|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online March 20, 2009
doi: 10.1242/10.1242/dev.027342
1 Shriners Hospital for Children, Research Division, Portland, OR 97239,
USA.
2 Department of Pharmacology, New York University School of Medicine, 550 First
Avenue, MSB 24, New York, NY 10016, USA.
3 Institute for Anatomy, Department of Neuroanatomy, University of Duisburg
Essen, Medical Faculty, 45122 Essen, Germany.
4 Department of Cell and Developmental Biology, Oregon Health and Science
University, Portland, OR 97239, USA.
Author for correspondence (e-mail:
Ronen{at}shcc.org)
Accepted 16 February 2009
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: TGFβ, Connective tissue, Ligaments, Tendons, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Recent studies identified scleraxis (Scx), a bHLH
transcription factor gene, as a unique marker for the tendon cell fate
(Cserjesi et al., 1995;
Schweitzer et al., 2001), and
used Scx expression to describe tendon induction and differentiation
during embryogenesis (Brent et al.,
2003; Schweitzer et al.,
2001) (reviewed by Tozer and
Duprez, 2005). In somites, tendon progenitors (TNPs) are found in
the syndetome, a dorsolateral stripe of the sclerotome at the junction between
adjacent myotomes (Brent et al.,
2003). In limb buds, TNPs are induced in mesenchyme directly under
the ectoderm, in locations that follow the proximal-to-distal outgrowth of the
limb bud (Schweitzer et al.,
2001); by E12.5, the TNPs align as loosely organized progenitors
between the differentiating muscles and corresponding cartilage condensations.
The TNPs later condense and differentiate to give rise to overtly distinct
tendons by E13.5 (Murchison et al.,
2007).
A molecular framework for tendon induction and differentiation is also
beginning to emerge. FGF signaling plays an important role in the induction of
TNPs (reviewed by Tozer and Duprez,
2005). In somites, FGFs emanate from the myotome to induce
adjacent sclerotomal cells to become TNPs
(Brent et al., 2003;
Brent and Tabin, 2004). In limb
buds the source and identity of FGFs that direct the induction of TNPs has not
been established to date, but expression of FGF4 has been reported in limb
muscles (Edom-Vovard et al.,
2002). The subsequent condensation and differentiation of TNPs is
dependent on the transcriptional activities of Scx
(Murchison et al., 2007).
TGFβs comprise a small subfamily within the TGFβ superfamily
(Massague et al., 2000;
Shi and Massague, 2003). The
regulation and function of TGFβ signaling has been the subject of
numerous studies, leading to the targeting in mice of all the unique
participants in TGFβ signaling, notably the ligands Tgfb1-3
(Kulkarni et al., 1993;
Proetzel et al., 1995;
Sanford et al., 1997) and
their receptors (Dudas et al.,
2006; Oshima et al.,
1996). Significantly, TGFβs use a single type II receptor,
TGFBR2 (also known as TβRII), which implies that targeted recombination
of a conditional allele, Tgfbr2flox, is sufficient for the
disruption of all TGFβ signaling, circumventing complications due to
redundancy of ligands or receptors (Chytil
et al., 2002). The analysis of such mutants has established a role
for TGFβ signaling in numerous developmental processes
(Dunker and Krieglstein, 2000;
Serra and Chang, 2003),
including crucial roles in skeletogenesis, the disruption of which can
manifest in reduced chondrocyte proliferation, cleft palate, disrupted
skeletal boundaries, fused joints and the failure of sternum development
(Baffi et al., 2006;
Proetzel et al., 1995;
Sanford et al., 1997;
Seo and Serra, 2007;
Spagnoli et al., 2007).
TGFβ signaling has also been associated with the connective tissues
because of its capacity to induce extracellular matrix (ECM) proteins and an
involvement in the development of fibrosis (reviewed by
Mauviel, 2005). More recently
it was demonstrated that disruption of TGFβ signaling resulted in the
loss of Scx expression in cranial tissues, suggesting a role for
TGFβ signaling in tendon development
(Oka et al., 2008).
We show that disruption of TGFβ signaling results in the loss of most tendons and ligaments - the first demonstration of a molecular activity with an essential role in formation of these tissues. The induction of TNPs was not affected in mutant embryos and tendon loss was apparent only at E12.5, concurrent with the organization of tendon primordia that align between the differentiating muscles and the prechondrogenic mesenchymal condensations. Moreover, we have found that TGFβ signaling is a potent inducer of Scx both in organ culture and in cultured cells, suggesting a role for TGFβ signaling in tendon induction. TGFβ signaling is thus essential for maintenance of the early TNPs, and we propose that it also mediates recruitment of additional tendon cells by the adjacent muscles and cartilage condensations to establish the connections of tendon primordia with these tissues, an essential event for the subsequent differentiation and growth of mature tendons.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
),
Tgfb3 (Proetzel et al.,
1995), Tgfbr2flox
(Chytil et al., 2002),
Prx1Cre (Logan et al.,
2002) and ScxGFP
(Pryce et al., 2007).
Tgfbr1-/+ mice were generated using the stochastic
germline activity in Prx1Cre females
(Logan et al., 2002), and the
colony was expanded to verify recombination in the germline. Tgfb2-/-;Tgfb3-/- embryos were retrieved at the expected ratio in harvests performed up to E12.5 (10/164 embryos), but the frequency decreased sharply in later stages (3/297 embryos at E14.5 and older).
In situ hybridization, antibody staining, BrdU and TUNEL assays were
performed as previously described
(Murchison et al., 2007).
Organ culture
Organ culture was performed as previously described
(Zuniga et al., 1999). Embryos
were harvested in DMEM and limb buds or trunks were dissected and placed on
metal grids in six-well plates containing Nutriated Medium
(Zuniga et al., 1999). Affigel
beads (BioRad) were soaked in 20 µg/ml TGFβ2 or TGFβ3, or 25
µg/ml hFGF4 recombinant proteins (R&D Systems) for 1 hour on ice and
grafted, and the plates were incubated at 37°C, 5% CO2. We
found a progressive loss of endogenous mRNAs for E12.5 limbs (but not E10.5
trunks) incubated for 2 hours and longer and therefore limited the duration of
these experiments.
Tissue culture
C3H10T1/2 cells (ATCC) were seeded in six-well plates
(2.5x106 cells/well) in DMEM-10% FBS; after 24 hours the
medium was supplemented with 20 ng/ml TGFβ2 protein (R&D Systems).
Activation medium was maintained till harvest or replaced by DMEM-10% FBS
after 1 hour. Cells were trypsinized in duplicate, RNA was prepped using
RNeasy mini (Qiagen) and 1 µg RNA was used for cDNA synthesis (Invitrogen
Superscript III).
Qualitative PCR primers were:
5'ScxExon1a, GAGACGGCGGCGAGAACACCC;
3'ScxExon2a, GCGTGCTCTTGGGGACCTGCG;
TNCExon12-5', GAACACCGATGCTCTCTACTGACG; and
TNCExon13-3', ATGTGGGCAGTCCGTTCAGCA.
Quantitative RT-PCR was performed using ABI 7900HT with SYBR green. Results were normalized to GAPDH and four samples were used for each time point. Primers were: Scx-Q5'-1 AGAGACGGCGGCGAGAACAC and Scx-Q3'-2 GTGGGGCTCTCCGTGACTCTTC.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
) prompted
us to check whether the same was true in mouse, and we detected expression of
both Tgfb2 and Tgfb3 in limb tendons at E14.5
(Fig. 5A,B). A functional link
between TGFβ signaling and limb tendons was recently proposed in an
analysis of the role TGFβ signaling plays in the development of the
deltoid tuberosity, a lateral outgrowth of the humerus
(Seo and Serra, 2007). The
deltoid tuberosity was not affected when Tgfbr2flox was
targeted in chondrocytes (Baffi et al.,
2004), but it did not develop in Tgfb2-/-
embryos (Sanford et al., 1997)
or when TGFβ signaling was disrupted throughout the limb mesenchyme
(Seo and Serra, 2007;
Spagnoli et al., 2007). As
growth of the deltoid tuberosity is dependent on biomechanical activation
(Dysart et al., 1989), it was
suggested that the phenotype might be attributed to a loss of muscles or
tendons in these mutants (Seo and Serra,
2007). To address this possibility, Tgfb2-/+
mice were bred with the tendon reporter ScxGFP
(Pryce et al., 2007). The
deltoid tuberosity and deltoid tendon were apparent in sagittal sections
through the humerus of a wild-type embryo at E16.5, but missing in sections
from a Tgfb2-/- littermate
(Fig. 1A,B, white arrowheads
and arrows, respectively). Moreover, antibody staining for myosin heavy chain
(MHC) revealed that the muscles around the humerus were also significantly
reduced in the Tgfb2-/- embryo, suggesting a defect in
tendons or muscles as being the underlying cause for the loss of biomechanical
activity in Tgfb2-/- embryos. Detection of ScxGFP in whole limbs revealed a more severe tendon phenotype, most of the extensor tendons were missing in the forelimb of E15.5 Tgfb2-/- embryos, but segments of the extensor tendons persisted in the digits (Fig. 1C,D, white arrows and arrowheads, respectively). To study the phenotype in greater detail, we analyzed cross sections through the forelimbs of E14.5 embryos. In digit sections, the extensor tendons appeared similar in wild-type and Tgfb2-/- embryos, but in more proximal positions the extensor tendons were missing or rudimentary in mutant embryos in agreement with the tendon loss we saw in whole limbs (Fig. 1F, a1-b3, white arrows). Surprisingly, the flexor tendons appeared normal in the mutant embryos (Fig. 1F, a1-b3, yellow arrows).
We found expression of Tgfb3 in tendons as well, but tendons were not disrupted in Tgfb3-/- embryos (not shown). However, an allelic series, combining mutations in both TGFβ genes resulted in a dramatic phenotypic series. In Tgfb2-/-;Tgfb3-/+ embryos, the loss of extensor tendons was enhanced relative to the loss in Tgfb2-/- embryos and flexor tendons were severely reduced as well (Fig. 1F, c1-c3, white and yellow arrows, respectively). Remarkably, in double mutant Tgfb2-/-;Tgfb3-/- embryos, no tendons were detected at all limb levels (Fig. 1F, d1-d3), except for a remnant of the flexor profundus tendon in the digit, whose signal is disproportionately enhanced in Fig. 1F, d1. Some ScxGFP-expressing cells were also found at the level of the metacarpals, encircling the muscles in a pattern that was not related to tendons in this position (Fig. 1F, d2).
Double mutant Tgfb2-/-;Tgfb3-/- embryos were
retrieved at a very low frequency (see Materials and methods), prompting us to
study some aspects of the phenotype using the conditionally targeted
Tgfbr2flox allele
(Chytil et al., 2002) in
conjunction with Prx1Cre (Logan
et al., 2002), a limb-specific Cre deletor that shows early
activity through the limb mesenchyme, resulting in the targeting of all tendon
cells (see Fig. S1 in the supplementary material). This combination leads to a
complete disruption of TGFβ signaling in limb mesenchyme and will be
denoted Tgfbr2Prx1Cre
(Seo and Serra, 2007;
Spagnoli et al., 2007).
Similar to Tgfb2-/-;Tgfb3-/- embryos,
ScxGFP could not be detected in limbs from
Tgfbr2Prx1Cre embryos at E14.5 (not shown) and in situ
hybridization (ISH) analysis showed a complete loss of Scx expression
in these limbs as well (Fig.
1G,H).
Tgfb2-/-;Tgfb3-/- and
Tgfbr2Prx1Cre embryos represent a broad disruption of
TGFβ signaling, hence we cannot rule out the possibility that the effects
on Scx expression were secondary to effects on other tissues. It is,
however, important to note that cartilage condensation appeared normal in
these mutants (Seo and Serra,
2007), and ISH with a Myod probe showed that early muscle
differentiation was not affected either
(Fig. 1I,J). Subsequent aspects
of skeletal differentiation were, however, affected when TGFβ signaling
was disrupted (Seo and Serra,
2007; Spagnoli et al.,
2007). Although muscle pattern was not drastically altered, the
positions of some muscles were changed and the muscles appeared less compact,
with increased spaces between myotubes
(Fig. 1F, a2,b2,c2,d2, pink
arrows). We did not determine at this time if these effects represent a
requirement for TGFβ signaling in muscles or a secondary consequence of
the tendon phenotype.
|
), could
not be detected in Tgfb2-/-;Tgfb3-/- embryos
(Fig. 2A,B), nor did we detect
expression of Col1a1, the most robust ISH probe in tendon cells,
which encodes the most abundant protein in tendons, collagen 1
(Murchison et al., 2007). In
transverse sections of forelimbs from a
Tgfb2-/-;Tgfb3-/- embryo
(Fig. 2C,D), or sagittal
sections from a Tgfbr2Prx1Cre forelimb
(Fig. 2E,F, white and yellow
arrows), the ISH signal for Col1a1 did not highlight tendon cells,
even when the ISH reactions were over-developed and other cells, notably
osteoblasts, showed a robust Col1a1 signal. Moreover, even in
Hematoxylin and Eosin stained sections, in which tendons have a distinct
condensed morphology, tendons could not be detected in mutant embryos
(Fig. 2G,H, yellow arrow).
Finally, in studies of the tendon phenotype in Scx-/-
embryos, we found that some tendon rudiments that lost expression of Scx,
Tnmd and Col1a1, retained the capacity to attach tissues and
expressed tendon matrix proteins such as collagen XII and tenascin C
(Murchison et al., 2007).
However, in limbs from Tgfbr2Prx1Cre embryos, we could not
detect any tendon-related expression of tenascin C or collagen XII
(Fig. 2I-L). Taken together,
these results imply that tendon cells do not exist in the limbs of embryos in
which TGFβ signaling is disrupted, the first mutant combination in which
a complete loss of limb tendons is identified.
Tendons and ligaments throughout the body are missing in mutants that disrupt TGFβ signaling
The essential role of TGFβ signaling in the development of limb
tendons prompted us to examine whether other tendons were also affected when
TGFβ signaling was disrupted. Although limb tendons are derived from the
lateral plate mesoderm, the axial tendons originate in a distinct somitic
domain, the syndetome (Brent et al.,
2003), and cranial tendons originate from cranial neural crest
cells (Chai et al., 2000;
Kontges and Lumsden, 1996).
The different embryonic origins of axial, cranial and appendicular tendons
suggest that there may also be divergent aspects to the regulation of their
differentiation and development (reviewed by
Tozer and Duprez, 2005).
The distinctive structures of trunk tendons seen in wild-type skinned embryos was missing in Tgfb2-/-;Tgfb3-/- littermates (Fig. 3A,B, white arrows). Moreover, in transverse sections through the head of embryos at E14.5, in which staining for collagen II and MHC was used to highlight the neck muscles and cartilage, Tnmd-expressing tendons cells could not be detected in sections from a Tgfb2-/-;Tgfb3-/- embryo (Fig. 3C,D). The same transverse sections extended also through the jaws and the masseter, the major cranial muscle (Fig. 3G,H). Tnmd-expressing tendons anchor the masseter to the jaws, but Tnmd could not be detected next to any of the cranial muscles in the Tgfb2-/-;Tgfb3-/- embryos (Fig. 3G,H, arrows). Interestingly, Scx-expressing progenitors of the masseter tendons could not be detected in heads of Tgfb2-/-;Tgfb3-/- mutant embryos already at E12.5 (Fig. 3E,F, arrows).
The most robust axial tendons in the mouse are the tail tendons that
originate in sacral muscles and extend through the tail to insert at the
dorsal and ventral sides of tail vertebrae
(Fig. 3I, white arrow) (see
also Murchison et al., 2007).
In cross section, these long tendons appear as peripheral dots in each
quadrant of the tail (Fig. 3M,
white arrows). Minor aspects of tail movement are regulated by intrinsic
muscles that extend across a single vertebra and anchor via short tendons
(Fig. 3M,O, yellow arrows) (see
also Shinohara, 1999). The
long tendons of the tail were entirely missing in Tgfb2-/-
mutant embryos (Fig. 3I,J,M,N,
white arrows), but the intrinsic muscles of the tail and their tendons were
intact (Fig. 3M-P, yellow
arrows); these tendons persisted even in double mutant
Tgfb2-/-;Tgfb3-/- embryos (not shown).
|
;
Spagnoli et al., 2007).
Ligaments do not form in these joints (not shown), but that may be a secondary
consequence to the failure of joint formation. We therefore focused on the
knee, in which cavitation does occur in these embryos. ISH with a
Col1a1 probe (Fig.
3K,L) on a saggital section through the hindlimb, highlighted the
unique features of the knee, the cruciate ligaments that connect the femur and
the tibia, and the patella, connected to the tibia with the patellar ligament
and connected to the quadricep muscles with a short tendon
(Fig. 3L). Limited cavitation
could be seen in the knees of Tgfbr2Prx1Cre embryos, but
no ligaments or tendons were found in these knees
(Fig. 3M). The muscles were
also drastically atrophied in the mutant knee, but at E17.5 that was most
likely to be a secondary consequence of the loss of tendons. TGFβ
signaling is thus the first molecular activity shown to be essential for the
formation of almost all tendons and ligaments.
TGFβ signaling is required for TNP expansion and reorganization at E12.5
Having established an essential role for TGFβ signaling in tendon
genesis, we next wanted to identify the onset of the tendon phenotype in
TGFβ signaling mutants. Contrary to the dramatic tendon phenotype
described above, at E11.5 Scx expression appeared normal in
Tgfbr2Prx1Cre embryos (not shown) and
Tgfb2-/-;Tgfb3-/- embryos
(Fig. 4A,B). As it is possible
that residual TGFβ signaling exists in these mutants, we generated a null
allele of the type II receptor, Tgfbr2-/+, by recombining
the Tgfbr2flox allele in the germline (see Materials and
methods). Tgfbr2-/- embryos die at E10.5
(Oshima et al., 1996), but we
found that at E10.5 Scx expression was not affected, even in
Tgfbr2-/- embryos (Fig.
4C), demonstrating that the initial induction of TNPs was not
dependent on TGFβ signaling.
The first indication of tendon loss was seen in mutant embryos at E12.5, Scx expression in the somites of Tgfb2-/- embryos was markedly reduced and was almost completely lost in Tgfb2-/-;Tgfb3-/- embryos (Fig. 4D-F). Interestingly, in limbs of Tgfb2-/- embryos, Scx expression was dramatically reduced on the dorsal side but only partially reduced on the ventral side, corresponding to the loss of extensor but not flexor tendons in Tgfb2-/- embryos at later stages (Fig. 4G,H,J,K). Moreover, Scx expression could hardly be detected in Tgfbr2Prx1Cre limbs (not shown) and Tgfb2-/-;Tgfb3-/- limbs at E12.5 (Fig. 4I,L). The full scope of the tendon phenotype was thus reflected in the loss of TNPs already at E12.5, a stage in which the TNPs undergo expansion and reorganization to form loosely organized tendon primordia between the differentiating muscles and the cartilage condensations.
The dramatic loss of Scx expression between E11.5 and E12.5 could be the result of apoptosis of the TNPs in the absence of TGFβ signaling. However, TUNEL staining on frontal sections from trunks of Tgfb2-/- mutants at E11.5, E12.5 and E13.5, showed no cell death in the ScxGFP-positive TNPs, but robust TUNEL activity in the sclerotome (Fig. 4M,N; data not shown). Ectopic TUNEL labeling was also not found in sections from limb buds of Tgfbr2Prx1Cre embryos at E11.5 and E12.5 (not shown). The loss of Scx-expressing cells could also be caused by a failure of TNP proliferation, but BrdU labeling in ScxGFP-expressing cells appeared normal in limb buds of Tgfbr2Prx1Cre embryos at E11.5 (Fig. 4O). The loss of TNPs in TGFβ mutants is thus not caused by cell loss and is likely to represent a failure in maintenance of the tendon cell fate when TGFβ signaling was disrupted.
|
), which can
be conveniently visualized in frontal sections (illustrated in
Fig. 4A), wherein the myotomes
can be highlighted by antibody staining for MHC expression (see
Fig. 6A,B). Expression of
Tgfb3 in somites was very faint in embryos between E10.5 and E12.5,
but low levels of Tgfb3 were detected in the syndetome
(Fig. 6E,F). Interestingly,
Tgfb2, which plays a more central role in axial tendon development,
was not expressed in the syndetome, although expression was detected in
condensed medial domains, the initial sites of cartilage condensation
(Fig. 6I,J, black arrows), and
in a triangular domain overlapping with MHC expression at the center of the
differentiating myotome (Fig.
6I,J, red arrows). In limb buds, Tgfb2 was again expressed in prechondrogenic mesenchymal condensations as they emerge in a proximal to distal progression, resulting in transient expression in digit condensations at E12.0 and a later restriction to the presumptive joints by E13.0 (Fig. 5C,D). Expression of Tgfb2 was also seen in differentiating muscles in the limb buds, but the expression was less distinct than that seen in somites (Fig. 6K,L, red arrows). Finally, a comparison of Tgfb2 and Scx expression in alternating sections at E12.5 showed that Tgfb2 was expressed in some TNPs as well; for example, in the TNPs that connect the pronator quadratus muscle to the radius and ulna (Fig. 5D,L, black arrows), and in other TNPs demarcated more clearly in sagittal sections through limbs at this stage (Fig. 5C,K, black arrows). However, not all TNPs expressed Tgfb2; for instance, the TNPs in the digits, the last TNPs induced at this stage, were positive for Scx but did not express Tgfb2 (Fig. 5C,K, white arrows). Tgfb2 and Scx expression were also overlapping in prospective joints, although in this case Tgfb2 expression was much broader than that of Scx, as seen in the presumptive wrist joint (Fig. 6C,K, yellow arrows). Expression of Tgfb3 in limb buds at these stages was again very faint, but similar to the expression in somites, Tgfb3 transcripts were detected in TNPs, e.g. in the pronator quadratus tendons (Fig. 6H, black arrows).
The combined expression of Tgfb2 or Tgfb3 in the stages relevant for the tendon phenotype therefore encompasses the TNPs, the muscles and the prechondrogenic skeletal condensations, suggesting a possible role for TGFβ signaling in the interaction that is established at this stage between the forming tendons and their musculoskeletal counterparts. In an attempt to identify the cells that can activate TGFβ signaling, we examined the expression of Tgfbr2, finding low and very broad expression in the undifferentiated mesenchyme (Fig. 6G). Interestingly, Tgfbr2 was not expressed at the distal parts of the limb bud, the site of the most recent induction of TNPs at this stage (Fig. 6C,G, white arrows).
|
In limb buds, endogenous Scx expression is induced in mesenchymal
cells directly under the ectoderm
(Schweitzer et al., 2001), but
Scx expression induced by a TGFβ2 bead extended much deeper in
the mesenchyme (Fig. 7E,F).
Interestingly, Scx induction was limited to undifferentiated
mesenchyme and Scx expression was never detected in the ectoderm or
prechondrogenic condensations. Endogenous expression of Scx is also
constrained in the proximodistal axis, extending at E12.5 only up to the
forming metacarpal-phalangeal joint (Fig.
7H, red arrow). Interestingly, a TGFβ2 bead grafted at the
level of the metacarpal-phalangeal joint resulted in induction of Scx
expression proximal but not distal to the bead
(Fig. 7I, yellow arrow), and
the introduction of two TGFβ2 beads resulted in robust and symmetric
induction of Scx around the proximal bead, but Scx was not
induced around the distal bead. The distal restriction of Scx
induction by TGFβ-loaded beads is likely to be related to the fact that
expression of Tgfbr2 could not be detected in the distal mesenchyme
at this stage (Fig. 6G, white
arrows).
Scx induction has been previously associated with FGF signaling
and has been shown to be regulated by modulation of the MAP kinase cascade
(Brent et al., 2003;
Brent and Tabin, 2004;
Edom-Vovard and Duprez, 2004;
Smith et al., 2005). We
therefore used UO126, a specific inhibitor of ERK1/2 phosphorylation
(Favata et al., 1998;
Yamamoto et al., 2003), to
investigate whether Scx induction by TGFβ signaling occurred
through an indirect activation of the MAP kinase cascade. To verify inhibition
of the MAPK cascade, we tested induction of Sprouty2
(Spry2-Mouse Genome Informatics), a common target of FGF signaling
(Minowada et al., 1999), and
found that the induction of Sprouty2 by a bead loaded with FGF4
protein was completely blocked by the addition of 50 µM UO126 to the medium
(Fig. 7K,L). However, induction
of Scx by a TGFβ2 bead was not affected in the presence of the
same concentration of UO126 (Fig.
7M), demonstrating a MAPK-independent pathway for Scx
induction by TGFβ signaling.
Robust induction of Scx in organ culture led us to test the
capacity of TGFβ signaling to induce Scx expression in cultured
cells as well. Induction was initially tested in mouse embryonic fibroblasts
(MEFs) extracted from ScxGFP embryos. Propagation of ScxGFP
MEFs in culture resulted in complete loss of the ScxGFP signal
(Fig. 8A), but incubation with
0.3 nM TGFβ2 in the medium for 24 hours resulted in a considerable
induction of ScxGFP (Fig.
8A). The ScxGFP signal level was variable in the induced
MEFs, highlighting the importance of cellular context for Scx
induction. To examine the induction in a more homogenous system, we next
tested the effects of TGFβ signaling in C3H10T1/2 cells, a murine cell
line considered to represent a mesenchymal progenitor state
(Pinney and Emerson,
1989).
|
|
To distinguish between a simple induction of Scx and an induction
of TNPs, we wanted to evaluate the expression of other tendon markers
following TGFβ activation. Tenascin C, an extracellular matrix protein,
is expressed distinctly in tendons (Fig.
2I) (Chiquet-Ehrismann et al.,
1991), and the expression has previously been used as a good
marker for early tendon cells (Edom-Vovard
et al., 2002; Kardon,
1998). The induction of tenascin C by TGFβ signaling has been
previously reported (Pearson et al.,
1988), and was also detected in our TGFβ2-induced C3H10T1/2
cells (Fig. 7B), but
interestingly we did not detect induction of tenascin C by TGFβ beads in
organ cultures (not shown), highlighting the importance of the cellular
context for these activities.
A small number of other tendon markers have been identified, including
Tnmd (Brandau et al.,
2001), collagen XII and collagen XIV
(Walchli et al., 1994;
Young et al., 2000), and
mohawk (Anderson et al., 2006).
None of these genes has been linked to a progenitor state and some clearly
represent a later stage of tendon differentiation
(Murchison et al., 2007;
Shukunami et al., 2006). The
induction of any of these genes by TGFβ signaling could not be detected
in organ culture or in C3H10T1/2 cells (not shown), suggesting that additional
molecular events following the activation by TGFβ might be required for
tendon differentiation.
|
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Maintenance of the TNP cell fate is dependent on TGFβ signaling
TNPs, identified as Scx-expressing cells, are induced between E9.5
and E12.5 in the syndetome and limb bud mesenchyme, and later differentiate to
overtly distinct tendons by E13.5 (Brent et
al., 2003; Schweitzer et al.,
2001). The tendon phenotype in
Tgfb2-/-;Tgfb3-/- and
Tgfbr2Prx1Cre embryos highlights a crucial stage in tendon
development between E11.5 and E12.5; in mutant embryos, the TNPs appeared
normal up to E11.5 and were then lost by E12.5, demonstrating a role for
TGFβ signaling in maintenance of the tendon cell fate at this stage.
Significantly, the loss of Scx expression was not accompanied by cell
death, suggesting that in the absence of TGFβ signaling the progenitors
assumed a different cell fate.
|
). TNP
loss was also seen in muscleless limbs in chick embryos
(Edom-Vovard and Duprez, 2004;
Kardon, 1998), and in
muscleless limbs of mouse embryos homozygous for the splotch delayed
(Spd) mutation, in which Scx expression in the stylopod and zeugopod
was reduced by E12.5 but lost only at E13.5
(Bonnin et al., 2005;
Tremblay et al., 1998) (T. J.
Riordan and R.S., unpublished). TNP loss in all of these cases was not
associated with cell death. Taken together, these results imply that early
Scx expression does not represent a commitment to the tendon cell
fate and that putative TNPs are dependent on endogenous and exogenous
activities to persist on the path of tendon differentiation, including
TGFβ signaling at E11.5, a signal from muscles by E12.5 and the
transcriptional activities of Scx by E13.5. The emergence of overtly
distinct tendons at E13.5 is likely to be associated with differentiation of
TNPs to committed tenocytes.
TGFβs from the muscles and cartilage are essential for tendon formation
The robust induction of tendon markers by TGFβ signaling represents an
obvious mechanism for maintenance of the tendon cell fate. However, although
expression of Tgfb2 or Tgfb3 in the TNPs suggests an
autocrine TGFβ function, expression of these genes in the muscles and
cartilage suggests an alternative in which TGFβ signaling plays a role in
communication between the differentiating tissues of the musculoskeletal
system. In somites, Tgfb2 is expressed in the differentiating muscles
and cartilage, and Tgfb3 is expressed in the TNPs. The extensive loss
of TNPs in the somites and tail of Tgfb2-/- embryos
therefore demonstrates that the essential signal for maintenance of the TNPs
comes from the muscles and cartilage. Interestingly, although Tgfb3
expression in the TNPs is not sufficient for their maintenance, the
accelerated loss of TNPs in
Tgfb2-/-;Tgfb3-/- embryos shows that
Tgfb3, and by inference signals from the TNPs, also plays a
maintenance role (Fig. 9, white
arrows).
A similar analysis cannot be applied to the tendon phenotypes in limb buds
because of the overlap between the expression domains of TGFβ2 and
TGFβ3, but a comparison of the tendon phenotypes in the limbs of
TGFβ signaling mutants with the tendon phenotype in muscleless limbs
highlights a similar paradigm. In Spd embryos, Scx
expression in the limb bud is normal at E11.5, but expression in the
presumptive stylopod and zeugopod is decreased at E12.5 and lost completely by
E13.5 (Bonnin et al., 2005) (T.
J. Riordan and R.S., unpublished). A signal from the muscles, probably
TGFβ, is therefore essential for maintenance of the TNPs. The loss of
TNPs is, however, accelerated in TGFβ signaling mutants, with complete
loss of TNPs already at E12.5, showing that TGFβs from sources other than
the muscles, probably the expression of Tgfb2 and Tgfb3 in
the TNPs, also contribute to the maintenance of TNP cell fate. We therefore
conclude that TGFβs from the muscles and cartilage are essential for
tendon formation at E12.5, and that TGFβs from the TNPs also contribute
to the maintenance of tendon markers in these cells
(Fig. 9, white arrows).
Recruitment of new tendon cells by TGFβ signaling
The robust induction of tendon markers by TGFβ signaling suggests also
a possible role in the recruitment of new tendon cells. By E12.5, the TNPs
align between the differentiating muscles and cartilage as tendon primordia
that later connect with these tissues
(Brent et al., 2003) (T. J.
Riordan and R.S., unpublished). Dependence of tendon formation on TGFβ
signaling is thus concurrent with the integration of the musculoskeletal
system, and the essential role of TGFβs from the muscles and cartilage
implicates TGFβ signaling in the cross talk between the tissues of the
musculoskeletal system. TGFβs from the muscles and cartilage thus
inevitably affect adjacent mesenchymal cells as well and are likely to recruit
these cells to the tendon cell fate, leading to the generation of a continuous
tendon primordium between the muscles and cartilage
(Fig. 9, black arrows).
An important implication of this model is the notion that tendons may not
be derived exclusively from committed early progenitors. The assertion that
early Scx-expressing cells are tendon progenitors was based on the
continuity of Scx expression, but a direct lineage from early
Scx-expressing cells to all of the tenocytes in mature tendons has
not been shown to date (Brent et al.,
2003; Schweitzer et al.,
2001; Tozer and Duprez,
2005). The results in this study suggest a wave of tendon
progenitor recruitment between E11.5 and E12.5, and dynamic expression of the
TGFβ genes in tendons through embryogenesis (not shown) suggests that
TGFβ signaling may be involved in the recruitment of tendon cells in
later stages as well. Continuous recruitment of tendon cells is further
supported by the recent identification of progenitor or stem cells for tendons
that can be isolated from human and mouse tendons
(Bi et al., 2007).
Induction of TNPs by FGF and TGFβ signaling
A pulse of TGFβ signaling in C3H10T1/2 cells led to an early induction
of Scx expression that occurred within 30 minutes and which therefore
was most likely caused by direct mediators of TGFβ signaling. Elevated
levels of Scx persisted for 24 hours after activation, suggesting
that Scx expression might also be regulated secondarily by early
transcriptional targets of TGFβ signaling. Interestingly, previous
studies have shown a role for FGF signaling in the induction of TNPs. Both FGF
and TGFβ signaling might thus be involved in tendon induction, and
because TGFβ signaling is not essential for the early induction of TNPs,
it is possible that the two cascades are essential in complementary phases of
tendon induction - early progenitors being induced by FGF signaling and later
recruitment of tendon cells being mediated by TGFβ signaling.
Combined functions of TGFβ and FGF signaling that manifest in
synergism or epistasis of the two signaling cascades have been reported in a
number of developmental and disease processes, including survival of
dopaminergic neurons (Roussa et al.,
2004), development of lens cataracts
(Cerra et al., 2003),
chondrocyte proliferation (Mukherjee et
al., 2005) and the development of calvarial bones
(Sasaki et al., 2006). As both
FGF and TGFβ signaling have now been shown to induce early tendon
markers, it will be important to establish in future studies the relationships
between these signaling cascades in tendon induction.
The role of TGFβ signaling in differentiation of the connective tissues
The connective tissues comprise a heterogeneous group of tissues that
combine to generate complex ECM structures, and that have so far received
limited attention at the cellular and molecular levels. The fate of connective
tissues in mutant or manipulated embryos has not often been addressed, largely
owing to the paucity of distinct molecular markers. A possible role for
TGFβ signaling in the formation of these tissues was suggested previously
because of the capacity of TGFβ signaling to induce the accumulation of
ECM proteins (Mauviel, 2005).
Indeed, a recent study shows expression of TGFβ isoforms in healing
tendons and their capacity to promote tendon healing
(Chan et al., 2008). The
tendons and ligaments are classified as dense regular connective tissues, and
a recent study has demonstrated a disruption of another of these tissues, the
annulus fibrosus of the intervertebral disc, when
Tgfbr2flox was targeted using the Col2Cre mouse
(Baffi et al., 2006). TGFβ
signaling might also be involved in the induction or differentiation of other
connective tissues. For example, the less compact appearance of muscles in
mutant embryos suggests a partial disruption of the connective tissues of the
muscles. Finally, the demonstration that the skeletal phenotype in the deltoid
tuberosity of Tgfb2-/- mutants was a secondary consequence
of the loss of limb tendons and biomechanical stimulation, suggests that
unrecognized effects on the development of connective tissues may underlie
other phenotypes identified in TGFβ signaling mutants.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/8/1351/DC1
|
Footnotes |
|---|
* These authors contributed equally to this work 
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Anderson, D. M., Arredondo, J., Hahn, K., Valente, G., Martin,
J. F., Wilson-Rawls, J. and Rawls, A. (2006). Mohawk is a
novel homeobox gene expressed in the developing mouse embryo. Dev.
Dyn. 235,792
-801.[CrossRef][Medline]
Baffi, M. O., Slattery, E., Sohn, P., Moses, H. L., Chytil, A.
and Serra, R. (2004). Conditional deletion of the TGF-beta
type II receptor in Col2a expressing cells results in defects in the axial
skeleton without alterations in chondrocyte differentiation or embryonic
development of long bones. Dev. Biol.
276,124
-142.[CrossRef][Medline]
Baffi, M. O., Moran, M. A. and Serra, R.
(2006). Tgfbr2 regulates the maintenance of boundaries in the
axial skeleton. Dev. Biol.
296,363
-374.[CrossRef][Medline]
Benjamin, M., Kaiser, E. and Milz, S. (2008).
Structure-function relationships in tendons: a review. J.
Anat. 212,211
-228.[CrossRef][Medline]
Bi, Y., Ehirchiou, D., Kilts, T. M., Inkson, C. A., Embree, M.
C., Sonoyama, W., Li, L., Leet, A. I., Seo, B. M., Zhang, L. et al.
(2007). Identification of tendon stem/progenitor cells and the
role of the extracellular matrix in their niche. Nat.
Med. 13,1219
-1227.[CrossRef][Medline]
Bonnin, M. A., Laclef, C., Blaise, R., Eloy-Trinquet, S.,
Relaix, F., Maire, P. and Duprez, D. (2005). Six1 is not
involved in limb tendon development, but is expressed in limb connective
tissue under Shh regulation. Mech. Dev.
122,573
-585.[CrossRef][Medline]
Brandau, O., Meindl, A., Fassler, R. and Aszodi, A.
(2001). A novel gene, tendin, is strongly expressed in tendons
and ligaments and shows high homology with chondromodulin-I. Dev.
Dyn. 221,72
-80.[CrossRef][Medline]
Brent, A. E. and Tabin, C. J. (2004). FGF acts
directly on the somitic tendon progenitors through the Ets transcription
factors Pea3 and Erm to regulate scleraxis expression.
Development 131,3885
-3896.
Brent, A. E., Schweitzer, R. and Tabin, C. J.
(2003). A somitic compartment of tendon progenitors.
Cell 113,235
-248.[CrossRef][Medline]
Cerra, A., Mansfield, K. J. and Chamberlain, C. G.
(2003). Exacerbation of TGF-beta-induced cataract by FGF-2 in
cultured rat lenses. Mol. Vis.
9, 689-700.[Medline]
Chai, Y., Jiang, X., Ito, Y., Bringas, P., Jr, Han, J., Rowitch,
D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000).
Fate of the mammalian cranial neural crest during tooth and mandibular
morphogenesis. Development
127,1671
-1679.[Abstract]
Chan, K.-M., Fu, S.-C., Wong, Y.-P., Hui, W.-C., Cheuk, Y.-C.
and Wong, M. W.-N. (2008). Expression of transforming growth
factor β isoforms and their roles in tendon healing. Wound Rep.
Reg. 16,399
-407.[CrossRef]
Chiquet-Ehrismann, R., Matsuoka, Y., Hofer, U., Spring, J.,
Bernasconi, C. and Chiquet, M. (1991). Tenascin variants:
differential binding to fibronectin and distinct distribution in cell cultures
and tissues. Cell Regul.
2, 927-938.[Medline]
Chytil, A., Magnuson, M. A., Wright, C. V. and Moses, H. L.
(2002). Conditional inactivation of the TGF-beta type II receptor
using Cre:Lox. Genesis
32, 73-75.[CrossRef][Medline]
Cserjesi, P., Brown, D., Ligon, K. L., Lyons, G. E., Copeland,
N. G., Gilbert, D. J., Jenkins, N. A. and Olson, E. N.
(1995). Scleraxis: a basic helix-loop-helix protein that
prefigures skeletal formation during mouse embryogenesis.
Development 121,1099
-1110.[Abstract]
Dudas, M., Kim, J., Li, W. Y., Nagy, A., Larsson, J., Karlsson,
S., Chai, Y. and Kaartinen, V. (2006). Epithelial and
ectomesenchymal role of the type I TGF-beta receptor ALK5 during facial
morphogenesis and palatal fusion. Dev. Biol.
296,298
-314.[CrossRef][Medline]
Dunker, N. and Krieglstein, K. (2000). Targeted
mutations of transforming growth factor-beta genes reveal important roles in
mouse development and adult homeostasis. Eur. J.
Biochem. 267,6982
-6988.[Medline]
Dysart, P. S., Harkness, E. M. and Herbison, G. P.
(1989). Growth of the humerus after denervation. An experimental
study in the rat. J. Anat.
167,147
-159.[Medline]
Edom-Vovard, F. and Duprez, D. (2004). Signals
regulating tendon formation during chick embryonic development.
Dev. Dyn. 229,449
-457.[CrossRef][Medline]
Edom-Vovard, F., Bonnin, M. and Duprez, D.
(2001). Fgf8 transcripts are located in tendons during embryonic
chick limb development. Mech. Dev.
108,203
-206.[CrossRef][Medline]
Edom-Vovard, F., Schuler, B., Bonnin, M. A., Teillet, M. A. and
Duprez, D. (2002). Fgf4 positively regulates scleraxis and
tenascin expression in chick limb tendons. Dev. Biol.
247,351
-366.[CrossRef][Medline]
Favata, M. F., Horiuchi, K. Y., Manos, E. J., Daulerio, A. J.,
Stradley, D. A., Feeser, W. S., Van Dyk, D. E., Pitts, W. J., Earl, R. A.,
Hobbs, F. et al. (1998). Identification of a novel inhibitor
of mitogen-activated protein kinase kinase. J. Biol.
Chem. 273,18623
-18632.
Kardon, G. (1998). Muscle and tendon
morphogenesis in the avian hind limb. Development
125,4019
-4032.[Abstract]
Kontges, G. and Lumsden, A. (1996).
Rhombencephalic neural crest segmentation is preserved throughout craniofacial
ontogeny. Development
122,3229
-3242.[Abstract]
Kulkarni, A. B., Huh, C. G., Becker, D., Geiser, A., Lyght, M.,
Flanders, K. C., Roberts, A. B., Sporn, M. B., Ward, J. M. and Karlsson,
S. (1993). Transforming growth factor beta 1 null mutation in
mice causes excessive inflammatory response and early death. Proc.
Natl. Acad. Sci. USA 90,770
-774.
Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N. and
Tabin, C. J. (2002). Expression of Cre Recombinase in the
developing mouse limb bud driven by a Prxl enhancer.
Genesis 33,77
-80.[CrossRef][Medline]
Massague, J., Blain, S. W. and Lo, R. S.
(2000). TGFbeta signaling in growth control, cancer, and
heritable disorders. Cell
103,295
-309.[CrossRef][Medline]
Mauviel, A. (2005). Transforming growth
factor-beta: a key mediator of fibrosis. Methods Mol.
Med. 117,69
-80.[Medline]
Merino, R., Ganan, Y., Macias, D., Economides, A. N., Sampath,
K. T. and Hurle, J. M. (1998). Morphogenesis of digits in the
avian limb is controlled by FGFs, TGFbetas, and noggin through BMP signaling.
Dev. Biol. 200,35
-45.[CrossRef][Medline]
Minowada, G., Jarvis, L. A., Chi, C. L., Neubuser, A., Sun, X.,
Hacohen, N., Krasnow, M. A. and Martin, G. R. (1999).
Vertebrate Sprouty genes are induced by FGF signaling and can cause
chondrodysplasia when overexpressed. Development
126,4465
-4475.[Abstract]
Mukherjee, A., Dong, S. S., Clemens, T., Alvarez, J. and Serra,
R. (2005). Coordination of TGF-beta and FGF signaling
pathways in bone organ cultures. Mech. Dev.
122,557
-571.[CrossRef][Medline]
Murchison, N. D., Price, B. A., Conner, D. A., Keene, D. R.,
Olson, E. N., Tabin, C. J. and Schweitzer, R. (2007).
Regulation of tendon differentiation by scleraxis distinguishes
force-transmitting tendons from muscle-anchoring tendons.
Development 134,2697
-2708.
Oka, K., Oka, S., Hosokawa, R., Bringas, P., Jr, Brockhoff, H.
C., 2nd, Nonaka, K. and Chai, Y. (2008). TGF-beta mediated
Dlx5 signaling plays a crucial role in osteo-chondroprogenitor cell lineage
determination during mandible development. Dev. Biol.
321,303
-309.[CrossRef][Medline]
Oshima, M., Oshima, H. and Taketo, M. M.
(1996). TGF-beta receptor type II deficiency results in defects
of yolk sac hematopoiesis and vasculogenesis. Dev.
Biol. 179,297
-302.[CrossRef][Medline]
Pearson, C. A., Pearson, D., Shibahara, S., Hofsteenge, J. and
Chiquet-Ehrismann, R. (1988). Tenascin: cDNA cloning and
induction by TGF-beta. EMBO J.
7,2977
-2982.[Medline]
Pinney, D. F. and Emerson, C. P., Jr (1989).
10T1/2 cells: an in vitro model for molecular genetic analysis of mesodermal
determination and differentiation. Environ. Health
Perspect. 80,221
-227.[Medline]
Proetzel, G., Pawlowski, S. A., Wiles, M. V., Yin, M., Boivin,
G. P., Howles, P. N., Ding, J., Ferguson, M. W. and Doetschman, T.
(1995). Transforming growth factor-beta 3 is required for
secondary palate fusion. Nat. Genet.
11,409
-414.[CrossRef][Medline]
Pryce, B. A., Brent, A. E., Murchison, N. D., Tabin, C. J. and
Schweitzer, R. (2007). Generation of transgenic tendon
reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis gene.
Dev. Dyn. 236,1677
-1682.[CrossRef][Medline]
Roussa, E., Farkas, L. M. and Krieglstein, K.
(2004). TGF-beta promotes survival on mesencephalic dopaminergic
neurons in cooperation with Shh and FGF-8. Neurobiol.
Dis. 16,300
-310.[CrossRef][Medline]
Sanford, L. P., Ormsby, I., Gittenberger-de Groot, A. C.,
Sariola, H., Friedman, R., Boivin, G. P., Cardell, E. L. and Doetschman,
T. (1997). TGFbeta2 knockout mice have multiple developmental
defects that are non-overlapping with other TGFbeta knockout phenotypes.
Development 124,2659
-2670.[Abstract]
Sasaki, T., Ito, Y., Bringas, P., Jr, Chou, S., Urata, M. M.,
Slavkin, H. and Chai, Y. (2006). TGFbeta-mediated FGF
signaling is crucial for regulating cranial neural crest cell proliferation
during frontal bone development. Development
133,371
-381.
Schweitzer, R., Chyung, J. H., Murtaugh, L. C., Brent, A. E.,
Rosen, V., Olson, E. N., Lassar, A. and Tabin, C. J. (2001).
Analysis of the tendon cell fate using Scleraxis, a specific marker for
tendons and ligaments. Development
128,3855
-3866.
Seo, H. S. and Serra, R. (2007). Deletion of
Tgfbr2 in Prx1-cre expressing mesenchyme results in defects in development of
the long bones and joints. Dev. Biol.
310,304
-316.[CrossRef][Medline]
Serra, R. and Chang, C. (2003). TGF-beta
signaling in human skeletal and patterning disorders. Birth Defects
Res. C Embryo Today 69,333
-351.[CrossRef][Medline]
Shi, Y. and Massague, J. (2003). Mechanisms of
TGF-beta signaling from cell membrane to the nucleus.
Cell 113,685
-700.[CrossRef][Medline]
Shinohara, H. (1999). The musculature of the
mouse tail is characterized by metameric arrangements of bicipital muscles.
Okajimas Folia Anat. Jpn
76,157
-169.[Medline]
Shukunami, C., Takimoto, A., Oro, M. and Hiraki, Y.
(2006). Scleraxis positively regulates the expression of
tenomodulin, a differentiation marker of tenocytes. Dev.
Biol. 298,234
-247.[CrossRef][Medline]
Smith, T. G., Sweetman, D., Patterson, M., Keyse, S. M. and
Munsterberg, A. (2005). Feedback interactions between MKP3
and ERK MAP kinase control scleraxis expression and the specification of rib
progenitors in the developing chick somite.
Development 132,1305
-1314.
Spagnoli, A., O'Rear, L., Chandler, R. L., Granero-Molto, F.,
Mortlock, D. P., Gorska, A. E., Weis, J. A., Longobardi, L., Chytil, A.,
Shimer, K. et al. (2007). TGF-beta signaling is essential for
joint morphogenesis. J. Cell Biol.
177,1105
-1117.
Tozer, S. and Duprez, D. (2005). Tendon and
ligament: development, repair and disease. Birth Defects Res. C
Embryo Today 75,226
-236.[CrossRef][Medline]
Tremblay, P., Dietrich, S., Mericskay, M., Schubert, F. R., Li,
Z. and Paulin, D. (1998). A crucial role for Pax3 in the
development of the hypaxial musculature and the long-range migration of muscle
precursors. Dev. Biol.
203, 49-61.[CrossRef][Medline]
Walchli, C., Koch, M., Chiquet, M., Odermatt, B. F. and Trueb,
B. (1994). Tissue-specific expression of the
fibril-associated collagens XII and XIV. J. Cell Sci.
107,669
-681.[Abstract]
Yamamoto, T., Cui, X. M. and Shuler, C. F.
(2003). Role of ERK1/2 signaling during EGF-induced inhibition of
palatal fusion. Dev. Biol.
260,512
-521.[CrossRef][Medline]
Young, B. B., Gordon, M. K. and Birk, D. E.
(2000). Expression of type XIV collagen in developing chicken
tendons: association with assembly and growth of collagen fibrils.
Dev. Dyn. 217,430
-439.[CrossRef][Medline]
Zuniga, A., Haramis, A. P., McMahon, A. P. and Zeller, R.
(1999). Signal relay by BMP antagonism controls the SHH/FGF4
feedback loop in vertebrate limb buds. Nature
401,598
-602.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
This article has been cited by other articles:
|
|
 |
|
  C. I. Lorda-Diez, J. A. Montero, C. Martinez-Cue, J. A. Garcia-Porrero, and J. M. Hurle Transforming Growth Factors {beta} Coordinate Cartilage and Tendon Differentiation in the Developing Limb Mesenchyme J. Biol. Chem., October 23, 2009; 284(43): 29988 - 29996. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
