spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online March 20, 2009
doi: 10.1242/10.1242/dev.026476


Development 136, 1375-1385 (2009)
Published by The Company of Biologists 2009


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tzchori, I.
Right arrow Articles by Yang, Y.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Tzchori, I.
Right arrow Articles by Yang, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

LIM homeobox transcription factors integrate signaling events that control three-dimensional limb patterning and growth

Itai Tzchori1,*, Timothy F. Day2,*, Peter J. Carolan2,{dagger}, Yangu Zhao1, Christopher A. Wassif3, LiQi Li4, Mark Lewandoski5, Marat Gorivodsky2, Paul E. Love4, Forbes D. Porter3, Heiner Westphal1,{ddagger} and Yingzi Yang2,{ddagger}

1 Section on Mammalian Molecular Genetics, Laboratory of Mammalian Genes and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, MD 20892, USA.
2 Section on Developmental Genetics, Genetic Disease Research Branch, National Human Genome Research Institute, Bethesda, MD 20892, USA.
3 Section on Molecular Dysmorphology, Heritable Disorders Branch, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, MD 20892, USA.
4 Section on Cellular and Developmental Biology, Laboratory of Mammalian Genes and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, MD 20892, USA.
5 Laboratory of Cancer and Developmental Biology, NCI-Frederick, National Institutes of Health, Frederick, MD 21702, USA.

{ddagger} Authors for correspondence (e-mails: hw{at}mail.nih.gov; yingzi{at}mail.nih.gov)

Accepted 12 February 2009


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vertebrate limb development is controlled by three signaling centers that regulate limb patterning and growth along the proximodistal (PD), anteroposterior (AP) and dorsoventral (DV) limb axes. Coordination of limb development along these three axes is achieved by interactions and feedback loops involving the secreted signaling molecules that mediate the activities of these signaling centers. However, it is unknown how these signaling interactions are processed in the responding cells. We have found that distinct LIM homeodomain transcription factors, encoded by the LIM homeobox (LIM-HD) genes Lhx2, Lhx9 and Lmx1b integrate the signaling events that link limb patterning and outgrowth along all three axes. Simultaneous loss of Lhx2 and Lhx9 function resulted in patterning and growth defects along the AP and the PD limb axes. Similar, but more severe, phenotypes were observed when the activities of all three factors, Lmx1b, Lhx2 and Lhx9, were significantly reduced by removing their obligatory co-factor Ldb1. This reveals that the dorsal limb-specific factor Lmx1b can partially compensate for the function of Lhx2 and Lhx9 in regulating AP and PD limb patterning and outgrowth. We further showed that Lhx2 and Lhx9 can fully substitute for each other, and that Lmx1b is partially redundant, in controlling the production of output signals in mesenchymal cells in response to Fgf8 and Shh signaling. Our results indicate that several distinct LIM-HD transcription factors in conjunction with their Ldb1 co-factor serve as common central integrators of distinct signaling interactions and feedback loops to coordinate limb patterning and outgrowth along the PD, AP and DV axes after limb bud formation.

Key words: Ldb1, Lhx9, Lhx2, Limb development, Lmx1b, Signaling, Mouse


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vertebrate limb outgrowth and patterning are coordinately regulated by signaling centers that produce secreted factors to control the behavior of their neighboring cells. During this process, transcription factors regulate both signal reception and emission by controlling gene expression. Proximodistal (PD) limb bud outgrowth is regulated by a positive-feedback loop between fibroblast growth factor 10 (Fgf10) of the distal limb mesenchyme and Fgfs of the apical ectodermal ridge (AER) (Lewandoski et al., 2000Go; Min et al., 1998Go; Ohuchi et al., 1997Go; Sekine et al., 1999Go; Sun et al., 2002Go). Fgf10 is required for PD limb outgrowth as the limb bud in the Fgf10-/- mouse embryo fails to grow (Min et al., 1998Go; Sekine et al., 1999Go). The AER, a thickened epithelial structure formed at the distal edge of the limb bud, serves as a signaling center to control PD limb outgrowth and patterning (Bell et al., 1959Go) by secreting multiple Fgfs (Martin, 1998Go). Among these, Fgf4 and Fgf8 play prominent roles as limb bud development fails in their absence (Sun et al., 2002Go). In addition to sustaining cell survival, AER-Fgfs regulate PD-patterning gene expression during early limb bud development to specify a distal domain (Mariani et al., 2008Go). T-box transcription factors Tbx5 and Tbx4 are required for forelimb and hindlimb initiation, respectively, by activating the expression of Fgf10 in the presumptive and early limb bud mesenchyme (Agarwal et al., 2003Go; Naiche and Papaioannou, 2003Go; Rallis et al., 2003Go). They are not required for subsequent limb outgrowth or Fgf10 expression once the limb bud has formed (Hasson et al., 2007Go; Naiche and Papaioannou, 2007Go). Thus, the transcription mechanism that regulates Fgf10 expression in response to Fgf8 after limb bud initiation remains to be elucidated.

Anteroposterior (AP) limb patterning is controlled by Sonic hedgehog (Shh) expressed in the zone of polarizing activity (ZPA) located at the posterior limb margin (Riddle et al., 1993Go). AP limb patterning and growth is intrinsically connected to PD limb outgrowth. Shh signaling is required for Fgf4 expression in the AER (Laufer et al., 1994Go; Niswander et al., 1994Go). It also maintains the AER structure itself by regulating gremlin 1 (Grem1) expression (Khokha et al., 2003Go; Zuniga et al., 1999Go). Conversely, Fgf signaling from the AER controls Shh expression in the ZPA (Laufer et al., 1994Go; Niswander et al., 1994Go). However, little is known about the transcriptional control of Shh-Fgf signaling interactions.

Dorsoventral (DV) limb patterning is controlled by Wnt7a in the dorsal ectoderm and by engrailed 1 (En1) in the ventral ectoderm (Loomis et al., 1996Go; Parr and McMahon, 1995Go). Wnt7a activates the expression of a LIM homeodomain (LIM-HD) transcription factor Lmx1b in the dorsal limb mesenchyme (Riddle et al., 1995Go), and Lmx1b determines dorsal cell fates (Chen et al., 1998Go; Dreyer et al., 1998Go; Vogel et al., 1995Go). DV limb polarity also indirectly affects AP limb patterning because Wnt7a is required to regulate Shh expression in the ZPA (Parr and McMahon, 1995Go; Yang and Niswander, 1995Go). Again, the transcription factors that regulate Shh expression and link DV and AP limb patterning are still unknown.

The LIM-HD regulators of transcription are evolutionarily conserved. In the developing Drosophila wing, the LIM-HD transcription factor apterous (ap) is expressed in dorsal cells and is required to specify dorsal cell fates. ap also directs limb outgrowth by establishing a signaling center at the boundary between dorsal and ventral cells (Cohen et al., 1992Go; Diaz-Benjumea and Cohen, 1993Go; Ng et al., 1996Go). In the developing mouse limb, Lhx2 and Lhx9, two functional homologs of ap, are expressed in the distal limb bud, whereas Lmx1b, another homolog of ap, is expressed in the dorsal limb mesenchyme (Chen et al., 1998Go; Rincon-Limas et al., 1999Go; Rodriguez-Esteban et al., 1998Go). However, neither Lhx2 nor Lhx9 mouse mutants show limb defects (Birk et al., 2000Go; Porter et al., 1997Go).

Here, we have taken a multifaceted loss-of-function approach to test whether three of the LIM-HD genes, Lmx1b, Lhx2 and Lhx9, act together to control mouse limb development in a way that resembles that of ap in Drosophila wing development. We have determined that Lhx2, Lhx9 and Lmx1b are major LIM-HD family members expressed in the developing limb bud. The limbs of the Lhx2-/-;Lhx9-/- double mutant embryos were significantly shorter with fewer digits. In addition, the function of Lhx2, Lhx9 and Lmx1b was reduced simultaneously in the pre-limb mesenchyme by Cre-mediated inactivation of Ldb1, which encodes an essential cofactor of LIM-HD factors (Agulnick et al., 1996Go; Mukhopadhyay et al., 2003Go; Zhao et al., 2007Go). In the Ldb1 mutant embryos, the limbs were ventralized and more severely shortened. Our analysis demonstrates that Ldb1 is required to maintain the expression of Fgf10 and Grem1 in the limb mesenchyme in response to Fgf8 and Shh, respectively. We conclude that a transcriptional apparatus encompassing LIM-HD factors and their co-factor Ldb1 acts as a central signaling integrator in distal limb mesenchymal cells to link limb patterning and growth along all three axes.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation and genotyping the mouse lines
The Lhx2+/-, Lhx9+/- and Ldb1c/+ mice have been described previously (Birk et al., 2000Go; Porter et al., 1997Go; Zhao et al., 2007Go). Genotyping was performed by PCR using genomic DNA prepared from tail snips or extra-embryonic membranes. The oligonucleotides used to genotype T-Cre mice were: Cre forward, 5'-CCATGAGTGAACGAACCTGG-3'; Cre reverse, 5'-GGGACCCATTTTTCTCTCC-3'. Conditional Ldb1 mice were genotype by using these oligos: Ldb1 forward, 5'-CAGCAAACGGAGGAAACGGAAGATGTCAG-3'; and Ldb1 reverse, 5'-CTTATGTGACCACAGCCATGCATGCATGTG-3'. To genotype the Ldb1 null allele, two oligos were used: NEO 3R forward, 5'-ACGAGTTCTTCTGAGGGGATC-3'; Ldb1 reverse, 5'-TGCCACACAGAATCTGCTCTGAACGTCT-3'.

Skeletal analysis
Embryos at 15.5 dpc or 18.5 dpc were dissected in PBS. The embryos were skinned, eviscerated and fixed in 95% ethanol. Skeletal preparations were performed as described previously (McLeod, 1980Go).

Histology, in situ hybridization and immunohistochemistry
For in situ hybridization, embryos were fixed in 4% paraformaldehyde at 4°C overnight. Some fixed samples were embedded in paraffin and sectioned at 5 µm. Histological analysis, immunohistochemistry, whole-mount and radioactive 35S RNA in situ hybridization were performed as described previously (Yang et al., 2003Go). The following primary antibodies were used: anti-Ldb1 polyclonal anti-Ldb1 (prepared in the lab 1:4000); anti-phospho-histone H3 antibody (1:500, Millipore); anti-BrdU (1; 20, Chemicon); and anti-cleaved caspase 3 (Asp 175) (1:400, Cell Signaling Technology). Signals were detected using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA, USA). The slides were counterstained with Methyl Green or Toluidine Blue.

Limb explant culture
Limbs were removed from 10.5 dpc and 11.25 dpc embryos and cultured on nuclearpore filters (0.1 µm pore size, Whatman) at the interphase of air and medium (BGJB, Invitrogen) with antibiotics/antimycotic solution (Invitrogen). Beads were soaked in 1 µg/µl of either BSA, Shh, Fgf10 or Fgf8 protein (R&D Systems) for 1 hour and then inserted into the limbs. Limbs were cultured for 20-24 hours, fixed with 4% paraformaldehyde in PBS and then processed for whole-mount in situ hybridization.

Cell proliferation and apoptosis assays
Paraffin wax-embedded sections were stained with the rabbit anti-phosphohistone H3 antibody. Signals were detected using biotin-conjugated secondary antibodies using ABC kit (Vectorstain). Cell death was detected as described previously (Barrow et al., 2003Go; Reis and Edgar, 2004Go).

Primers used for examining the expression of LIM-HD genes by RT-PCR
Primers used were: Lhx1 F, 5'AGACTGGCCTCAACATGCGTGTTA; Lhx1 R, 5'GTGCCAGGATGTCAGTAAATCGCT; Lhx2 F, 5'AGCACACTTTAACCATGCCGACGT; Lhx2 R, 5'ATTGTCCGAAGCTGGTGGTGCTT; Lhx3 F, 5'ACCGACATTGGCACAGCAAGTGT; Lhx3 R, 5'TCGCTGCTTGGCTGTTTCGTAGT; Lhx4 F, 5'ACTTTGTCTACCACCTGCACTGCT; Lhx4 R, 5'GGCTCCTCTTGACACTCTTGTAGA; Lhx5 F, 5'CTCATCGGACAAGGAAACCGCTAACA; Lhx5 R, 5'GGAGCGTAGTAGTCACTTTGGTAGT; Lhx6 F, 5'CTCTGGACAAGGACGAAGGTAGA; Lhx6 R, 5'CCTCTTGAGGTTCTCGATCATGGT; Lhx8 F, 5'ATGACTTATGCTGGCATGTCCGCT; Lhx8 R, 5'AGTGCACTCTACAGAGGACCTTCT; Lhx9 F, 5'ATCTGCTGGCCGTAGACAAACAGT; Lhx9 R, 5'TGCCAGTGCCATTGAAGTAAGGCA; Islet1 F, 5'GCTCATGAAGGAGCAACTAGTGGAGA; Islet1 R, 5'TTAGAGCCTGGTCCTCCTTCTGAA; Islet2 F, 5'ACGCGCTCATGAAAGAGCAGCTAGTA; Islet2 R, 5'GAGTGCAAACTCGCTGAGTGCTTT; Lmx1a F, 5'AAATGGTAGTGGGAATGCGGGCAT; Lmx1a R, 5'TTCTGAGGTTGCCAGGAAGCAGT; Lmx1b F, 5'AGTGTGTGTACCACTTGGGCTGTT; Lmx1b R, 5'AGGATGCCTTGAAAGCTCTTCGCT; Ldb1 F, 5'GAGGCACACACCATATGGTAACCA; Ldb1 R, 5'ATGAGCTCTCTGTGTTGCCGGAT; Ldb2 F, 5'ACTGGAGCCAATGCAGGAACTGAT; Ldb2 R, 5'AAGTCTTCTTCGTCGTCCATGCCGTT.

Preparation of tissues for scanning electron microscopy (SEM)
Samples were prepared for SEM according to the manufacturer (Ted Pella, Reading, CA). Briefly, limb samples were rinsed in 0.2 M sodium cacodylate buffer, postfixed in sodium cacodylate buffer (4% formaldehyde, 2% glutaraldehyde and 0.1 M sodium cacodylate) and stored at 4°C. The samples were dehydrated in graded ethanol solutions (e.g., 35, 50, 70, 95 and 100%), infiltrated in a 1:1 mixture of absolute ethanol and Peldri (Zimmer, 1989Go), followed by pure Peldri for 1 hour at 37°C. Following a change of pure Peldri, the solution was allowed to solidify at room temperature, and sublimation was completed in a vacuum chamber overnight. The embryos were attached on an SEM aluminum stub with double-sided adhesive tape and coated with gold palladium in a vacuum evaporator. Embryos were photographed with a Hitachi S-570 scanning electron microscope operated at 8 kV.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Lhx2, Lhx9 and their co-factor Ldb1 are required for limb development
Lhx2, Lhx9 and Lmx1b are homologous to the Drosophila ap gene, a major regulator of wing development. To test whether Lhx2, Lhx9 and Lmx1b play redundant roles in regulating limb development, we first compared their expression patterns in the early mouse limb bud (Fig. 1A). At 9.5 days post coitum (dpc), when the forelimb just forms, both Lhx2 and Lhx9 were expressed throughout the limb mesenchyme, whereas Lmx1b expression was restricted to the dorsal limb mesenchyme. At later stages (i.e. at 11.0 dpc), when there is substantial PD outgrowth of the limb bud, Lhx2 and Lhx9 were similarly expressed in the distal limb mesenchyme. Lmx1b expression, although still restricted to the dorsal mesenchyme, showed no PD bias. At 12.5 dpc, when chondrogenesis starts in the limb, Lhx2 and Lhx9 expression was still distally restricted and found in the interdigital area. Lmx1b expression was weaker in the interdigital area, possibly owing to reduced cell numbers. These results suggest that Lhx2 and Lhx9 may play redundant roles in controlling limb development, and that Lmx1b may compensate for the function of Lhx2 and Lhx9 when they are missing in the dorsal limb bud mesenchyme. We also examined the expression of all LIM-HD genes in the hindlimb bud by reverse transcriptase-polymerase chain reaction (RT-PCR) (see Table S1 in the supplementary material) and found that Islet1 and Islet2 were expressed in the limb bud. Islet1 expression appeared to be confined to the early stages of hindlimb bud development (see Table S1 in the supplementary material), in agreement with the published expression patterns of Islet1 and Islet2 in the early limb bud (MGI:3508865, MGI:3509558). Expression of Islet1 was no longer detected in the hindlimb after 10.5 dpc by whole-mount in situ hybridization. Ldb1 is an obligatory co-factor of LIM-HD factors, as null mutants of Ldb1 phenocopy individual or combined mutants of LIM-HD genes in other contexts (Suleiman et al., 2007Go; Zhao et al., 2007Go). Ldb1 protein was ubiquitously expressed in the limb bud at all stages that we analyzed (Fig. 1B).


Figure 1
View larger version (99K):
[in this window]
[in a new window]

 
Fig. 1. Expression of Lhx2, Lhx9, Lmx1b and Ldb1 in wild-type limb buds. (A) Whole-mount in situ hybridization of Lhx2, Lhx9 and Lmx1b. Only forelimbs are shown. Hindlimbs had the same expression patterns. (B) Expression of the Ldb1 protein in the hindlimb, as shown by immunohistochemistry on cryosections (9.5 dpc and 10.5 dpc) and paraffin sections (11.5 dpc and 12.5 dpc). Ldb1 was ubiquitously expressed in the limb bud. See Fig. S1 in the supplementary material for controls of the Ldb1 antibodies.

 
We generated Lhx2-/-;Lhx9-/- double mutant embryos to test their redundant functions in limb development. Most of the double mutant embryos died around 15.5 dpc with defects in both the forelimbs and the hindlimbs, and such limb defects were progressively more severe distally. The zeugopod (radius and ulna or tibia and fibula) and autopod (carpals/tarsals, metacarpals/metatarsals and digits) were severely shortened and only two or three digits had formed (Fig. 2A). These digits, especially in the forelimb, did not have clear identities, as carpal/tarsal bones were fused and the number of phalanges was reduced. The Lhx2-/-;Lhx9+/- and Lhx2+/-;Lhx9-/- mutants developed largely normal limbs (Fig. 2A; data not shown) except that distal phalanges were slightly shorter. These results indicate that Lhx2 and Lhx9 play equivalent and redundant roles in mouse limb development and that one gene copy of either Lhx2 or Lhx9 is sufficient to regulate PD limb outgrowth and AP limb patterning.

To further test whether Lmx1b, and possibly other LIM-HD genes, can function like Lhx2 and Lhx9 in the dorsal limb mesenchyme, we reduced the activities of all LIM-HD genes in the developing limb bud by inactivating Ldb1 specifically in the developing limb bud. We generated the Ldb1c/-;T-Cre mice by crossing mice carrying a floxed Ldb1 allele (Zhao et al., 2007Go) with T-Cre mice. T-Cre activity results in recombination in the mesoderm of the primitive streak and has been useful to bypass gastrulation defects, thereby resulting in embryos with mesodermal lineages that carry specific Cre-induced gene inactivation (Perantoni et al., 2005Go; Verheyden et al., 2005Go). As the limb bud mesenchyme is derived from mesoderm, Ldb1c/-;T-Cre mice should lack Ldb1 activity in this tissue. At 11.5 dpc, Ldb1 expression in the Ldb1c/-;T-Cre limb bud was absent in most cells of the hindlimb mesenchyme, whereas expression in the ectoderm was not affected (see Fig. S1A in the supplementary material). The Ldb1c/-;T-Cre embryos exhibited similar, yet slightly more severe, limb defects compared with those in the Lhx2-/-;Lhx9-/- double mutant embryos (Fig. 2B). We focused subsequent studies on the hindlimb as the forelimb phenotype of the Ldb1c/-;T-Cre embryos was weaker (Fig. 2B) because more cells there have escaped Cre-mediated Ldb1 inactivation.

The hindlimb zeugopod and tarsal region of 15.5 dpc Ldb1c/-;T-Cre mutant embryos were more reduced compared with those in the Lhx2-/-;Lhx9-/- double mutant embryos (Fig. 2B). The autopod had only two or three digits, resembling the Lhx2-/-;Lhx9-/- double mutant limb (Fig. 2B). The tarsal region was fused and the digits left might be digit 1 and 4 according to their morphology and positions (Zhu et al., 2008Go). It appears that the phenotype in the Ldb1c/-;T-Cre limbs is somewhat less severe (see Fig. S2B and S3 in the supplementary material) because some cells had escaped recombination in the Ldb1c/-;T-Cre hindlimb buds and, as a result, a residual amount of Ldb1-positive (Ldb1+) cells formed patches in the distal limb bud at 12.5 dpc (see Fig. S1 in the supplementary material).

Importantly, expression of the dorsal limb marker Lmx1b was normal at 10.5 dpc but missing in patches of the dorsal limb bud at 12.5 dpc (see Fig. S2A in the supplementary material), suggesting partial ventralization of the Ldb1c/-;T-Cre limb. We reasoned that Ldb1 deficiency would lead to impaired Lmx1b function, ultimately resulting in loss of dorsal cell fate and then of Lmx1b expression. The DV patterning defect of the Ldb1c/-;T-Cre hindlimb bud and the similarities between its limb phenotype and that of the Lhx2-/-;Lhx9-/- embryos indicated that Lhx2, Lhx9 and Lmx1b are the major LIM-HD factors that act together with Ldb1 in regulating limb development.

Lhx2, Lhx9 and their co-factor Ldb1 are required for AP limb patterning by controlling Shh expression
To understand the molecular mechanism underlying the defects in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre limbs, expression of key regulatory genes in early limb patterning and growth along the PD, AP and DV axes were examined. As digit number is reduced when Shh activity is reduced or removed later in the limb bud (Lewis et al., 2001Go; Zhu et al., 2008Go), we examined Shh expression in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre embryos. In the Lhx2-/-;Lhx9-/- mutant, there was a progressive loss of Shh expression in the ZPA (Fig. 3A). Shh expression was normal before 10.0 dpc (data not shown). Starting at 10.5 dpc, Shh expression was significantly reduced in the forelimb, whereas, in the hindlimb, decreased Shh expression was less pronounced. This may be due to a time lag between the onset of forelimb and hindlimb development. Reduced Shh expression was confirmed by reduced expression of patched 1 (Ptch1), a transcription target of Hedgehog signaling (Fig. 3A) (Goodrich et al., 1996Go; Marigo et al., 1996Go). In the Ldb1c/-;T-Cre mutant limb bud, Shh expression was diminished at 10.75 dpc in the hindlimb bud (Fig. 3B). This was confirmed by reduced expression of Gli1, another transcription target of Hedgehog signaling (Fig. 3B). The expression of Fgf4, also regulated by Shh signaling, was lost in the AER of the mutant limb bud (Fig. 3B). In addition, bone morphogenetic protein 4 (Bmp4), which requires Shh signaling to be expressed at the normal level (Chiang et al., 2001Go; Lewis et al., 2001Go), was reduced in expression in the anterior limb bud and AER (Fig. 3B). Consistent with the reduced Shh expression, the distal limb bud was noticeably narrower along the AP axis by 11.5 dpc in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre mutant, ultimately leading to fewer digits.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 2. Limb defects in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre embryos. Limb skeletal preparations of mouse embryos are shown. (A) At 15.5 dpc, only Lhx2-/-;Lhx9-/- mutant limbs showed severely shortened zeugopod and autopod (arrows), and fewer digits in both the forelimb and the hindlimb. (B) At 15.5 dpc, Ldb1c/-;T-Cre mutant hindlimb showed severely shortened zeugopod and autopod (arrows) and fewer digits. The phenotype in the hindlimb was more severe than that in the forelimb. FL, forelimb; HL, hindlimb; H, humerus; R, radius; U, ulna; Fe, femur; T, tibia; Fi, fibula; S, stylopod; Z, zeugopod; A, autopod.

 
Lhx2, Lhx9 and their co-factor Ldb1 are required for the response to Shh signaling by regulating Grem1 expression
As Shh signaling regulates Fgf4 expression in the AER through Grem1, which encodes a secreted Bmp inhibitor (Zuniga et al., 1999Go), we next examined Grem1 expression in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre mutant limb buds. In both cases, Grem1 expression was significantly reduced compared with the control (Fig. 3C). Strikingly, the symmetrical expression pattern of Grem1 in dorsal and ventral limb mesenchyme was disrupted in the Lhx2-/-;Lhx9-/- mutant limb bud (Fig. 3D). Although Grem1 expression in the dorsal limb mesenchyme was reduced, its expression was almost completely lost in the ventral limb mesenchyme of the Lhx2-/-;Lhx9-/- mutant embryo. By contrast, the expression pattern of Lmx1b appeared unchanged, indicating that DV limb patterning was not altered in the Lhx2-/-;Lhx9-/- mutant limb bud. Therefore, the more pronounced loss of Grem1 expression in the ventral limb is not a consequence of defects in DV limb patterning. These results raised an interesting possibility that the residual Grem1 expression in the dorsal limb mesenchyme is maintained by a dorsal-specific transcription factor that is partially redundant with Lhx2 and Lhx9, which can conceivably be Lmx1b. As Lmx1b function was also compromised in the Ldb1c/-;T-Cre limb bud, we reasoned that Grem1 expression should be lost to similar levels in both dorsal and ventral limb mesenchyme in the Ldb1c/-;T-Cre limb bud, and this was indeed the case (Fig. 3E). As Lmx1b is the only dorsal-specific LIM-HD factor in the developing mouse limb, our results suggest that Lmx1b can substitute for the function of Lhx2 and Lhx9 to a certain extent in the dorsal limb mesenchyme by regulating the expression of Grem1 and possibly other signaling factors.

To test whether reduced Grem1 expression in the Ldb1c/-;T-Cre and Lhx2-/-;Lhx9-/- mutant limb buds resulted from reduced Shh expression or Shh signaling activity, we inserted Shh-coated beads into the hindlimb buds of the Shh-/-, Ldb1c/-;T-Cre and Lhx2-/-;Lhx9-/- mutants, as well as wild-type embryos and compared Grem1 expression levels. Although Shh beads upregulated Grem1 expression in the Shh-/- limb bud, they failed to do so in the Ldb1c/-;T-Cre and Lhx2-/-;Lhx9-/- mutant hindlimb bud (Fig. 4A,B). In addition, Shh beads in the anterior limb bud of the wild-type and Lhx2-/-;Lhx9+/- embryos expanded Fgf4 expression in the AER, but failed to do so in the Lhx2-/-;Lhx9-/- mutant limb bud (Fig. 4C). However, Ptch1 expression was similarly induced by the Shh beads in both wild-type and Ldb1c/-;T-Cre mutant hindlimb bud (Fig. 4D). These results indicate that Shh activation of Grem1 expression, rather than Shh signal transduction itself, requires LIM-HD/Ldb1 activities. Thus, Ldb1, in conjunction with the LIM-HD transcription factors expressed in the limb bud, acts in limb mesenchymal cells to control the production of some output signals in response to Shh, such as Grem1.


Figure 3
View larger version (88K):
[in this window]
[in a new window]

 
Fig. 3. Shh expression and response were impaired in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre limbs. Whole-mount in situ hybridization was performed to examine gene expression. In situ hybridization with the 35S-labelled probes of Lmx1b and Grem1 was performed on limb sections at 10.5 dpc. (A) Expression of indicated genes in the 10.5 dpc Lhx2-/-;Lhx9-/- limbs. Reduced gene expression in the mutant limbs is indicated by arrows. FL, forelimb; HL, hindlimb. (B) Expression of indicated genes in the 10.75 dpc Ldb1c/-;T-Cre hindlimb. (C) Significantly reduced Grem1 expression in the 10.5 dpc hindlimb of the Ldb1c/-;T-Cre embryo and the 10.5 dpc forelimb of the Lhx2-/-;Lhx9-/- embryo. In A-C, reduced gene expression in the mutant limbs is indicated by arrows. (D) Loss of Grem1 expression was more severe in the ventral limb bud of the Lhx2-/-;Lhx9-/- embryo (arrow). Lmx1b expression in the dorsal limb was not altered in the Lhx2-/-;Lhx9-/- limb. (E) Grem1 expression was similarly lost in both dorsal and ventral Ldb1c/-;T-Cre hindlimb bud at 11.0 dpc (arrow). D, dorsal; V, ventral. AER, apical ectodermal ridge.

 
Lhx2, Lhx9 and their co-factor Ldb1 are required for PD limb outgrowth by regulating Fgf10 expression
Lhx2 and Lhx9 expression in the distal limb bud resembles that of Fgf10 (Ohuchi et al., 1997Go), which is required for PD limb outgrowth (Min et al., 1998Go; Sekine et al., 1999Go). Fgf10 and other Fgfs expressed in the AER, mainly Fgf8, regulate each other's expression, and such reciprocal regulation primarily controls PD limb outgrowth. At 9.5 dpc when the hindlimb bud is initiated, expression of Fgf10 was normal in the Ldb1c/-;T-Cre mutant compared with the wild-type control (Fig. 5A). However, Fgf10 expression was rapidly reduced during successive stages of limb development. Shortly after limb initiation, Fgf10 expression began to disappear in patches in the distal forelimb at 9.5 dpc (Fig. 5A). At 10.25 dpc and 10.5 dpc, Fgf10 expression was much reduced (Fig. 5A). Surprisingly, the distal expression of sprouty 4 (Spry4), a transcription target of Fgf signaling (Minowada et al., 1999Go), was almost normal in the Ldb1c/-;T-Cre hindlimb bud at 10.5 dpc and 11.5 dpc (Fig. 5B and data not shown), suggesting that in the to Ldb1c/-;T-Cre hindlimb, Fgf8 signaling is transduced at normal levels, but unable to maintain Fgf10 expression. In the Lhx2-/-;Lhx9-/- mutant limb bud, we also observed reduction of Fgf10 expression, although not as severe as that in the Ldb1c/-;T-Cre limb bud (Fig. 5A).

Fgf8 expression was detected in the AER in the Ldb1c/-;T-Cre limb bud at 10.25 dpc, but its expression domain was thinner and truncated posteriorly (Fig. 5C). In the Lhx2-/-;Lhx9-/- mutant, Fgf8 expression was also lost in the posterior AER, but this happens at a slightly later developmental stage (Fig. 5D). At 10.5 dpc, in the Ldb1c/-;T-Cre mutant limb, Fgf8 expression in the AER became very spotty and the AER was completely flattened by 11.5 dpc (Fig. 5C). These results indicate that Lhx2, Lhx9 and Ldb1 are not required for the initial expression of Fgf10 and Fgf8, but they are likely to mediate the positive-feedback loop between Fgf10 and Fgf8 by regulating Fgf10 expression in the limb mesenchyme in response to Fgf8 signaling.

The distal limb bud of the Ldb1c/-;T-Cre embryo at 11.5 dpc still expressed Lhx9, which marks the distal domain (Fig. 5E), indicating that loss of Fgf10 expression later in limb development did not result in loss of distal limb bud cells. However, when the zeugopod and autopod skeletal primordia were detected by Sox9 in situ hybridization at 12.5 dpc, both were much smaller, and distal chondrogenesis was much reduced in the Ldb1c/-;T-Cre mutant limb (Fig. 5F). As premature AER loss due to AER specific removal of fibroblast growth factor receptor 2 (Fgfr2) delayed generation of above threshold number of progenitors required to form normal autopod skeletons (Lu et al., 2008Go; Yu and Ornitz, 2008Go), reduced autopod skeleton formation in the Ldb1c/-;T-Cre mutant limb bud may also be a result of reduced limb progenitor cells owing to reduced Fgf and Shh signaling.


Figure 4
View larger version (36K):
[in this window]
[in a new window]

 
Fig. 4. Regulation of Grem1 expression by Shh was impaired in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre limbs. (A) Shh-coated beads were implanted into the hindlimb buds at 10.5 dpc and Grem1 expression was examined. (B) Grem1 expression was reduced in the 10.5 dpc Lhx2-/-;Lhx9-/- hindlimb bud, most notably in the posterior part. Ectopic Grem1 expression in the anterior limb bud was induced by Shh beads in the control Lhx2+/-;Lhx9+/- limb, but not in the Lhx2-/-;Lhx9-/- limb (arrows). Control beads were inserted to the contralateral limb buds. D, dorsal; V, ventral. (C) Shh-coated beads were implanted into 10.25 dpc forelimb buds and Fgf4 expression was not induced in the Lhx2-/-;Lhx9-/- limb (arrow). (D) Shh-coated beads were implanted into the hindlimb buds at 11.0 dpc. Ptch1 expression was upregulated in the Ldb1c/-;T-Cre and wild-type limb buds.

 
Lhx2, Lhx9, Lmx1b and their co-factor Ldb1 integrate limb patterning and growth along all three axes
The growth and patterning defects along the AP, DV and PD axes in the Ldb1c/-;T-Cre mutant limb suggest that Lhx2, Lhx9, Lmx1b and their co-factor Ldb1 coordinate limb patterning and growth along all three axes. To test this hypothesis, we first inserted Fgf8-coated beads into the hindlimb mesenchyme. Fgf8 beads upregulated Fgf10 expression in the control limb bud, but failed to maintain or activate Fgf10 expression in the Ldb1c/-;T-Cre hindlimb (Fig. 6A). By contrast, Fgf10 beads rescued Fgf8 expression in the AER of the Ldb1c/-;T-Cre and Lhx2-/-;Lhx9-/- limb buds (Fig. 6B,C), indicating that one of the primary defects in the Ldb1c/-;T-Cre and Lhx2-/-;Lhx9-/- limb buds was reduced Fgf10 expression. Furthermore, Fgf8 beads induced Spry4 expression around the beads in the 10.5 dpc Ldb1c/-;T-Cre limb bud (Fig. 6D). This finding is consistent with the normal Spry4 expression in the Ldb1c/-;T-Cre hindlimb bud (Fig. 5B). When cell death was examined in the cultured limb bud by whole-mount TUNEL assay (see Fig. S4 in the supplementary material), no difference was found between cultured wild-type and Ldb1c/-;T-Cre hindlimb buds. Thus, weakened or loss of gene expression in the mutant cultured limb bud is not a result of excessive cell death. Our results confirm that Fgf8 signal itself is transduced at normal levels in the Ldb1c/-;T-Cre limb bud and that the LIM-HD factors are required in the positive-feedback loop to regulate Fgf10 expression.

Next, we tested whether the LIM-HD factors are also required in the positive-feedback loop between Fgf signaling from the AER and Shh expression in the ZPA. In the Shh-/- mutant limb, PD limb outgrowth was reduced with prematurely degenerated AER and reduced Fgf8 expression (Chiang et al., 2001Go). The zeugopod phenotype of Shh-/- mutant (Chiang et al., 2001Go) is similar to that of the Ldb1c/-;T-Cre limb. To test whether Ldb1 also acts to maintain Shh expression in response to Fgf signaling from the AER, we inserted Fgf8-coated beads into the posterior hindlimb mesenchyme of 10.5 dpc embryos. Fgf8 beads expanded Shh expression domain in the control hindlimb (Fig. 6E), but failed to do so in the Ldb1c/-;T-Cre mutant (Fig. 6E). We did notice that small patches of distal limb bud cells under the AER and around the Fgf8 bead expressed Shh in the Ldb1c/-;T-Cre mutant. These are probably the Ldb1+ cells that have escaped recombination by the T-Cre and can therefore respond to the recombinant Fgf8. As Grem1 also plays an essential role in limb mesenchymal-epithelial signaling interactions, and both A-P and P-D limb defects were observed in the Grem1-/- limb bud (Khokha et al., 2003Go; Michos et al., 2004Go), another mechanism used by Lhx2, Lhx9, Lmx1b and Ldb1 to coordinate limb development along the AP and PD axes is to regulate Grem1 expression in response to Shh signaling (Fig. 3C).

Ldb1 is required to maintain cell proliferation in the limb bud
The smaller limb sizes in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre embryos suggest that Ldb1 in conjunction with the transcriptional regulators that depend on this co-factor, regulates cell proliferation and/or cell survival. To test this, we examined cell proliferation and cell death in the hindlimb bud of the Ldb1c/-;T-Cre embryos. At early stages (i.e. 10.5 dpc) of development, cell proliferation was similar throughout the entire limb bud. We observed a significant reduction of cell proliferation in the Ldb1c/-;T-Cre embryos (Fig. 7A,B). By 11.5 dpc, cell proliferation progressively reduces in the distal to proximal direction in the wild-type limb bud. In the mutant limb bud, there was a significant reduction in cell proliferation in all regions of the limb (Fig. 7A,B). We did not detect significant difference of cell death in most regions of the limb between the mutant and wild type (Fig. 7C). However, consistent with reduced Fgf signaling from the AER, we found that cell death was slightly increased in the proximal limb bud of the Ldb1c/-;T-Cre mutant (Fig. 7C).


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our report is focused on transcriptional regulation in response to cell-cell signaling that controls limb patterning and outgrowth. We show that the LIM-HD transcription factors Lhx2 and Lhx9 play redundant roles to integrate limb outgrowth and patterning along the PD and AP axes by regulating the expression of the crucial signaling molecules Shh, Grem1 and Fgf10 in the posterior distal limb mesenchyme (Fig. 7D). In addition, by removing Lhx2 and Lhx9, we uncovered a previously undescribed role of the dorsal determinant Lmx1b. In our mutants, it can partially substitute for the function of Lhx2 and Lhx9 in regulating AP and PD limb patterning and outgrowth through Grem1 (Fig. 7D). Furthermore, conditional inactivation of Ldb1, an essential co-factor of LIM-HD genes, causes additional phenotypes that affect limb development not only along the PD and AP, but also the DV axis. Curtailing Ldb1 function in the limb bud leads to signaling defects that can be ascribed to the malfunction of several LIM-HD factors, including Lhx2, Lhx9 and Lmx1b. Our data revealed that Ldb1 and the associated LIM-HD transcription factors act in concert to integrate the signal exchange between limb mesenchyme and ectoderm that regulates limb growth and patterning along all three axes.


Figure 5
View larger version (72K):
[in this window]
[in a new window]

 
Fig. 5. Reduced Fgf10 and Fgf8 expression in the Lhx2-/-;Lhx9-/- and Ldb1c/-;T-Cre limbs. Whole- mount in situ hybridization was performed. (A) Fgf10 expression was rapidly lost in the mutant limb bud. Loss of Fgf10 expression was first observed in the distal-most limb bud (arrow). Loss of Fgf10 expression in the Lhx2-/-;Lhx9-/- hindlimb bud was less significant (arrow). (B) Spry4 was expressed almost normally in the Ldb1c/-;T-Cre mutant hindlimb bud at 10.5 dpc. (C) Fgf8 expression was progressively reduced in the AER of the Ldb1c/-;T-Cre hindlimb bud (black arrows). The AER was completely flattened (yellow arrows) at 11.5 dpc, as shown by the scanning EM. (D) Fgf8 expression was lost in the posterior AER of the Lhx2-/-;Lhx9-/- forelimb bud at 10.5 dpc (arrow and broken line). (E) Lhx9 expression in the 11.5 dpc hindlimb. (F) Sox9 expression in the 12.5 dpc hindlimb bud. Small Sox9-expressing domains the Ldb1c/-;T-Cre mutant are indicated by arrows. Z, zeugopod; A, autopod.

 
LIM-HD transcription factors act as a central integrator for patterning and growth along the three axes of the limb
Crosstalk among the signaling centers that control limb development along the PD, AP and DV axes have been previously identified as a signal relay in which a cell receives a signal and emits its own signal(s) to elicit responses in neighboring cells. It was unknown prior to our study how such signal relays were transcriptionally controlled. We show that a transcriptional complex whose essential elements include Ldb1 and LIM-HD protein is instrumental in controlling signaling interactions and integrations in the early limb bud. Shh and Fgf10 expression in response to Fgf8 signaling and Grem1 expression in response to Shh signaling are controlled by the same family of transcription factors directly or indirectly (Fig. 7D). Therefore, Ldb1, together with a select group of LIM-HD transcription factors, acts as a central intracellular integrator to coordinate limb development along all three axes by mediating at least two distinct signaling feedback loops: Shh-AER and Fgf10-Fgf8 (Fig. 7D). This is quite intriguing because Shh and Fgfs signal through completely different intracellular pathways that can be distinguished by their well-established signaling read-outs. The Ldb1/LIM-HD transcription complex appears to control some specific responses to Shh and Fgf8 signaling, rather than regulating these signaling activities per se in the limb bud mesenchyme. Thus, one system the limb bud has employed is a remarkably efficient signaling integration strategy, whereby LIM-HD/Ldb1 factors act as a central node in the distal limb mesenchymal cells. This central node first receives signaling inputs from any one of the three axes and subsequently controls the production of signals that can regulate patterning and growth along other axes. One possibility is that LIM-HD/Ldb1 factors regulate expression of some downstream genes of both Fgf and Shh signaling. However, one cannot rule out that some or even all of these regulations may be indirect. As the expression of Shh, Grem1 and Fgf10 in the mesenchyme gradually decreases as the limb mesenchymal cells differentiate, it is possible that the LIM-HD transcription factors and co-factors may also maintain limb progenitor cell states by regulating responses to AER-Fgfs and Shh. Recent studies have shown that both Fgf and Shh signaling act to sustain progenitor pools required for proper limb patterning and growth (Lu et al., 2008Go; Mariani et al., 2008Go; Towers et al., 2008Go; Yu and Ornitz, 2008Go; Zhu et al., 2008Go). Entirely compatible with this idea is our observation that Lhx2 and Lhx9 expression was lost in the older distal limb bud when chondrogenesis started (Fig. 1). Furthermore, Lhx2 has been shown to control an early progenitor cell state during hair follicle formation or in the hematopoietic system (Rhee et al., 2006Go).


Figure 6
View larger version (92K):
[in this window]
[in a new window]

 
Fig. 6. Production of output signals in response to Fgf8 signaling is disrupted in the Ldb1c/-;T-Cre and Lhx2-/-;Lhx9-/- mutant limb buds. (A) The Fgf8-soaked bead implanted in the 10.5 dpc hindlimb failed to upregulate Fgf10 expression in the Ldb1c/-;T-Cre mutant limb (arrow). (B) Fgf10-soaked beads, but not control beads, rescued Fgf8 expression in the AER of the Ldb1c/-;T-Cre mutant limb (arrow). Beads were implanted into the 10.5 dpc hindlimb bud. Ventral view of the limbs is shown. (C) Fgf10-soaked beads, but not control beads, rescued Fgf8 expression in the AER of the Lhx2-/-;Lhx9-/- forelimb bud mutant limb (arrows). Beads were implanted into the 11.0 dpc forelimb bud. Dorsal view of the limbs is shown. Control beads fell off in the Lhx2-/-;Lhx9-/- forelimb bud during the in situ hybridization procedure. (D) Fgf8-soaked beads implanted into the 10.5 dpc hindlimb bud induced Spry4 expression in both Ldb1c/-;T-Cre mutant and wild-type limb buds. (E) At 10.25 dpc, loss of Shh expression in the hindlimb of the Ldb1c/-;T-Cre mutant embryo (arrow) was not rescued by the implanted Fgf8-soaked bead. Only small patches of Shh expression were detected around the Fgf8-soaked bead and under the AER. Shh expression in the hindgut is indicated by an arrowhead.

 
Growth and patterning signals are integrated in the distal limb mesenchyme
Lhx2 and Lhx9 are expressed throughout the early limb bud. Later in limb development, their expression is restricted to the distal limb mesenchyme (Fig. 1). Lmx1b expression overlaps with that of Lhx2 and Lhx9 in the dorsal limb bud. The distal limb mesenchyme is the location where signaling inputs from the AER (Fgf8), ZPA (Shh) and the dorsal ectoderm (Wnt7a) are integrated. The LIM-HD transcription factors Lhx2, Lhx9 and Lmx1b, and possibly additional members of this family, regulate the production of output signals, including Fgf10, Shh and Grem1 in the limb mesenchyme in response to the integrated signals (Fig. 7D). A fate-mapping study in the early chick limb bud indicates that regionalization along the PD axis progresses in a proximal-to-distal direction. Cells located more distally are less restricted in terms of their final regional identities and thus able to contribute to limb structures that span a larger domain (Sato et al., 2007Go). Therefore, it appears that more distal limb cells are more expandable and have more plasticity in this regard. This further underscores the likelihood that the LIM-HD factors Lhx2, Lhx9 and Lmx1b may regulate a transcription profile required for maintaining a progenitor state and that this profile may also allow the distal limb cells to express downstream genes regulated by Fgf and Shh signals. Our model predicts that, in the absence of Lhx2 and Lhx9 function, mesenchymal cells of the limb bud will assume a more determined and regionalized state such that their ability to expand is severely compromised. Indeed, the limb buds were smaller, narrower and limb skeletal segments were either much shorter or missing in the Lhx2-/-;Lhx9-/- and the Ldb1c/-;T-Cre mutant, although zeugopods and autopods still formed. Some elements (i.e. the tarsal bones) were fused together. These phenotypes are very similar to those observed in the Fgf and Shh signaling-deficient limbs, in which missing skeletal elements are thought to be caused by reduced progenitor cell numbers (Sun et al., 2002Go; Zhu et al., 2008Go). However, Fgf8/4 signaling does not control Lhx2/9 expression (see Fig. S5 in the supplementary material). In addition, in contrast to the Shh, Grem1 and all Fgf mutants, reduced cell proliferation, rather than cell death, is the major contributing factor to the small limb phenotypes in the Ldb1 mutant limb. This may be due to incomplete loss of Shh, Fgf and Grem1 signaling in the Ldb1 mutant.


Figure 7
View larger version (65K):
[in this window]
[in a new window]

 
Fig. 7. Reduced proliferation was detected in the Ldb1c/-;T-Cre mutant limb. (A) Analysis of cell proliferation in wild-type and the Ldb1c/-;T-Cre hindlimb bud by staining the limb sections with the anti-phosphohistone H3 (anti-PHH3) antibodies to show cells in M phase. (B) Stained and total cell numbers were counted in the boxed regions in A of the section from three independent limbs at the same stages. The average percentage of M-phase cells in different samples is shown in B. Reduction of cell proliferation was more severe in the ventral limb. (C) Cell death was analyzed by immunohistochemistry with cleaved caspase 3 antibodies in transverse sections of hindlimb buds at 11.5 dpc. The boxed proximal limb regions are shown at higher magnification underneath. Cell death was increased in the mutant. (D) Model of signaling interactions in the early limb bud mediated by the LIM-HD factors and Ldb1. Our data provide strong evidence that a transcriptional machinery composed of LIM-HD transcription factors Lhx2, Lhx9, Lmx1b and their common co-factor, Ldb1, mediates at least two distinct signaling feedback loops (orange and blue arrows, respectively) between the AER and the underlying mesenchyme of the limb bud. These feedback loops integrate limb growth and patterning along the PD, AP and DV axes. The LIM-HD transcription factors enable Fgf8 emanating from the AER to control Shh expression, which in turn governs AER maintenance through Grem1 expression in the mesenchyme (orange arrows). Grem1 expression also regulates Fgf4 expression (stripes) in the posterior AER. Strong Fgf signaling from the AER also inhibits Grem1 in the mesenchyme under the AER (Verheyden and Sun, 2008Go). In addition, these transcription factors regulate the feedback loop between Fgf10 and Fgf8 expression required for PD limb outgrowth (blue arrows).

 
It appears that Lhx2 and Lhx9 are the major LIM-HD transcription factors acting in conjunction with Ldb1 to coordinate early limb patterning and outgrowth. This by no means excludes the possibility that additional factors participate in the transcriptional regulation of this process. Ldb2, a close family member of Ldb1, is also expressed in the developing limb bud (see Table S1 and http://www.informatics.jax.org/searches/image.cgi?11751). Ldb2-/- mice do not have limb defects (H.W., unpublished). However, these two genes may play redundant roles in limb development. Besides mediating the function of the three LIM-HD factors analyzed in this report, they are likely to affect the function of additional Ldb-associated regulators in the developing limb. For example, our RT-PCR analysis (Table S1 in the supplementary material) revealed the presence of appreciable amounts of Islet1 transcripts at transient stages of early limb bud formation. Also, GATA and Ssdp factors are regularly observed in the context of Ldb/LIM-HD transcriptional activity (van Meyel et al., 2003Go; Vyas et al., 1999Go). Furthermore, in the Twist1-/- limb bud, the Fgf10-Fgf8 feedback loop is also disrupted (Zuniga et al., 2002Go), raising the possibility that the LIM-HD/Ldb1 factors in the limb may also interact with Twist1.

Different molecular mechanisms underlie the function of Lhx2 and Lhx9 during evolution in limb development
Despite the functional similarity between ap in Drosophila and Lhx2, Lhx9 and Lmx1b in the mouse, the underlying molecular mechanisms by which these transcription factors regulate limb development may not be conserved. In the Drosophila wing primordium, ap induces the expression of the Notch ligand Serrate in dorsal cells and restricts the expression of Delta, another Notch ligand, to the ventral cells (Diaz-Benjumea and Cohen, 1995Go; Milan and Cohen, 2000Go). Serrate and Delta activates Notch signaling. This induces Wg expression in cells along the DV boundary, which is required for PD outgrowth (Diaz-Benjumea and Cohen, 1995Go; Doherty et al., 1996Go). Limb development in vertebrates is more complicated, as it involves two distinct germ layers: ectoderm and the mesoderm. The ectoderm emits signals (i.e. Wnt7a and Fgf8), whereas the mesoderm responds to these signals by expressing Lmx1b, Shh and Fgf10, which, in turn, control DV, AP and PD limb patterning and outgrowth, respectively. Lhx2, Lhx9 and Lmx1b are expressed only in the limb mesenchyme, whereas the action of Notch ligand jagged 2 (a homologue of Drosophila Serrate) appears to be mainly confined to the AER, which is an ectodermal structure (Sidow et al., 1997Go; Valsecchi et al., 1997Go). Therefore, Lhx2, Lhx9 and Lmx1b may not act through controlling the activation of Notch signaling by directly regulating the expression of jagged 2, its major ligand in the developing limb. Rather, a new mechanism may have been evolved in higher vertebrates whereby Lhx2, Lhx9 and Lmx1b coordinate three-dimensional limb patterning and outgrowth.

Supplementary material
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/136/8/1375/DC1


    Footnotes
 
We thank members of the Yang and Westphal laboratories for stimulating discussion, and Julia Fekecs for help with figure preparation. Dr Gail Martin kindly provided the Spry4 probe. This work was supported by NIH intramural research programs of NHGRI, NICHD and NCI. Deposited in PMC for release after 12 months.

* These authors contributed equally to the work Back

{dagger} Present address: Department of Stem Cell and Regenerative Biology, Harvard Stem Cell Institute, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138, USA Back


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Agarwal, P., Wylie, J. N., Galceran, J., Arkhitko, O., Li, C., Deng, C., Grosschedl, R. and Bruneau, B. G. (2003). Tbx5 is essential for forelimb bud initiation following patterning of the limb field in the mouse embryo. Development 130,623 -633.[Abstract/Free Full Text]
Agulnick, A. D., Taira, M., Breen, J. J., Tanaka, T., Dawid, I. B. and Westphal, H. (1996). Interactions of the LIM-domain-binding factor Ldb1 with LIM homeodomain proteins. Nature 384,270 -272.[CrossRef][Medline]
Barrow, J. R., Thomas, K. R., Boussadia-Zahui, O., Moore, R., Kemler, R., Capecchi, M. R. and McMahon, A. P. (2003). Ectodermal Wnt3/beta-catenin signaling is required for the establishment and maintenance of the apical ectodermal ridge. Genes Dev. 17,394 -409.[Abstract/Free Full Text]
Bell, E., Saunders, J. W., Jr and Zwilling, E. (1959). Limb development in the absence of ectodermal ridge. Nature 184,1736 -1737.[CrossRef][Medline]
Birk, O. S., Casiano, D. E., Wassif, C. A., Cogliati, T., Zhao, L., Zhao, Y., Grinberg, A., Huang, S., Kreidberg, J. A., Parker, K. L. et al. (2000). The LIM homeobox gene Lhx9 is essential for mouse gonad formation. Nature 403,909 -913.[CrossRef][Medline]
Chen, H., Lun, Y., Ovchinnikov, D., Kokubo, H., Oberg, K. C., Pepicelli, C. V., Gan, L., Lee, B. and Johnson, R. L. (1998). Limb and kidney defects in Lmx1b mutant mice suggest an involvement of LMX1B in human nail patella syndrome. Nat. Genet. 19, 51-55.[CrossRef][Medline]
Chiang, C., Litingtung, Y., Harris, M. P., Simandl, B. K., Li, Y., Beachy, P. A. and Fallon, J. F. (2001). Manifestation of the limb prepattern: limb development in the absence of sonic hedgehog function. Dev. Biol. 236,421 -435.[CrossRef][Medline]
Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D. and Cohen, S. M. (1992). apterous, a gene required for imaginal disc development in Drosophila encodes a member of the LIM family of developmental regulatory proteins. Genes Dev. 6, 715-729.[Abstract/Free Full Text]
Diaz-Benjumea, F. J. and Cohen, S. M. (1993). Interaction between dorsal and ventral cells in the imaginal disc directs wing development in Drosophila. Cell 75,741 -752.[CrossRef][Medline]
Diaz-Benjumea, F. J. and Cohen, S. M. (1995). Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121,4215 -4225.[Abstract]
Doherty, D., Feger, G., Younger-Shepherd, S., Jan, L. Y. and Jan, Y. N. (1996). Delta is a ventral to dorsal signal complementary to Serrate, another Notch ligand, in Drosophila wing formation. Genes Dev. 10,421 -434.[Abstract/Free Full Text]
Dreyer, S. D., Zhou, G., Baldini, A., Winterpacht, A., Zabel, B., Cole, W., Johnson, R. L. and Lee, B. (1998). Mutations in LMX1B cause abnormal skeletal patterning and renal dysplasia in nail patella syndrome. Nat. Genet. 19, 47-50.[CrossRef][Medline]
Goodrich, L. V., Johnson, R. L., Milenkovic, L., McMahon, J. A. and Scott, M. P. (1996). Conservation of the hedgehog/patched signaling pathway from flies to mice: induction of a mouse patched gene by Hedgehog. Genes Dev. 10,301 -312.[Abstract/Free Full Text]
Hasson, P., Del Buono, J. and Logan, M. P. (2007). Tbx5 is dispensable for forelimb outgrowth. Development 134,85 -92.[Abstract/Free Full Text]
Khokha, M. K., Hsu, D., Brunet, L. J., Dionne, M. S. and Harland, R. M. (2003). Gremlin is the BMP antagonist required for maintenance of Shh and Fgf signals during limb patterning. Nat. Genet. 34,303 -307.[CrossRef][Medline]
Laufer, E., Nelson, C. E., Johnson, R. L., Morgan, B. A. and Tabin, C. (1994). Sonic hedgehog and Fgf-4 act through a signaling cascade and feedback loop to integrate growth and patterning of the developing limb bud. Cell 79,993 -1003.[CrossRef][Medline]
Lewandoski, M., Sun, X. and Martin, G. R. (2000). Fgf8 signalling from the AER is essential for normal limb development. Nat. Genet. 26,460 -463.[CrossRef][Medline]
Lewis, P. M., Dunn, M. P., McMahon, J. A., Logan, M., Martin, J. F., St-Jacques, B. and McMahon, A. P. (2001). Cholesterol modification of sonic hedgehog is required for long-range signaling activity and effective modulation of signaling by Ptc1. Cell 105,599 -612.[CrossRef][Medline]
Loomis, C. A., Harris, E., Michaud, J., Wurst, W., Hanks, M. and Joyner, A. L. (1996). The mouse Engrailed-1 gene and ventral limb patterning. Nature 382,360 -363.[CrossRef][Medline]
Lu, P., Yu, Y., Perdue, Y. and Werb, Z. (2008). The apical ectodermal ridge is a timer for generating distal limb progenitors. Development 135,1395 -1405.[Abstract/Free Full Text]
Mariani, F. V., Ahn, C. P. and Martin, G. R. (2008). Genetic evidence that FGFs have an instructive role in limb proximal-distal patterning. Nature 453,401 -405.[CrossRef][Medline]
Marigo, V., Scott, M. P., Johnson, R. L., Goodrich, L. V. and Tabin, C. J. (1996). Conservation in hedgehog signaling: induction of a chicken patched homolog by Sonic hedgehog in the developing limb. Development 122,1225 -1233.[Abstract]
Martin, G. R. (1998). The roles of FGFs in the early development of vertebrate limbs. Genes Dev. 12,1571 -1586.[Free Full Text]
McLeod, M. J. (1980). Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology 22,299 -301.[CrossRef][Medline]
Michos, O., Panman, L., Vintersten, K., Beier, K., Zeller, R. and Zuniga, A. (2004). Gremlin-mediated BMP antagonism induces the epithelial-mesenchymal feedback signaling controlling metanephric kidney and limb organogenesis. Development 131,3401 -3410.[Abstract/Free Full Text]
Milan, M. and Cohen, S. M. (2000). Temporal regulation of apterous activity during development of the Drosophila wing. Development 127,3069 -3078.[Abstract]
Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B. D., Tarpley, J. E., DeRose, M. and Simonet, W. S. (1998). Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless. Genes Dev. 12,3156 -3161.[Abstract/Free Full Text]
Minowada, G., Jarvis, L. A., Chi, C. L., Neubuser, A., Sun, X., Hacohen, N., Krasnow, M. A. and Martin, G. R. (1999). Vertebrate Sprouty genes are induced by FGF signaling and can cause chondrodysplasia when overexpressed. Development 126,4465 -4475.[Abstract]
Mukhopadhyay, M., Teufel, A., Yamashita, T., Agulnick, A. D., Chen, L., Downs, K. M., Schindler, A., Grinberg, A., Huang, S. P., Dorward, D. et al. (2003). Functional ablation of the mouse Ldb1 gene results in severe patterning defects during gastrulation. Development 130,495 -505.[Abstract/Free Full Text]
Naiche, L. A. and Papaioannou, V. E. (2003). Loss of Tbx4 blocks hindlimb development and affects vascularization and fusion of the allantois. Development 130,2681 -2693.[Abstract/Free Full Text]
Naiche, L. A. and Papaioannou, V. E. (2007). Tbx4 is not required for hindlimb identity or post-bud hindlimb outgrowth. Development 134,93 -103.[Abstract/Free Full Text]
Ng, M., Diaz-Benjumea, F. J., Vincent, J. P., Wu, J. and Cohen, S. M. (1996). Specification of the wing by localized expression of wingless protein. Nature 381,316 -318.[CrossRef][Medline]
Niswander, L., Jeffrey, S., Martin, G. R. and Tickle, C. (1994). A positive feedback loop coordinates growth and patterning in the vertebrate limb. Nature 371,609 -612.[CrossRef][Medline]
Ohuchi, H., Nakagawa, T., Yamamoto, A., Araga, A., Ohata, T., Ishimaru, Y., Yoshioka, H., Kuwana, T., Nohno, T., Yamasaki, M. et al. (1997). The mesenchymal factor, FGF10, initiates and maintains the outgrowth of the chick limb bud through interaction with FGF8, an apical ectodermal factor. Development 124,2235 -2244.[Abstract]
Parr, B. A. and McMahon, A. P. (1995). Dorsalizing signal Wnt-7a required for normal polarity of D-V and A-P axes of mouse limb. Nature 374,350 -353.[CrossRef][Medline]
Perantoni, A. O., Timofeeva, O., Naillat, F., Richman, C., Pajni-Underwood, S., Wilson, C., Vainio, S., Dove, L. F. and Lewandoski, M. (2005). Inactivation of FGF8 in early mesoderm reveals an essential role in kidney development. Development 132,3859 -3871.[Abstract/Free Full Text]
Porter, F. D., Drago, J., Xu, Y., Cheema, S. S., Wassif, C., Huang, S. P., Lee, E., Grinberg, A., Massalas, J. S., Bodine, D. et al. (1997). Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development 124,2935 -2944.[Abstract]
Rallis, C., Bruneau, B. G., Del Buono, J., Seidman, C. E., Seidman, J. G., Nissim, S., Tabin, C. J. and Logan, M. P. (2003). Tbx5 is required for forelimb bud formation and continued outgrowth. Development 130,2741 -2751.[Abstract/Free Full Text]
Reis, T. and Edgar, B. A. (2004). Negative regulation of dE2F1 by cyclin-dependent kinases controls cell cycle timing. Cell 117,253 -264.[CrossRef][Medline]
Rhee, H., Polak, L. and Fuchs, E. (2006). Lhx2 maintains stem cell character in hair follicles. Science 312,1946 -1949.[Abstract/Free Full Text]
Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C. (1993). Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75,1401 -1416.[CrossRef][Medline]
Riddle, R. D., Ensini, M., Nelson, C., Tsuchida, T., Jessell, T. M. and Tabin, C. (1995). Induction of the LIM homeobox gene Lmx1 by WNT7a establishes dorsoventral pattern in the vertebrate limb. Cell 83,631 -640.[CrossRef][Medline]
Rincon-Limas, D. E., Lu, C. H., Canal, I., Calleja, M., Rodriguez-Esteban, C., Izpisua-Belmonte, J. C. and Botas, J. (1999). Conservation of the expression and function of apterous orthologs in Drosophila and mammals. Proc. Natl. Acad. Sci. USA 96,2165 -2170.[Abstract/Free Full Text]
Rodriguez-Esteban, C., Schwabe, J. W., Pena, J. D., Rincon-Limas, D. E., Magallon, J., Botas, J. and Belmonte, J. C. (1998). Lhx2, a vertebrate homologue of apterous, regulates vertebrate limb outgrowth. Development 125,3925 -3934.[Abstract]
Sato, K., Koizumi, Y., Takahashi, M., Kuroiwa, A. and Tamura, K. (2007). Specification of cell fate along the proximal-distal axis in the developing chick limb bud. Development 134,1397 -1406.[Abstract/Free Full Text]
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. et al. (1999). Fgf10 is essential for limb and lung formation. Nat. Genet. 21,138 -141.[CrossRef][Medline]
Sidow, A., Bulotsky, M. S., Kerrebrock, A. W., Bronson, R. T., Daly, M. J., Reeve, M. P., Hawkins, T. L., Birren, B. W., Jaenisch, R. and Lander, E. S.(1997). Serrate2 is disrupted in the mouse limb-development mutant syndactylism. Nature 389,722 -725.[CrossRef][Medline]
Suleiman, H., Heudobler, D., Raschta, A. S., Zhao, Y., Zhao, Q., Hertting, I., Vitzthum, H., Moeller, M. J., Holzman, L. B., Rachel, R. et al. (2007). The podocyte-specific inactivation of Lmx1b, Ldb1 and E2a yields new insight into a transcriptional network in podocytes. Dev. Biol. 304,701 -712.[CrossRef][Medline]
Sun, X., Mariani, F. V. and Martin, G. R. (2002). Functions of FGF signalling from the apical ectodermal ridge in limb development. Nature 418,501 -508.[CrossRef][Medline]
Towers, M., Mahood, R., Yin, Y. and Tickle, C. (2008). Integration of growth and specification in chick wing digit-patterning. Nature 452,882 -886.[CrossRef][Medline]
Valsecchi, C., Ghezzi, C., Ballabio, A. and Rugarli, E. I. (1997). JAGGED2: a putative Notch ligand expressed in the apical ectodermal ridge and in sites of epithelial-mesenchymal interactions. Mech. Dev. 69,203 -207.[CrossRef][Medline]
van Meyel, D. J., Thomas, J. B. and Agulnick, A. D. (2003). Ssdp proteins bind to LIM-interacting co-factors and regulate the activity of LIM-homeodomain protein complexes in vivo. Development 130,1915 -1925.[Abstract/Free Full Text]
Verheyden, J. M. and Sun, X. (2008). An Fgf/Gremlin inhibitory feedback loop triggers termination of limb bud outgrowth. Nature 454,638 -641.[CrossRef][Medline]
Verheyden, J. M., Lewandoski, M., Deng, C., Harfe, B. D. and Sun, X. (2005). Conditional inactivation of Fgfr1 in mouse defines its role in limb bud establishment, outgrowth and digit patterning. Development 132,4235 -4245.[Abstract/Free Full Text]
Vogel, A., Rodriguez, C., Warnken, W. and Izpisua Belmonte, J. C. (1995). Dorsal cell fate specified by chick Lmx1 during vertebrate limb development. Nature 378,716 -720.[CrossRef][Medline]
Vyas, P., McDevitt, M. A., Cantor, A. B., Katz, S. G., Fujiwara, Y. and Orkin, S. H. (1999). Different sequence requirements for expression in erythroid and megakaryocytic cells within a regulatory element upstream of the GATA-1 gene. Development 126,2799 -2811.[Abstract]
Yang, Y. and Niswander, L. (1995). Interaction between the signaling molecules WNT7a and SHH during vertebrate limb development: dorsal signals regulate anteroposterior patterning. Cell 80,939 -947.[CrossRef][Medline]
Yang, Y., Topol, L., Lee, H. and Wu, J. (2003). Wnt5a and Wnt5b exhibit distinct activities in coordinating chondrocyte proliferation and differentiation. Development 130,1003 -1015.[Abstract/Free Full Text]
Yu, K. and Ornitz, D. M. (2008). FGF signaling regulates mesenchymal differentiation and skeletal patterning along the limb bud proximodistal axis. Development 135,483 -491.[Abstract/Free Full Text]
Zhao, Y., Kwan, K. M., Mailloux, C. M., Lee, W. K., Grinberg, A., Wurst, W., Behringer, R. R. and Westphal, H. (2007). LIM-homeodomain proteins Lhx1 and Lhx5, and their cofactor Ldb1, control Purkinje cell differentiation in the developing cerebellum. Proc. Natl. Acad. Sci. USA 104,13182 -13186.[Abstract/Free Full Text]
Zhu, J., Nakamura, E., Nguyen, M. T., Bao, X., Akiyama, H. and Mackem, S. (2008). Uncoupling Sonic hedgehog control of pattern and expansion of the developing limb bud. Dev. Cell 14,624 -632.[CrossRef][Medline]
Zimmer, B. (1989). Peldri II: a quick and easy alternative to critical point drying for scanning electron microscopy. Am. Fern J. 79,146 -150.[CrossRef]
Zuniga, A., Haramis, A. P., McMahon, A. P. and Zeller, R. (1999). Signal relay by BMP antagonism controls the SHH/FGF4 feedback loop in vertebrate limb buds. Nature 401,598 -602.[CrossRef][Medline]
Zuniga, A., Quillet, R., Perrin-Schmitt, F. and Zeller, R. (2002). Mouse Twist is required for fibroblast growth factor-mediated epithelial-mesenchymal signalling and cell survival during limb morphogenesis. Mech. Dev. 114, 51-59.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tzchori, I.
Right arrow Articles by Yang, Y.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Tzchori, I.
Right arrow Articles by Yang, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?