol.
18,6353
-6364.
Browning, J. D. and Horton, J. D. (2004).
Molecular mediators of hepatic steatosis and liver injury. J. Clin.
Invest. 114,147
-152.[CrossRef][Medline]
Buist, N. R., Glenn, B., Vugrek, O., Wagner, C., Stabler, S.,
Allen, R. H., Pogribny, I., Schulze, A., Zeisel, S. H., Baric, I. et al.
(2006). S-adenosylhomocysteine hydrolase deficiency in a
26-year-old man. J. Inherit. Metab. Dis.
29,538
-545.[CrossRef][Medline]
Chiang, P. K. (1998). Biological effects of
inhibitors of S-adenosylhomocysteine hydrolase. Pharmacol.
Ther. 77,115
-134.[CrossRef][Medline]
Chiang, P. K., Gordon, R. K., Tal, J., Zeng, G. C., Doctor, B.
P., Pardhasaradhi, K. and McCann, P. P. (1996).
S-Adenosylmethionine and methylation. FASEB J.
10,471
-480.[Abstract]
Chung, H., Hong, D. P., Kim, H. J., Jang, K. S., Shin, D. M.,
Ahn, J. I., Lee, Y. S. and Kong, G. (2005). Differential gene
expression profiles in the steatosis/fibrosis model of rat liver by chronic
administration of carbon tetrachloride. Toxicol. Appl.
Pharmacol. 208,242
-254.[CrossRef][Medline]
Cloos, P. A., Christensen, J., Agger, K. and Helin, K.
(2008). Erasing the methyl mark: histone demethylases at the
center of cellular differentiation and disease. Genes
Dev. 22,1115
-1140.
Colell, A., Garcia-Ruiz, C., Morales, A., Ballesta, A.,
Ookhtens, M., Rodes, J., Kaplowitz, N. and Fernandez-Checa, J. C.
(1997). Transport of reduced glutathione in hepatic mitochondria
and mitoplasts from ethanol-treated rats: effect of membrane physical
properties and S-adenosyl-L-methionine. Hepatology
26,699
-708.[Medline]
Deaciuc, I. V., Doherty, D. E., Burikhanov, R., Lee, E. Y.,
Stromberg, A. J., Peng, X. and de Villiers, W. J. (2004).
Large-scale gene profiling of the liver in a mouse model of chronic,
intragastric ethanol infusion. J. Hepatol.
40,219
-227.[CrossRef][Medline]
Diehl, A. M. (2005). Lessons from animal models
of NASH. Hepatol. Res.
33,138
-144.[CrossRef][Medline]
Duerre, J. A. and Briske-Anderson, M. (1981).
Effect of adenosine metabolites on methyltransferase reactions in isolated rat
livers. Biochim. Biophys. Acta
678,275
-282.[Medline]
Duong, F. H., Christen, V., Filipowicz, M. and Heim, M. H.
(2006). S-Adenosylmethionine and betaine correct hepatitis C
virus induced inhibition of interferon signaling in vitro.
Hepatology 43,796
-806.[CrossRef][Medline]
El Gazzar, M., Yoza, B. K., Hu, J. Y., Cousart, S. L. and
McCall, C. E. (2007). Epigenetic silencing of tumor necrosis
factor alpha during endotoxin tolerance. J. Biol.
Chem. 282,26857
-26864.
Endo, M., Masaki, T., Seike, M. and Yoshimatsu, H.
(2007). TNF-alpha induces hepatic steatosis in mice by enhancing
gene expression of sterol regulatory element binding protein-1c (SREBP-1c).
Exp. Biol. Med. 232,614
-621.
Esfandiari, F., Villanueva, J. A., Wong, D. H., French, S. W.
and Halsted, C. H. (2005). Chronic ethanol feeding and folate
deficiency activate hepatic endoplasmic reticulum stress pathway in micropigs.
Am. J. Physiol. Gastrointest. Liver Physiol.
289,G54
-G63.
Felver, M. E., Mezey, E., McGuire, M., Mitchell, M. C., Herlong,
H. F., Veech, G. A. and Veech, R. L. (1990). Plasma tumor
necrosis factor alpha predicts decreased long-term survival in severe
alcoholic hepatitis. Alcohol Clin. Exp. Res.
14,255
-259.[CrossRef][Medline]
Fromenty, B., Robin, M. A., Igoudjil, A., Mansouri, A. and
Pessayre, D. (2004). The ins and outs of mitochondrial
dysfunction in NASH. Diabetes Metab.
30,121
-138.[Medline]
Fumic, K., Beluzic, R., Cuk, M., Pavkov, T., Kloor, D., Baric,
I., Mijic, I. and Vugrek, O. (2007). Functional analysis of
human S-adenosylhomocysteine hydrolase isoforms SAHH-2 and SAHH-3.
Eur. J. Hum. Genet. 15,347
-351.[CrossRef][Medline]
Garcia-Ruiz, C. and Fernandez-Checa, J. C.
(2006). Mitochondrial glutathione: hepatocellular survival-death
switch. J. Gastroenterol. Hepatol.
21 Suppl. 3,S3
-S6.[CrossRef][Medline]
Garcia-Ruiz, C., Colell, A., Mari, M., Morales, A., Calvo, M.,
Enrich, C. and Fernandez-Checa, J. C. (2003). Defective
TNF-alpha-mediated hepatocellular apoptosis and liver damage in acidic
sphingomyelinase knockout mice. J. Clin. Invest.
111,197
-208.[CrossRef][Medline]
Garcia-Ruiz, I., Rodriguez-Juan, C., Diaz-Sanjuan, T., del Hoyo,
P., Colina, F., Munoz-Yague, T. and Solis-Herruzo, J. A.
(2006). Uric acid and anti-TNF antibody improve mitochondrial
dysfunction in ob/ob mice. Hepatology
44,581
-591.[CrossRef][Medline]
Guranowski, A., Montgomery, J. A., Cantoni, G. L. and Chiang, P.
K. (1981). Adenosine analogues as substrates and inhibitors
of S-adenosylhomocysteine hydrolase. Biochemistry
20,110
-115.[CrossRef][Medline]
Hermes, M., Geisler, H., Osswald, H., Riehle, R. and Kloor,
D. (2008). Alterations in S-adenosylhomocysteine metabolism
decrease O6-methylguanine DNA methyltransferase gene expression without
affecting promoter methylation. Biochem. Pharmacol.
75,2100
-2111.[CrossRef][Medline]
Hoek, J. B. and Pastorino, J. G. (2002).
Ethanol, oxidative stress, and cytokine-induced liver cell injury.
Alcohol 27,63
-68.[CrossRef][Medline]
Horne, D. W., Holloway, R. S. and Wagner, C.
(1997). Transport of S-adenosylmethionine in isolated rat liver
mitochondria. Arch. Biochem. Biophys.
343,201
-206.[CrossRef][Medline]
Hu, Y., Komoto, J., Huang, Y., Gomi, T., Ogawa, H., Takata, Y.,
Fujioka, M. and Takusagawa, F. (1999). Crystal structure of
S-adenosylhomocysteine hydrolase from rat liver.
Biochemistry 38,8323
-8333.[CrossRef][Medline]
Hu, Y., Yang, X., Yin, D. H., Mahadevan, J., Kuczera, K.,
Schowen, R. L. and Borchardt, R. T. (2001). Computational
characterization of substrate binding and catalysis in S-adenosylhomocysteine
hydrolase. Biochemistry
40,15143
-15152.[CrossRef][Medline]
Innis, S. M. and Hasman, D. (2006). Evidence of
choline depletion and reduced betaine and dimethylglycine with increased
homocysteine in plasma of children with cystic fibrosis. J.
Nutr. 136,2226
-2231.
Jepsen, K., Solum, D., Zhou, T., McEvilly, R. J., Kim, H. J.,
Glass, C. K., Hermanson, O. and Rosenfeld, M. G. (2007).
SMRT-mediated repression of an H3K27 demethylase in progression from neural
stem cell to neuron. Nature
450,415
-419.[CrossRef][Medline]
Jones, P. A. and Taylor, S. M. (1980). Cellular
differentiation, cytidine analogs and DNA methylation.
Cell 20,85
-93.[CrossRef][Medline]
Kharbanda, K. K. (2007). Role of
transmethylation reactions in alcoholic liver disease. World J.
Gastroenterol. 13,4947
-4954.[Medline]
Koca, S. S., Bahcecioglu, I. H., Poyrazoglu, O. K., Ozercan, I.
H., Sahin, K. and Ustundag, B. (2007). The treatment with
antibody of TNF-alpha Reduces the inflammation, necrosis and fibrosis in the
non-alcoholic steatohepatitis induced by methionine- and choline-deficient
diet. Inflammation 31,91
-98.[CrossRef][Medline]
Lan, F., Bayliss, P. E., Rinn, J. L., Whetstine, J. R., Wang, J.
K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E. et al.
(2007). A histone H3 lysine 27 demethylase regulates animal
posterior development. Nature
449,689
-694.[CrossRef][Medline]
Lawson, B. R., Manenkova, Y., Ahamed, J., Chen, X., Zou, J. P.,
Baccala, R., Theofilopoulos, A. N. and Yuan, C. (2007).
Inhibition of transmethylation down-regulates CD4 T cell activation and
curtails development of autoimmunity in a model system. J.
Immunol. 178,5366
-5374.
Li, Q. S., Cai, S., Borchardt, R. T., Fang, J., Kuczera, K.,
Middaugh, C. R. and Schowen, R. L. (2007). Comparative
kinetics of cofactor association and dissociation for the human and
trypanosomal S-adenosylhomocysteine hydrolases. 1. Basic features of the
association and dissociation processes. Biochemistry
46,5798
-5809.[CrossRef][Medline]
Li, Z., Agellon, L. B., Allen, T. M., Umeda, M., Jewell, L.,
Mason, A. and Vance, D. E. (2006). The ratio of
phosphatidylcholine to phosphatidylethanolamine influences membrane integrity
and steatohepatitis. Cell Metab.
3, 321-331.[CrossRef][Medline]
Lorent, K., Yeo, S. Y., Oda, T., Chandrasekharappa, S., Chitnis,
A., Matthews, R. P. and Pack, M. (2004). Inhibition of
Jagged-mediated Notch signaling disrupts zebrafish biliary development and
generates multi-organ defects compatible with an Alagille syndrome phenocopy.
Development 131,5753
-5766.
Lu, S. C., Alvarez, L., Huang, Z. Z., Chen, L., An, W.,
Corrales, F. J., Avila, M. A., Kanel, G. and Mato, J. M.
(2001). Methionine adenosyltransferase 1A knockout mice are
predisposed to liver injury and exhibit increased expression of genes involved
in proliferation. Proc. Natl. Acad. Sci. USA
98,5560
-5565.
Lu, S. C., Tsukamoto, H. and Mato, J. M.
(2002). Role of abnormal methionine metabolism in alcoholic liver
injury. Alcohol 27,155
-162.[CrossRef][Medline]
Luka, Z., Capdevila, A., Mato, J. M. and Wagner, C.
(2006). A glycine N-methyltransferase knockout mouse model for
humans with deficiency of this enzyme. Transgenic Res.
15,393
-397.[CrossRef][Medline]
Manco, M., Marcellini, M., Giannone, G. and Nobili, V.
(2007). Correlation of serum TNF-alpha levels and histologic
liver injury scores in pediatric nonalcoholic fatty liver disease.
Am. J. Clin. Pathol.
127,954
-960.
Mari, M., Caballero, F., Colell, A., Morales, A., Caballeria,
J., Fernandez, A., Enrich, C., Fernandez-Checa, J. C. and Garcia-Ruiz, C.
(2006). Mitochondrial free cholesterol loading sensitizes to TNF-
and Fas-mediated steatohepatitis. Cell Metab.
4, 185-198.[CrossRef][Medline]
Martinez-Chantar, M. L., Vazquez-Chantada, M., Ariz, U.,
Martinez, N., Varela, M., Luka, Z., Capdevila, A., Rodriguez, J., Aransay, A.
M., Matthiesen, R. et al. (2008). Loss of the glycine
N-methyltransferase gene leads to steatosis and hepatocellular carcinoma in
mice. Hepatology 47,1191
-1199.[CrossRef][Medline]
Mathurin, P., Deng, Q. G., Keshavarzian, A., Choudhary, S.,
Holmes, E. W. and Tsukamoto, H. (2000). Exacerbation of
alcoholic liver injury by enteral endotoxin in rats.
Hepatology 32,1008
-1017.[CrossRef][Medline]
Mato, J. M., Martinez-Chantar, M. L. and Lu, S. C.
(2008). Methionine metabolism and liver disease. Annu.
Rev. Nutr. 28,273
-293.[CrossRef][Medline]
Matthews, R. P., Lorent, K., Russo, P. and Pack, M.
(2004). The zebrafish onecut gene hnf-6 functions in an
evolutionarily conserved genetic pathway that regulates vertebrate biliary
development. Dev. Biol.
274,245
-259.[CrossRef][Medline]
Matthews, R. P., Plumb-Rudewiez, N., Lorent, K., Gissen, P.,
Johnson, C. A., Lemaigre, F. and Pack, M. (2005). Zebrafish
vps33b, an ortholog of the gene responsible for human arthrogryposis-renal
dysfunction-cholestasis syndrome, regulates biliary development downstream of
the onecut transcription factor hnf6. Development
132,5295
-5306.
McMaster, C. R. and Bell, R. M. (1997).
CDP-choline:1,2-diacylglycerol cholinephosphotransferase. Biochim.
Biophys. Acta 1348,100
-110.[Medline]
Miller, M. W., Duhl, D. M., Winkes, B. M., Arredondo-Vega, F.,
Saxon, P. J., Wolff, G. L., Epstein, C. J., Hershfield, M. S. and Barsh, G.
S. (1994). The mouse lethal nonagouti (a(x)) mutation deletes
the S-adenosylhomocysteine hydrolase (Ahcy) gene. EMBO
J. 13,1806
-1816.[Medline]
Pasini, D., Hansen, K. H., Christensen, J., Agger, K., Cloos, P.
A. and Helin, K. (2008). Coordinated regulation of
transcriptional repression by the RBP2 H3K4 demethylase and
Polycomb-Repressive Complex 2. Genes Dev.
22,1345
-1355.
Rawls, J. F., Samuel, B. S. and Gordon, J. I.
(2004). Gnotobiotic zebrafish reveal evolutionarily conserved
responses to the gut microbiota. Proc. Natl. Acad. Sci.
USA 101,4596
-4601.
Sadler, K. C., Amsterdam, A., Soroka, C., Boyer, J. and Hopkins,
N. (2005). A genetic screen in zebrafish identifies the
mutants vps18, nf2, and foie gras as models of liver disease.
Development 132,3561
-3572.
Song, Z., Zhou, Z., Uriarte, S., Wang, L., Kang, Y. J., Chen,
T., Barve, S. and McClain, C. J. (2004).
S-adenosylhomocysteine sensitizes to TNF-alpha hepatotoxicity in mice and
liver cells: a possible etiological factor in alcoholic liver disease.
Hepatology 40,989
-997.[CrossRef][Medline]
Song, Z., Zhou, Z., Song, M., Uriarte, S., Chen, T., Deaciuc, I.
and McClain, C. J. (2007). Alcohol-induced
S-adenosylhomocysteine accumulation in the liver sensitizes to TNF
hepatotoxicity: possible involvement of mitochondrial S-adenosylmethionine
transport. Biochem. Pharmacol.
74,521
-531.[CrossRef][Medline]
Stenkamp, D. L. and Frey, R. A. (2003).
Extraretinal and retinal hedgehog signaling sequentially regulate retinal
differentiation in zebrafish. Dev. Biol.
258,349
-363.[CrossRef][Medline]
Streetz, K., Leifeld, L., Grundmann, D., Ramakers, J., Eckert,
K., Spengler, U., Brenner, D., Manns, M. and Trautwein, C.
(2000). Tumor necrosis factor alpha in the pathogenesis of human
and murine fulminant hepatic failure. Gastroenterology
119,446
-460.[CrossRef][Medline]
Sullivan, K. E., Reddy, A. B., Dietzmann, K., Suriano, A. R.,
Kocieda, V. P., Stewart, M. and Bhatia, M. (2007). Epigenetic
regulation of tumor necrosis factor alpha. Mol. Cell.
Biol. 27,5147
-5160.
Tan, J., Yang, X., Zhuang, L., Jiang, X., Chen, W., Lee, P. L.,
Karuturi, R. K., Tan, P. B., Liu, E. T. and Yu, Q. (2007).
Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene
repression selectively induces apoptosis in cancer cells. Genes
Dev. 21,1050
-1063.
Tanaka, N., Nakanishi, M., Kusakabe, Y., Shiraiwa, K., Yabe, S.,
Ito, Y., Kitade, Y. and Nakamura, K. T. (2004). Crystal
structure of S-adenosyl-L-homocysteine hydrolase from the human malaria
parasite Plasmodium falciparum. J. Mol. Biol.
343,1007
-1017.[CrossRef][Medline]
Thakur, V., McMullen, M. R., Pritchard, M. T. and Nagy, L.
E. (2007). Regulation of macrophage activation in alcoholic
liver disease. J. Gastroenterol. Hepatol.
22 Suppl. 1,S53
-S56.[CrossRef][Medline]
Tomita, K., Tamiya, G., Ando, S., Ohsumi, K., Chiyo, T.,
Mizutani, A., Kitamura, N., Toda, K., Kaneko, T., Horie, Y. et al.
(2006). Tumour necrosis factor alpha signalling through
activation of Kupffer cells plays an essential role in liver fibrosis of
non-alcoholic steatohepatitis in mice. Gut
55,415
-424.
Turner, M. A., Yuan, C. S., Borchardt, R. T., Hershfield, M. S.,
Smith, G. D. and Howell, P. L. (1998). Structure
determination of selenomethionyl S-adenosylhomocysteine hydrolase using data
at a single wavelength. Nat. Struct. Biol.
5, 369-376.[CrossRef][Medline]
Villanueva, J. A. and Halsted, C. H. (2004).
Hepatic transmethylation reactions in micropigs with alcoholic liver disease.
Hepatology 39,1303
-1310.[CrossRef][Medline]
Wallace, K. N. and Pack, M. (2003). Unique and
conserved aspects of gut development in zebrafish. Dev.
Biol. 255,12
-29.[CrossRef][Medline]
Wigg, A. J., Roberts-Thomson, I. C., Dymock, R. B., McCarthy, P.
J., Grose, R. H. and Cummins, A. G. (2001). The role of small
intestinal bacterial overgrowth, intestinal permeability, endotoxaemia, and
tumour necrosis factor alpha in the pathogenesis of non-alcoholic
steatohepatitis. Gut 48,206
-211.
Wortham, M., He, L., Gyamfi, M., Copple, B. L. and Wan, Y.
J. (2008). The transition from fatty Liver to NASH associates
with SAMe depletion in db/db mice fed a methionine choline-deficient diet.
Dig. Dis. Sci. 53,2761
-2764.[CrossRef][Medline]
Xue, G. P. and Snoswell, A. M. (1986).
Quantitative evaluation and regulation of S-adenosylmethionine-dependent
transmethylation in sheep tissues. Comp. Biochem. Physiol.
B 85,601
-608.[CrossRef][Medline]
Yee, N. S., Lorent, K. and Pack, M. (2005).
Exocrine pancreas development in zebrafish. Dev. Biol.
284,84
-101.[CrossRef][Medline]
Younossi, Z. M., Gorreta, F., Ong, J. P., Schlauch, K., Giacco,
L. D., Elariny, H., Van Meter, A., Younoszai, A., Goodman, Z., Baranova, A. et
al. (2005). Hepatic gene expression in patients with
obesity-related non-alcoholic steatohepatitis. Liver
Int. 25,760
-771.[CrossRef][Medline]
Zhu, X., Song, J., Mar, M. H., Edwards, L. J. and Zeisel, S.
H. (2003). Phosphatidylethanolamine N-methyltransferase
(PEMT) knockout mice have hepatic steatosis and abnormal hepatic choline
metabolite concentrations despite ingesting a recommended dietary intake of
choline. Biochem. J.
370,987
-993.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Forlenza, S. Magez, J. P. Scharsack, A. Westphal, H. F. J. Savelkoul, and G. F. Wiegertjes Receptor-Mediated and Lectin-Like Activities of Carp (Cyprinus carpio) TNF-{alpha} J. Immunol., October 15, 2009; 183(8): 5319 - 5332. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
P<0.05; NS, not
significant (P=0.3). (D) Calculated SAM:SAH ratio for the four
conditions in C. Differences in the SAM:SAH ratio between B and D arise from
experimental variation. (E) Anti-methylcytosine (
