|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online February 20, 2009
doi: 10.1242/10.1242/dev.028415
Helmholtz Zentrum München, Institute of Stem Cell Research, Ingolstädter Landstrasse 1, 85764 Neuherberg, Germany.
* Author for correspondence (e-mail: heiko.lickert{at}helmholtz-muenchen.de)
Accepted 15 January 2009
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Foxa2, Brachyury, Epithelial-mesenchymal transition, Mesenchymal-epithelial transition, Morphogenesis, Cell polarity, Cell adhesion, Epithelialization, Gastrulation, Germ-layer formation, Time-lapse imaging
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
Pluripotent epiblast cells constitute the progenitor cells for all cell
lineages in the embryo proper and differentiate to form the three principal
germ layers: endoderm, mesoderm and ectoderm
(Beddington and Robertson,
1999; Tam and Loebel,
2007). Clonal analysis of epiblast cell fate revealed that in the
early-streak embryo at E6.5, the proximal one-third of the posterior epiblast
contains the precursors of the extra-embryonic mesoderm and the primordial
germ cells. By contrast, the distal region of the epiblast contains the
precursors of the entire neural ectoderm, and the intermediate posterior
epiblast contains the precursors for the anterior mesoderm and definitive
endoderm (Lawson et al., 1991;
Lawson and Pedersen, 1992;
Tam and Beddington, 1992;
Lawson and Hage, 1994). Clonal
descendants were not necessarily confined to a single germ layer, indicating
that these lineages are not separated at the beginning of gastrulation. In
support of this notion are embryonic stem (ES) cell differentiation
experiments (Kubo et al.,
2004), as well as conditional gene targeting results, indicating
that bipotential mesendodermal progenitor cell populations exist
(Lickert et al., 2002) (for a
review, see Rodaway and Patient,
2001). At various stages of gastrulation, the primitive streak
(PS) has been shown to contain precursor cells of different mesodermal and
endodermal lineages that are destined for different parts of the body
(Kinder et al., 1999;
Kinder et al., 2001).
Therefore, allocation of mesoderm and endoderm in the embryo takes place in an
anteroposterior (AP) manner determined by the timing and order of recruitment
through the PS. The majority of definitive endodermal (DE) cells ingress
through the anterior end of the primitive streak (APS) at the mid-streak (MS)
stage and intercalate into the overlying VE to give rise to the foregut
(Kwon et al., 2008); however,
a small population of DE cells might directly delaminate into the VE from the
epiblast (Tam and Beddington,
1992). Taken together, these studies clearly indicate that
mesoderm and endoderm are specified in a spatiotemporal manner during
gastrulation; however, it is not clear if these cells become specified in the
epiblast or PS region and when these cells differentiate into morphological
and molecular distinct cell populations.
The T-box transcription factor brachyury (T) was shown to mark progenitor
cells for mesoderm and endoderm in ES cell differentiation cultures,
suggesting that these cells originate from a common progenitor
(Kubo et al., 2004). In the
mouse embryo, T protein is localized in the posterior epiblast at the
early-streak stage and is detected in nascent mesoderm in the PS region during
gastrulation, as well as in the node and notochord from the late-streak (LS)
stage onwards (Inman and Downs,
2006). T localization in the mesoderm and notochord suggests that
abnormalities in these cell populations are responsible for the homozygous
mutant phenotype (Wilkinson et al.,
1990). By contrast, Foxa2 is also expressed in the
posterior epiblast from the early stage onwards and is then confined to
anterior definitive endoderm (ADE) and axial mesoderm, which consists of the
head process, prechordal plate, notochord and node
(Sasaki and Hogan, 1993;
Monaghan et al., 1993).
Foxa2 is a member of the Forkhead transcription factor family, which
includes three related transcription factors: Foxa1, Foxa2 and Foxa3, first
identified by their ability to regulate liver-specific gene expression
(Lai et al., 1990;
Lai et al., 1991). A null
mutation of the Foxa2 gene leads to absence of ADE and axial mesoderm
(Ang and Rossant, 1994;
Weinstein et al., 1994). Foxa1
and Foxa3 are expressed from E7.5 onwards in the definitive endoderm and can
compensate for the loss of Foxa2 in the null mutants, which allows hindgut,
but not fore- and midgut formation (Sasaki
and Hogan, 1993; Monaghan et
al., 1993; Ang and Rossant,
1994; Weinstein et al.,
1994; Dufort et al.,
1998). These results collectively demonstrate that T and Foxa2 are
functionally important for mesoderm and endoderm development; however, it is
not clear how these transcription factors regulate a molecular and cellular
program for the differentiation of these cell populations.
In addition to cellular differentiation, the gastrulating embryo also
undergoes dramatic morphological changes to form the three principal germ
layers and the basic body plan. One of the first morphogenetic events is the
formation of the PS when signals and factors trigger epithelial-mesenchymal
transition (EMT) of epiblast cells to give rise to mesoderm and endoderm
(Thiery and Sleeman, 2006).
During this process, epiblast cells lose their apical-basal (AB) epithelial
polarity, downregulate the cell-cell adhesion molecule E-cadherin (cadherin 1
– Mouse Genome Informatics) and break through the basement membrane (BM)
to invade into the PS region. The interstitial mesodermal cells acquire a
mesenchymal cellular fate and migrate over long distances between the endoderm
and the ectoderm germ layer before they re-aggregate to form distinct organs
such as the heart or kidney. By contrast, cells that are fate-specified to
become DE appear in the APS region from MS to LS stage
(Lawson et al., 1991;
Tam et al., 1997;
Kinder et al., 2001;
Tam and Beddington, 1992).
These cells acquire an epithelial fate and intercalate into the outside
epithelium, but it is not clear if these cells undergo EMT followed by
mesenchymal-epithelial transition or alternatively maintain epithelial
polarity and just transiently downregulate cell-cell adhesion molecules to
leave the epiblast epithelium. By the end of gastrulation the germ layers have
formed and have already acquired AP, dorsoventral (DV) and left-right (LR)
patterning information through signals from the embryonic organizer tissues,
which include anterior VE, ADE, axial mesoderm, node, notochord and floorplate
(Tam and Loebel, 2007).
Functional analysis of genes in mouse has greatly contributed to the
understanding of germ-layer formation in the mouse embryo; however, the
phenotypic analysis has been hampered by static techniques that often only
describe end points, as well as the fact that embryogenesis in all placental
mammals occurs in utero and is not easily amenable to ex vivo observation. The
establishment of static embryo culture systems and the genetic introduction of
fluorescent marker proteins in transgenic animals has now allowed for direct
imaging of mouse embryogenesis (Yamanaka
et al., 2007; Kwon et al.,
2008). In this study, we established an ex utero static embryo
culture system to continuously monitor the cellular processes occurring during
germ-layer formation. The generation of genetic mosaics using aggregation
chimera allowed us to distinguish embryonic and extra-embryonic lineages using
fluorescent labels in order to follow mesoderm and endoderm formation at
cellular resolutions. We present evidence for a specific role of Foxa2 in the
formation of polarized and epithelialized cell types, namely the definitive
endoderm and axial mesoderm (node and notochord).
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
For generation of Lyn-Tomato, an oligonucleotide was subcloned between the
NotI and XbaI sites in the pBKS vector in front of the
td-Tomato: Lyn-Oligo fwd,
5'-GGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGCCACCATGGGATGTATTAAATCAAAAAGGAAAGACGGGGCCCGGTACT;
Lyn-Oligo rev,
5'-CTAGAGTACCGGGCCCCGTCTTTCCTTTTTGATTTAATACATCCCATGGTGGCATAACTTCGTATAATGTATGCTATACGAAGTTATGCTTATGC.
The NotI/SpeI-digested fluorescent markers were subcloned
into the NotI/NheI sites of the eukaryotic expression vector
pCAGGS (Niwa et al.,
1991).
Generation of fluorescent reporter ES cell lines
The fluorescent ES cell and mouse lines used in this study were generated
by electroporation of ScaI-linearized pCAGGS vector DNA containing
dsRed, YFP or Lyn-Tomato into wild-type IDG3.2 ES cells
(Hitz et al., 2007) or
Foxa2–/– R1 ES cells (Ang et al., 1994). Cells
were selected with 1 µg/ml puromycin, and resistant clones were screened
for uniform and ubiquitous reporter expression in cell culture and in vivo
using embryos derived from ES cells.
Generation of chimeras and mouse lines
Diploid or tetraploid chimeras were generated according to standard
protocols (Nagy, 2003).
Embryos were collected from dsRed-
(Vintersten et al., 2004) and
YFP- (Hadjantonakis et al.,
2002) expressing mouse lines, both maintained on mixed genetic
backgrounds (CD1/129Sv/C57/Bl6). T-GFP targeting construct was used
to generate ES cells and a mouse line as previously described
(Fehling et al., 2003).
Time-lapse live imaging
Embryos were dissected in DMEM containing 10% FCS and 20 mM HEPES. Embryos
were cultured on glass-bottom dishes using 200 µl embryo culture medium
(50% rat serum, 40% DMEM without Phenol Red, 2 mM glutamine, 100 µM
2-mercaptoethanol and 1 mM sodium pyruvate in a 37°C incubator with 5%
CO2 and 5% O2). To avoid evaporation the medium was
covered with mineral oil. Image acquisition was performed on a Leica DMI 6000
confocal microscope and image analysis was carried out using Leica LAS AF
software.
Statistical analysis
Cell measurements were carried out using Leica LAS AF software. Average and
standard deviation are shown in the graphs. P-values were determined
using a two-tailed Student's t-test with unequal variance with the
number of cells and embryos stated in the figure legends.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as previously described
(Lickert at al., 2002). The
following probes were used: Eomes
(Ciruna and Rossant, 1999),
Hex (Hhex – Mouse Genome Informatics)
(Thomas et al., 1998) and
claudin 4 (RZPDp981G04226D). Embryos were photographed using a Zeiss Stereo
Lumar V12 microscope.
Antibodies and immunohistochemistry
Immunofluorescence whole-mount stainings were performed as previously
described (Nakaya et al.,
2005). Briefly, embryos were isolated, fixed for 20 minutes in 2%
PFA in PBS, and then permeabilized in 0.1% Triton X-100 in 0.1 M glycine pH
8.0. After blocking in 10% FCS, 3% goat serum, 0.1% BSA, 0.1% Tween 20 for 2
hours, embryos were incubated with the primary antibody o/n at 4°C in
blocking solution. After several washes in PBS containing 0.1% Tween-20 (PBST)
embryos were incubated with secondary antibodies (donkey anti-mouse 594,
donkey anti-rabbit 488, donkey anti-goat 594 Alexa fluor, Molecular Probes) in
blocking solution for 3 hours. During the final washes with PBST, embryos were
stained with 4',6-diamidino-2-phenylindole, dihydrochloride (DAPI),
transferred into 40% glycerol and embedded between two coverslips using 120
µm Secure-Seal spacers (Invitrogen, S24737) and ProLong Gold antifade
reagent (Invitrogen, P36930). Antibodies: Foxa2 (Abcam, Ab408749), brachyury
(N-19, Santa Cruz), GFP (A11122, Invitrogen), E-cadherin (610181, BD), ZO-1
(Tjp1 – Mouse Genome Informatics) (33-9100, Zymed).
|
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Weinstein et al., 1994),
whereas the T-box transcription factor brachyury (T) is necessary for
posterior, but not anterior, mesoderm formation
(Wilkinson et al., 1990). As
previously reported, the mRNAs for both genes are expressed during
gastrulation in the posterior epiblast, but it was not clear whether the
proteins are synthesized in the same cells of the epiblast and
epiblast-derived mesoderm and endoderm descendants
(Sasaki and Hogan, 1993;
Monaghan et al., 1993;
Herrmann, 1991). To
investigate the cellular distribution of these two transcription factors
during gastrulation, we used whole-mount immunohistochemistry (IHC) with
antibodies to T and Foxa2 and laser scanning microscopy (LSM) of fixed
embryos. Surprisingly, in pre-streak-stage embryos the double
immunofluorescent antibody staining revealed that T and Foxa2 protein was
synthesized in two intermingled, but mutually exclusive, cell populations in
the posterior epiblast (Fig.
1A; see Fig. S1A in the supplementary material). At MS stage,
these two cell populations segregated into proximal and distal domains of the
posterior epiblast (Fig. 1B;
see Fig. S2 in the supplementary material). Proximal epiblast cells upregulate
T protein after EMT and show a round, mesenchymal cellular phenotype in the PS
region (Inman and Downs,
2006), whereas distal epiblast cells upregulate Foxa2 protein
after EMT and show a flattened cell morphology (see Fig. S2 in the
supplementary material). Interestingly, Foxa2-expressing flattened cells
appeared anterior to the anatomical end of the PS, forming a two-cell-diameter
row of polarized cells (see Fig. S2D, white arrows, in the supplementary
material). From fate maps (Tam and
Beddington, 1992) and our imaging results (see
Fig. 2 below), this seems to be
the region in which the first DE cells appear at the surface, suggesting that
a small population of DE cells might directly delaminate into the outside VE.
At the LS stage, only epiblast cells underlying the APS were Foxa2-positive
and showed signs of EMT (Fig.
1C; see Fig. S1B in the supplementary material). We could clearly
distinguish three cell populations in the PS region: T-positive posterior
mesoderm; Foxa2- and T-double-positive axial mesoderm; and Foxa2-positive VE
and DE populations. At the LS stage, we could rarely detect single
Foxa2-positive cells in the APS region. This implies that Foxa2+
epiblast cells quickly upregulate T protein after EMT, which suggests that
cells for the axial mesoderm are recruited from the APS region
(Kinder et al., 2001). These
results collectively indicate that endoderm and mesoderm is specified in the
epiblast and differentiates after EMT, which can be distinguished by
morphology and marker gene expression. Interestingly, Foxa2 epiblast precursor
cells gave rise to polarized and epithelialized endoderm and axial mesoderm,
including the polarized and epithelialized cells of the node and
notochord.
|
). To this
end, we analyzed germ-layer formation using aggregation chimera, which allowed
us to label the embryonic and extra-embryonic lineages by means of different
fluorescent marker genes (Fig.
2A). In tetraploid (4n) or diploid (2n) embryo 
wild-type 9
(wt) ES cell aggregation chimera (hereafter called 2n/4n wt chimera),
the ES cells can only contribute to the embryonic epiblast, whereas the
extra-embryonic lineages are always formed by the cells of the 2n or 4n embryo
(Tam and Rossant, 2003).
Therefore, using 2n and 4n chimera allowed us to distinguish between embryonic
lineages, namely ectoderm, mesoderm and DE, and extra-embryonic lineages,
specifically trophectoderm and VE. Generating 2n chimera allowed us
additionally to generate genetic mosaics in the epiblast to study mutant cells
in an otherwise wild-type environment. For the time-lapse imaging we used an
inverse confocal microscope in combination with a static embryo culture system
(Fig. 2B). Analyzing single
optical sections using LSM at the mid-sagittal and surface level of fixed 4n
chimeras revealed that the epiblast was always completely derived from the ES
cells at the pre-streak stage (E6.5) and was covered by a single-layered
epithelium of VE from the 4n embryo (Fig.
2C) (n>100). As predicted from fate map studies of the
mouse embryo (Lawson et al.,
1991; Lawson and Pedersen,
1992; Tam and Beddington,
1992), the first DE cells were recruited from the epiblast and
intercalated into the surface VE in the APS region at MS stage
(Fig. 2C). By the LS stage, the
recruitment of DE was almost finished and the VE was mostly displaced by DE
(Fig. 2C). From these results
we concluded that fluorescent-lineage tagging using aggregation chimeras
generates useful genetic mosaics to monitor cellular processes and lineage
allocation in the pre- to LS-stage embryo. Next we performed time-lapse live
imaging analysis using LSM of static immobilized 4n dsRed wt YFP
chimera during gastrulation (Fig.
2D). As already indicated by our analysis of fixed MS chimera
(Fig. 2C), DE cells formed in
the APS region and intercalated into the overlying VE at this developmental
stage (Fig. 2D; see Movie 1 in
the supplementary material). The time-lapse analysis revealed that the DE and
the mesoderm populations are morphologically distinct cell populations in the
PS region, even before the DE cells intercalate into the outside VE
(Fig. 2D) (time
0:00–0:39). The DE cells showed flat morphology and had an average
length-width ratio of 4:1 (l=13.1±1.7 µm; w=3.24±0.67 µm;
l/w=4.21±0.9; n=50), whereas the mesoderm cells showed a
characteristic round morphology with an approximate length-width ratio of
1.4:1 (l=7.73±1.54 µm; w=5.63±1.16 µm;
l/w=1.41±0.36; n=50) at LS stage. Furthermore, T-positive
mesoderm cells and Foxa2-positive endoderm cells showed distinct morphology at
the MS stage (see Fig. S2 in the supplementary material), indicating that
mesoderm and endoderm can be distinguished by marker gene expression and
morphology. This observation is consistent with results previously obtained in
zebrafish (Warga and
Nüsslein-Volhard, 1999), demonstrating that mesoderm and
endoderm cell populations can also be distinguished by morphological criteria
in higher vertebrates and that these cell populations are specified in the
epiblast (Fig. 1) and
differentiate and segregate in the PS region
(Fig. 2).
|
) and analyzed genetic mosaics using LSM. In 4n wt
chimeras, DE cells intercalated into the outside VE in the APS region from MS
stage onwards and displaced and dispersed the VE by the LS stage
(Fig. 3A) (n>20).
In striking contrast, all 4n Foxa2–/–
chimeras showed no sign of DE intercalation and failed to form an anatomical
node at the distal tip of the embryo even at the end of LS stage, indicating
that the node and definitive endoderm cells are either not formed or that
these cells do not reach the surface epithelial layer
(Fig. 3A) (n>30).
We noticed that cells accumulated in the APS region and frequently led to an
indentation of posterior epiblast epithelium into the amniotic cavity from
E7.5 onwards (Fig. 3A; see
Movie 3 in the supplementary material; data not shown). We next performed
time-lapse imaging using LSM of Foxa2–/– ES 2n
chimeras to analyze the behavior of Foxa2 mutant cells in an
otherwise wild-type environment (Fig.
3B; see Movie 2 in the supplementary material) (n=9). As
shown earlier in this study, Foxa2-positive epiblast cells reside in the APS
region (Fig. 1), leave the
epiblast epithelium and form DE, which intercalates into the overlying VE
(Fig. 2). Imaging
Foxa2 null cells from MS stage onwards clearly revealed that APS
cells leave the epiblast and ingress into the APS region
(Fig. 3B) (t=0:00-1:45 h, white
asterisk). In contrast to wild-type DE cells,
Foxa2–/– `endoderm-like' cells showed endoderm
morphology (Fig. 3B) (time
0:00; l=13.3±2.6 µm; w=3.8±0.7 µm; l/w: 3.6±0.9;
n=50), made contact and partially integrated into the outside VE, but
failed to epithelialize (Fig.
3B) (time 0:00-1:15, black asterisks). We wondered whether in 2n
wt chimeras wild-type cells had a competitive advantage and substituted
or rescued DE formation; thus this might have been the reason that
Foxa2–/– cells were not integrated in the
outside epithelium. Therefore we analyzed the cellular behavior of mutant
cells in 4n Foxa2–/– chimeras
(Fig. 3C; see Movie 3 in the
supplementary material). We clearly observed cells, which were intercalated
but left the outside epithelium (Fig.
3C) (time 0:00-0:36). This indicates that Foxa2 is necessary for
functional integration of DE cells into the VE epithelium.
|
)],
transcription and endoderm formation [Hex
(Thomas et al., 1998;
Martinez Barbera et al.,
2000)], as well as cell-matrix adhesion [integrin alpha3
(Tamplin et al., 2008)] and
tight junction formation (claudin 4). In completely
Foxa2–/– ES-cell-derived MS-stage embryos,
Eomes was expressed at normal levels in the PS, confirming that
Foxa2 mutant cells underwent EMT and formed mesendoderm
(Fig. 4A;
Fig. 3). Moreover, ADE
formation was clearly induced in Foxa2 mutant cells, as indicated by
the expression of the endoderm marker gene Hex
(Fig. 4B). We previously used
gene expression profiling of 4n wt and
Foxa2–/– chimeras to identify differentially
expressed genes at the gastrulation stage
(Tamplin et al., 2008). This
analysis revealed that the tight junction markers claudin 4 and the
cell-matrix adhesion molecule integrin alpha3 (Itga3) are potential
target genes for Foxa2 in the DE. Strikingly, we found that whereas
Itga3 was strongly expressed in the APS region of 4n
Foxa2–/– chimeras at the head-fold stage
(Tamplin et al., 2008)
(Fig. 2C,F), the tight junction
marker claudin 4 was not detectable in the anterior endoderm region of 4n
Foxa2–/– chimera
(Fig. 6C). To further
characterize the identity of Foxa2–/– cells on
a cellular level, we performed whole-mount IHC to detect the mesoderm marker
protein T. As expected, Foxa2–/– endoderm-like
cells, which where partially integrated into the outside VE, were negative for
T protein (Fig. 4C), indicating
that Foxa2–/– endoderm cells did not switch to
a mesodermal fate, but still remained endoderm-like, expressing Eomes,
Hex and Itga3, but not the tight-junction marker claudin 4.
These results clearly indicate that endoderm-like cells are formed in
Foxa2 mutants, but accumulate in the APS region, fail to induce
claudin 4 and do not functionally integrate into the outside VE (compare with
Fig. 3).
|
wt Lyn-Tomato chimera
(Fig. 5A; see Movie 4 in the
supplementary material). By the beginning of intercalation, DE cells in
contact with the outside VE were not polarized, but extended filopodia
processes into the outside epithelium (Fig.
5A) (time 0:00). During intercalation, DE cells became more and
more polarized (Fig. 5A) (time
0:15–0:30) and by the end of the process clearly showed AB cell polarity
by the means of Lyn-Tomato localization
(Fig. 5A) (time 0:45).
|
wt or Foxa2–/–
chimeras (Fig. 5B). Analyzing
MS- to LS-stage embryos revealed that Foxa2 mutant cells were able to
localize Lyn-Tomato to the apical membrane
(Fig. 5B, white arrowheads).
However, the analysis also showed a statistically significant difference in
the cellular polarization between wt and Foxa2 mutant cells. To
investigate the cause of the cell polarity defects, we analyzed the formation
of adherens and/or tight junctions using whole-mount immunolocalization
studies to detect E-cadherin and ZO-1 in the endoderm epithelium. Comparing MS
to LS stage 4n wt and Foxa2–/– chimeras
clearly demonstrated that the adherens junction protein E-cadherin was not
localized at junctions between adjacent mutant cells, but surprisingly
mutant-wt cell junctions showed a similar extent of basolateral localization
as wt-wt adherens junctions (Fig.
6A). We speculate that the correct positioning of E-cadherin in
mutant-wt cell junctions is due to homotypic molecular interactions of the
E-cadherin protein in mutant cells with those correctly localized to the
basolateral domain in wt cells. However, these interactions may be transient,
as the mutant cells failed to functionally integrate into the outside
epithelium. Due to the fact that claudin 4 is not expressed in Foxa2
mutants (Fig. 6C), we
investigated the localization of the tight-junction protein ZO-1. Comparing MS
to LS stage 2n wt and Foxa2–/– chimeras
revealed that wt cells localized ZO-1 to the basolateral junctions in a
punctate manner, whereas most mutant cells ectopically localized ZO-1 to the
apical surface (Fig. 6B). It is
well known that Claudins are the major cell-adhesion molecules of tight
junctions (Tsukita et al.,
2001; Furuse and Tsukita,
2006) and bind specifically to ZO-1, ZO-2 (Tjp2 – Mouse
Genome Informatics) and ZO-3 (Tjp3 – Mouse Genome Informatics) via an
intracellular PDZ domain (Itoh et al.,
1999). Therefore, failure to induce claudin 4 or other Claudins
expressed in the endoderm (Sousa-Nunes et
al., 2003; Hou et al.,
2007) might explain the ectopic localization of ZO-1 at the apical
membrane of Foxa2 mutant endoderm-like cells. Alternatively, Foxa2
might regulate a molecular program of cell polarity important to establish
functional tight and adherens junctions. |
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Epiblast cells are specified and differentiate in the PS region
An important question in embryology and stem cell biology is when and how
precursor cells are specified and differentiate. To our surprise, the T-box
transcription factor brachyury (T) and the Forkhead box transcription factor
Foxa2 are specifically synthesized in specified mesoderm and endoderm
precursor cells in the posterior epiblast during gastrulation. Using
time-lapse imaging and immunohistochemistry, we have shown that mesodermal and
endodermal cells quickly segregate and differentiate after EMT. T-positive
epiblast cells differentiate into T-positive mesenchymal cells in the PS,
whereas Foxa2-positive epiblast cells differentiate into Foxa2-positive
epithelial endodermal cells that integrate into the overlying epithelium and
Foxa2-positive, T-positive axial mesodermal cells. Fate map analyses have
revealed that the cells in the anterior end of the PS of the MS-stage embryo,
which we have shown are Foxa2-positive, will give rise to anterior mesoderm
and endoderm (Kinder et al.,
2001), whereas cells in the posterior region of the PS, which we
have shown are T-positive, will give rise to posterior as well as
extra-embryonic mesoderm (Kinder et al.,
1999). This is consistent with the gene functional analysis of
either of these genes. T null mutants lack posterior mesoderm and notochord
(Wilkinson et al., 1990;
Kispert and Herrmann, 1994),
whereas Foxa2 null mutants lack anterior mesoderm and endoderm, as
well as the node and notochord (Ang and
Rossant, 1994; Weinstein et
al., 1994). Using a T-Cre and Foxa2-Cre genetic lineage tracing
approach, we and others have recently shown that Foxa2 epiblast precursor
cells give rise to anterior mesoderm and endoderm, whereas T epiblast
precursors give rise to posterior mesoderm and endoderm
(Uetzmann et al., 2008;
Park et al., 2008;
Kumar et al., 2007;
Verheyden et al., 2005). These
results are consistent with the idea that a bipotential mesendodermal
progenitor cell population exists in mammals
(Rodaway and Patient, 2001;
Lickert et al., 2002;
Kubo et al., 2004). Taken
together, these results suggest that the posterior epiblast can be divided
into a distal Foxa2-positive and proximal T-positive precursor cell
population, giving rise to anterior and posterior mesendodermal cell
populations, respectively.
Foxa2 is upstream of T and initiates axial mesoderm development
How does axial mesoderm, namely the head process, prechordal plate,
notochord and node, develop? It was previously suggested that Foxa2 is on top
of a developmental program for axial mesoderm formation
(Yamanaka et al., 2007). At
the MS stage we detected an APS population, which was Foxa2-positive and was
fate-mapped to give rise to the axial mesoderm and endoderm
(Kinder et al., 2001). At the
LS stage, the epiblast cells generated three distinct cell populations by
morphology and marker gene expression: a T-positive posterior mesoderm
population, a Foxa2-positive endoderm population and an anterior
Foxa2-positive and T-positive axial mesoderm population. We noticed that
Foxa2-positive epiblast cells at MS to LS stage upregulated T protein after
EMT, indicating that Foxa2 epiblast cells give rise to axial mesoderm. From
knockout studies it is known that Foxa2 mutants do not form axial
mesoderm at all, whereas the T mutants initially form but fail to maintain
posterior notochord. We also showed in this study that no anatomical node
structure is formed at the distal tip of Foxa2 mutant chimera. This
suggests that Foxa2 is on top of the axial mesoderm hierarchy
(Yamanaka et al., 2007) and is
consistent with loss of brachyury expression, specifically in the
node and AME, but not PS, of tetraploid-derived Foxa2 null embryos at
E7.5 (Dufort et al., 1998).
Interestingly, axial mesodermal cells (node and notochord) did not acquire a
mesenchymal fate along with the rest of the T-positive mesoderm population in
the posterior PS, but rather constituted a population of cells that were
highly polarized and connected through cell-cell adhesion. For example, node
cells formed a characteristic anatomical structure in the surface endoderm
layer at the distal tip of the embryo. The cells showed clear AB polarity,
were monociliated and interconnected through E-cadherin-mediated cell-cell
adhesion (Yamanaka et al.,
2007). Also the notochord descendents of the node cells were
highly polarized and formed a solid rod-like structure through cell-cell
adhesion, between the endoderm and the ectoderm epithelium. This suggests that
Foxa2 progenitor cells in general give rise to polarized, interconnected cell
types and that Foxa2 promotes an epithelial fate and suppresses a mesenchymal
fate.
Foxa2 induces an epithelial cellular phenotype
In this study, we have shown that Foxa2 mutant progenitor cells
leave the epiblast, but fail to integrate into the outside epithelium, which
leads to an accumulation of mesenchymal cells in the APS region. This is
consistent with the idea that Foxa2 regulates a program necessary to acquire
an epithelial cellular phenotype. This is also accordant with the lack of
polarized and epithelialized cell types in the Foxa2 mutant embryos,
i.e. node, notochord and anterior definitive endoderm
(Ang and Rossant, 1994;
Weinstein et al., 1994), but
how does Foxa2 regulate cell-cell polarity and epithelialization in the
endoderm germ layer? In our attempts to identify novel Foxa2 target genes at
the gastrulation stage (Tamplin et al.,
2008), we have identified many potential target genes, including
the homeobox transcription factors Hex and Otx2
(Kimura-Yoshida et al., 2007),
the signaling molecules Cer1 and Shh
(Epstein et al., 1999;
Jeong and Epstein, 2003), the
SRY-related HMG box transcription factor Sox17 and the Forkhead box
transcription factor Foxa1 (Duncan et al.,
1998). Most of these endoderm-specific patterning factors are
expressed in the endoderm germ layer, but not in Foxa2-positive epiblast
precursor cells. This is consistent with the idea that Foxa2 is a pioneer
factor, which opens compact chromatin and acts in higher-order gene regulation
to allow mesendoderm and endoderm specific transcription factors to specify
cell fate (Cirillo et al.,
2002). But how does this molecular program translate into cellular
changes that lead to the mesoderm or endoderm lineage decisions? In this
respect it was interesting to find proteins involved in cell adhesion, such as
the tight junction protein claudin 4, the homotypic cell-cell adhesion
molecules Flrt2, Flrt3 and Pcdh19, as well as the cell-matrix adhesion
molecule Itga3, as potential Foxa2 endoderm target genes
(Tamplin et al., 2008). It was
recently shown that hepatocyte nuclear factor 4a (HNF4a; Hnf1a – Mouse
Genome Informatics), an important nuclear receptor for endoderm development
(Lemaigre and Zaret, 2004),
triggers formation of functional tight junctions and establishment of
polarized epithelial morphology by specifically inducing Claudin expression
(Chiba et al., 2003;
Satohisa et al., 2005). ZO-1
has been proposed to be a scaffolding protein between transmembrane and
cytoplasmatic proteins, and possibly forms a link between the adherens and
tight junctions, e.g. formation of the adherens junction through E-cadherin is
associated with the formation and localization of tight junction proteins,
particularly ZO-1 (Rajasekaran et al.,
1996; Siliciano and
Goodenough, 1988). Taken together, we suggest that Foxa2
mutant endoderm-like cells fail to initiate an endodermal molecular program
regulated by Foxa2 and different endoderm-specific patterning factors, which
results in a change of cellular morphology dictated by cell-cell, cell-matrix
adhesion and cell polarity molecules.
|
Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/136/6/1029/DC1
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Ang, S. L. and Rossant, J. (1994). HNF-3 beta
is essential for node and notochord formation in mouse development.
Cell 78,561
-574.[CrossRef][Medline]
Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S.,
Rossant, J. and Zaret, K. S. (1993). The formation and
maintenance of the definitive endoderm lineage in the mouse: involvement of
HNF3/forkhead proteins. Development
119,1301
-1315.[Abstract]
Arnold, S. J., Hofmann, U. K., Bikoff, E. K. and Robertson, E.
J. (2008). Pivotal roles for eomesodermin during axis
formation, epithelium-to-mesenchyme transition and endoderm specification in
the mouse. Development
135,501
-511.
Beddington, R. S. and Robertson, E. J. (1999).
Axis development and early asymmetry in mammals. Cell
96,195
-209.[CrossRef][Medline]
Chiba, H., Gotoh, T., Kojima, T., Satohisa, S., Kikuchi, K.,
Osanai, M. and Sawada, N. (2003). Hepatocyte nuclear factor
(HNF)-4alpha triggers formation of functional tight junctions and
establishment of polarized epithelial morphology in F9 embryonal carcinoma
cells. Exp. Cell Res.
286,288
-297.[CrossRef][Medline]
Cirillo, L. A., Lin, F. R., Cuesta, I., Friedman, D., Jarnik, M.
and Zaret, K. S. (2002). Opening of compacted chromatin by
early developmental transcription factors HNF3 (FoxA) and GATA-4.
Mol. Cell 9,279
-289.[CrossRef][Medline]
Ciruna, B. G. and Rossant, J. (1999).
Expression of the T-box gene Eomesodermin during early mouse development.
Mech. Dev. 81,199
-203.[CrossRef][Medline]
Dufort, D., Schwartz, L., Harpal, K. and Rossant, J.
(1998). The transcription factor HNF3beta is required in visceral
endoderm for normal primitive streak morphogenesis.
Development 125,3015
-3025.[Abstract]
Duncan, S. A., Navas, M. A., Dufort, D., Rossant, J. and
Stoffel, M. (1998). Regulation of a transcription factor
network required for differentiation and metabolism.
Science 281,692
-695.
Epstein, D. J., McMahon, A. P. and Joyner, A. L.
(1999). Regionalization of Sonic hedgehog transcription along the
anteroposterior axis of the mouse central nervous system is regulated by
Hnf3-dependent and -independent mechanisms.
Development 126,281
-292.[Abstract]
Fehling, H. J., Lacaud, G., Kubo, A., Kennedy, M., Robertson,
S., Keller, G. and Kouskoff, V. (2003). Tracking mesoderm
induction and its specification to the hemangioblast during embryonic stem
cell differentiation. Development
130,4217
-4227.
Furuse, M. and Tsukita, S. (2006). Claudins in
occluding junctions of humans and flies. Trends Cell
Biol. 16,181
-188.[CrossRef][Medline]
Hadjantonakis, A. K., Macmaster, S. and Nagy, A.
(2002). Embryonic stem cells and mice expressing different GFP
variants for multiple non-invasive reporter usage within a single animal.
BMC Biotechnol. 2,11
.[CrossRef][Medline]
Herrmann, B. G. (1991). Expression pattern of
the Brachyury gene in whole-mount TWis/TWis mutant embryos.
Development 113,913
-917.[Abstract]
Hitz, C., Wurst, W. and Kuhn, R. (2007).
Conditional brain-specific knockdown of MAPK using Cre/loxP regulated RNA
interference. Nucleic Acids Res.
35, e90.
Hou, J., Charters, A. M., Lee, S. C., Zhao, Y., Wu, M. K.,
Jones, S. J., Marra, M. A. and Hoodless, P. A. (2007). A
systematic screen for genes expressed in definitive endoderm by Serial
Analysis of Gene Expression (SAGE). BMC Dev. Biol.
7, 92.[CrossRef][Medline]
Inman, K. E. and Downs, K. M. (2006). Brachyury
is required for elongation and vasculogenesis in the murine allantois.
Development 133,2947
-2959.
Itoh, M., Furuse, M., Morita, K., Kubota, K., Saitou, M. and
Tsukita, S. (1999). Direct binding of three tight
junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of
claudins. J. Cell Biol.
147,1351
-1363.
Jeong, Y. and Epstein, D. J. (2003). Distinct
regulators of Shh transcription in the floor plate and notochord indicate
separate origins for these tissues in the mouse node.
Development 130,3891
-3902.
Kimura-Yoshida, C., Tian, E., Nakano, H., Amazaki, S.,
Shimokawa, K., Rossant, J., Aizawa, S. and Matsuo, I. (2007).
Crucial roles of Foxa2 in mouse anterior-posterior axis polarization via
regulation of anterior visceral endoderm-specific genes. Proc.
Natl. Acad. Sci. USA 104,5919
-5924.
Kinder, S. J., Tsang, T. E., Quinlan, G. A., Hadjantonakis, A.
K., Nagy, A. and Tam, P. P. (1999). The orderly allocation of
mesodermal cells to the extraembryonic structures and the anteroposterior axis
during gastrulation of the mouse embryo. Development
126,4691
-4701.[Abstract]
Kinder, S. J., Tsang, T. E., Wakamiya, M., Sasaki, H.,
Behringer, R. R., Nagy, A. and Tam, P. P. (2001). The
organizer of the mouse gastrula is composed of a dynamic population of
progenitor cells for the axial mesoderm. Development
128,3623
-3634.
Kispert, A. and Herrmann, B. G. (1994).
Immunohistochemical analysis of the Brachyury protein in wild-type and mutant
mouse embryos. Dev. Biol.
161,179
-193.[CrossRef][Medline]
Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy,
M., Woo, S., Fehling, H. J. and Keller, G. (2004).
Development of definitive endoderm from embryonic stem cells in culture.
Development 131,1651
-1662.
Kumar, A., Yamaguchi, T., Sharma, P. and Kuehn, M. R.
(2007). Transgenic mouse lines expressing Cre recombinase
specifically in posterior notochord and notochord.
Genesis 45,729
-736.[CrossRef][Medline]
Kwon, G. S., Viotti, M. and Hadjantonakis, A. K.
(2008). The endoderm of the mouse embryo arises by dynamic
widespread intercalation of embryonic and extraembryonic lineages.
Dev. Cell 15,509
-520.[CrossRef][Medline]
Lai, E., Prezioso, V. R., Smith, E., Litvin, O., Costa, R. H.
and Darnell, J. E., Jr (1990). HNF-3A, a hepatocyte-enriched
transcription factor of novel structure is regulated transcriptionally.
Genes Dev. 4,1427
-1436.
Lai, E., Prezioso, V. R., Tao, W. F., Chen, W. S. and Darnell,
J. E., Jr (1991). Hepatocyte nuclear factor 3 alpha belongs
to a gene family in mammals that is homologous to the Drosophila homeotic gene
fork head. Genes Dev. 5,416
-427.
Lawson, K. A. and Pedersen, R. A. (1992).
Clonal analysis of cell fate during gastrulation and early neurulation in the
mouse. Ciba Found. Symp.
165, 3-21; discussion
21-26.[Medline]
Lawson, K. A. and Hage, W. J. (1994). Clonal
analysis of the origin of primordial germ cells in the mouse. Ciba
Found. Symp. 182,68
-84; discussion 84-91.[Medline]
Lawson, K. A., Meneses, J. J. and Pedersen, R. A.
(1991). Clonal analysis of epiblast fate during germ layer
formation in the mouse embryo. Development
113,891
-911.[Abstract]
Lemaigre, F. and Zaret, K. S. (2004). Liver
development update: new embryo models, cell lineage control, and
morphogenesis. Curr. Opin. Genet. Dev.
14,582
-590.[CrossRef][Medline]
Lewis, S. L. and Tam, P. P. (2006). Definitive
endoderm of the mouse embryo: formation, cell fates, and morphogenetic
function. Dev. Dyn. 235,2315
-2329.[CrossRef][Medline]
Lickert, H., Kutsch, S., Kanzler, B., Tamai, Y., Taketo, M. M.
and Kemler, R. (2002). Formation of multiple hearts in mice
following deletion of beta-catenin in the embryonic endoderm. Dev.
Cell 3,171
-181.[CrossRef][Medline]
Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez,
T., Meloy, D., Kioussis, D. and Beddington, R. S. (2000). The
homeobox gene Hex is required in definitive endodermal tissues for normal
forebrain, liver and thyroid formation. Development
127,2433
-2445.[Abstract]
Monaghan, A. P., Kaestner, K. H., Grau, E. and Schutz, G.
(1993). Postimplantation expression patterns indicate a role for
the mouse forkhead/HNF-3 alpha, beta and gamma genes in determination of the
definitive endoderm, chordamesoderm and neuroectoderm.
Development 119,567
-578.
Nagy, A. (2003). Manipulating The
Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
Nakaya, M. A., Biris, K., Tsukiyama, T., Jaime, S., Rawls, J. A.
and Yamaguchi, T. P. (2005). Wnt3a links left-right
determination with segmentation and anteroposterior axis elongation.
Development 132,5425
-5436.
Niwa, H., Yamamura, K. and Miyazaki, J. (1991).
Efficient selection for high-expression transfectants with a novel eukaryotic
vector. Gene 108,193
-199.[CrossRef][Medline]
Park, E. J., Sun, X., Nichol, P., Saijoh, Y., Martin, J. F. and
Moon, A. M. (2008). System for tamoxifen-inducible expression
of cre-recombinase from the Foxa2 locus in mice. Dev.
Dyn. 237,447
-453.[CrossRef][Medline]
Rajasekaran, A. K., Hojo, M., Huima, T. and Rodriguez-Boulan,
E. (1996). Catenins and zonula occludens-1 form a complex
during early stages in the assembly of tight junctions. J. Cell
Biol. 132,451
-463.
Rodaway, A. and Patient, R. (2001).
Mesendoderm: an ancient germ layer? Cell
105,169
-172.[CrossRef][Medline]
Sasaki, H. and Hogan, B. L. (1993).
Differential expression of multiple fork head related genes during
gastrulation and axial pattern formation in the mouse embryo.
Development 118,47
-59.[Abstract]
Satohisa, S., Chiba, H., Osanai, M., Ohno, S., Kojima, T.,
Saito, T. and Sawada, N. (2005). Behavior of tight-junction,
adherens-junction and cell polarity proteins during HNF-4alpha-induced
epithelial polarization. Exp. Cell Res.
310, 66-78.[CrossRef][Medline]
Siliciano, J. D. and Goodenough, D. A. (1988).
Localization of the tight junction protein, ZO-1, is modulated by
extracellular calcium and cell-cell contact in Madin-Darby canine kidney
epithelial cells. J. Cell Biol.
107,2389
-2399.
Sousa-Nunes, R., Rana, A. A., Kettleborough, R., Brickman, J.
M., Clements, M., Forrest, A., Grimmond, S., Avner, P., Smith, J. C.,
Dunwoodie, S. L. et al. (2003). Characterizing embryonic gene
expression patterns in the mouse using nonredundant sequence-based selection.
Genome Res. 13,2609
-2620.
Tam, P. P. and Beddington, R. S. (1992).
Establishment and organization of germ layers in the gastrulating mouse
embryo. Ciba Found. Symp.
165, 27-41; discussion
42-49.[Medline]
Tam, P. P. and Rossant, J. (2003). Mouse
embryonic chimeras: tools for studying mammalian development.
Development 130,6155
-6163.
Tam, P. P. and Loebel, D. A. (2007). Gene
function in mouse embryogenesis: get set for gastrulation. Nat.
Rev. Genet. 8,368
-381.[CrossRef][Medline]
Tam, P. P., Parameswaran, M., Kinder, S. J. and Weinberger, R.
P. (1997). The allocation of epiblast cells to the embryonic
heart and other mesodermal lineages: the role of ingression and tissue
movement during gastrulation. Development
124,1631
-1642.[Abstract]
Tamplin, O. J., Kinzel, D., Cox, B. J., Bell, C. E., Rossant, J.
and Lickert, H. (2008). Microarray analysis of Foxa2 mutant
mouse embryos reveals novel gene expression and inductive roles for the
gastrula organizer and its derivatives. BMC Genomics
9, 511.[CrossRef][Medline]
Thiery, J. P. and Sleeman, J. P. (2006).
Complex networks orchestrate epithelial-mesenchymal transitions.
Nat. Rev. Mol. Cell Biol.
7, 131-142.[CrossRef][Medline]
Thomas, P. Q., Brown, A. and Beddington, R. S.
(1998). Hex: a homeobox gene revealing peri-implantation
asymmetry in the mouse embryo and an early transient marker of endothelial
cell precursors. Development
125, 85-94.[Abstract]
Tsukita, S., Furuse, M. and Itoh, M. (2001).
Multifunctional strands in tight junctions. Nat. Rev. Mol. Cell
Biol. 2,285
-293.[CrossRef][Medline]
Uetzmann, L., Burtscher, I. and Lickert, H.
(2008). A mouse line expressing Foxa2-driven Cre recombinase in
node, notochord, floorplate and endoderm. Genesis
46,515
-522.[CrossRef][Medline]
Verheyden, J. M., Lewandoski, M., Deng, C., Harfe, B. D. and
Sun, X. (2005). Conditional inactivation of Fgfr1 in mouse
defines its role in limb bud establishment, outgrowth and digit patterning.
Development 132,4235
-4245.
Vintersten, K., Monetti, C., Gertsenstein, M., Zhang, P.,
Laszlo, L., Biechele, S. and Nagy, A. (2004). Mouse in red:
red fluorescent protein expression in mouse ES cells, embryos, and adult
animals. Genesis 40,241
-246.[CrossRef][Medline]
Warga, R. M. and Nusslein-Volhard, C. (1999).
Origin and development of the zebrafish endoderm.
Development 126,827
-838.[Abstract]
Weinstein, D. C., Ruiz i Altaba, A., Chen, W. S., Hoodless, P.,
Prezioso, V. R., Jessell, T. M. and Darnell, J. E., Jr
(1994). The winged-helix transcription factor HNF-3 beta is
required for notochord development in the mouse embryo.
Cell 78,575
-588.[CrossRef][Medline]
Wells, J. M. and Melton, D. A. (1999).
Vertebrate endoderm development. Annu. Rev. Cell Dev.
Biol. 15,393
-410.[CrossRef][Medline]
Wilkinson, D. G., Bhatt, S. and Herrmann, B. G.
(1990). Expression pattern of the mouse T gene and its role in
mesoderm formation. Nature
343,657
-659.[CrossRef][Medline]
Yamanaka, Y., Tamplin, O. J., Beckers, A., Gossler, A. and
Rossant, J. (2007). Live imaging and genetic analysis of
mouse notochord formation reveals regional morphogenetic mechanisms.
Dev. Cell 13,884
-896.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
