|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 31 March 2009
doi: 10.1242/dev.025999
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



1 Department of Biochemistry, Institute for Stem Cell and Regenerative Medicine,
University of Washington, Seattle, WA 98195, USA.
2 Wadsworth Center, New York State Department of Health, 150 New Scotland
Avenue, Albany, NY 12208, USA.
¶ Author for correspondence (e-mail: hannele{at}u.washington.edu)
Accepted 2 March 2009
| SUMMARY |
|---|
|
|
|---|
Key words: Cell cycle, Dacapo, Stem cells, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
MicroRNAs (miRNAs) are endogenous, short (
21 nucleotide) non-coding
RNAs that regulate gene expression through incomplete sequence complementarity
with miRNA response elements (MREs) in the 3'UTR of target mRNAs. Recent
studies have shown that miRNAs serve important regulatory roles in a variety
of tissues, including stem cells (Ambros,
2004
; Bartel, 2004
;
Carrington and Ambros, 2003
;
Du and Zamore, 2005
;
Stadler and Ruohola-Baker,
2008
; Yi et al.,
2008
). Mutations in, or misexpression of, miRNAs are found in
several human cancers, indicating that miRNAs may also function as oncogenes
or tumor suppressors (Croce and Calin,
2005
; Esquela-Kerscher and
Slack, 2006
).
Analysis of essential miRNA biogenic factors [Dicer, Dgcr8 (Pasha -
FlyBase)] has guided our understanding of the functions of miRNAs in vivo.
Dicer1 knockout mice die as embryos owing to depletion of pluripotent
stem cells (Bernstein et al.,
2003
) and the proliferation of mouse embryonic stem (ES) cells
that are deficient for Dicer1 or Dgcr8 is reduced
(Murchison et al., 2005
;
Wang et al., 2007
). In
Drosophila, disruption of Dcr-1 in germline stem cells
(GSCs) also leads to a significant reduction of cell division and to the
disruption of GSC maintenance (Hatfield et
al., 2005
; Jin and Xie,
2007
; Park et al.,
2007
; Shcherbata et al.,
2007
). Expression of the Drosophila cyclin-dependent
kinase inhibitor (CKI) Dacapo (Dap), a p21/p27 (Cdkn1a/Cdkn1b) homolog, is
increased in Dcr-1 mutant GSCs, suggesting that miRNAs might regulate
the cell cycle of GSCs by repressing Dap
(Hatfield et al., 2005
). Other
components involved in miRNA biogenesis and function, such as
loquacious (loqs) or Argonaute-1 (Ago1),
are also required for GSC maintenance
(Forstemann et al., 2005
;
Park et al., 2007
;
Yang et al., 2007
). These
results suggest that miRNAs play crucial roles in stem cell maintenance and
division. Furthermore, conservation between miRNA function in stem cells is
highlighted by miRNAs regulating p21cip1 in mouse ES cells and Dap
in Drosophila GSCs (Sinkkonen et
al., 2008
; Wang et al.,
2008
; Hatfield et al.,
2005
).
Extrinsic signaling is crucial in regulating stem cells. For example,
neural stem cell maintenance in mammals requires hedgehog signaling
(Ahn and Joyner, 2005
;
Balordi and Fishell, 2007
).
Similarly, the chemokine Cxcl12 (Sdf1) is required to maintain bone marrow
hematopoietic stem cells (Kollet et al.,
2006
; Sacchetti et al.,
2007
; Sugiyama et al.,
2006
). In Drosophila, TGF-β and insulin signaling
regulate cell division of GSCs (Hsu et
al., 2008
; LaFever and
Drummond-Barbosa, 2005
; Xie
and Spradling, 1998
). Activation of the Insulin receptor (InR;
Insulin-like receptor - FlyBase) in GSCs by Drosophila Insulin-like
peptide (Dilp; Ilp1 - FlyBase) is required for the nutrient-dependent
regulation of cell division (LaFever and
Drummond-Barbosa, 2005
). However, the molecular mechanisms
downstream of InR signaling that directly regulate the GSC cell cycle remain
unknown. Evidence from mammalian cells suggests that the CKIs
p21cip1 and p27kip1 might regulate the cell cycle
downstream of the InR signaling cascade through Foxo, a member of the forkhead
transcription family (Medema et al.,
2000
; Nakae et al.,
2003
; Seoane et al.,
2004
; Alvarez et al.,
2001
; Burgering and Kops,
2002
; Kops et al.,
1999
). Since InR signaling also regulates the cell cycle in
Drosophila GSCs and miRNAs affect cell division by negatively
regulating Dap levels in these cells, we explored the possibility that these
pathways might interact to control the GSC cell cycle.
The Drosophila CKI Dap can inhibit the Cyclin E-Cdk2 (Cdc2c)
complex that is required for the G1-S phase transition
(de Nooij et al., 2000
;
Lane et al., 1996
). Previous
studies have shown increased Dap expression in Dcr-1 mutant GSCs.
Furthermore, reduction of dap partially rescues the cell cycle
defects in Dcr-1 mutant GSCs. This suggests that Dap acts downstream
of miRNAs to regulate the cell cycle
(Hatfield et al., 2005
). We
now show that the dap 3'UTR responds to miRNA activities in
GSCs using heterologous reporters (sensors) consisting of a tubulin promoter
driving the green fluorescent protein (GFP) gene fused to the dap
3'UTR. Using luciferase assays, we identified miRNAs that can directly
target the dap 3'UTR, including miR-7, miR-278 and
miR-309. GSCs deficient for miR-278 or miR-7 show
mild division defects or abnormal expression of cell cycle markers,
respectively. It is therefore possible that the control of cell division
through Dap in GSCs requires the simultaneous function of multiple miRNAs. We
further show that GFP-dap 3'UTR sensors respond to InR but not
to TGF-β activity. Consistent with these findings, GSCs deficient for
InR show a Dcr-1-like cell division defect: slow kinetics,
increased frequency of staining for Cyclin E and Dap and decreased frequency
of staining for Cyclin B. The genetic evidence places the miRNAs and Dap
downstream of InR signaling in regulating cell division: cell division of
Dcr-1 or dap mutant GSCs does not respond to nutrition, and
reduction of dap partially rescues the cell cycle defects of
InR mutant GSCs. Thus, our results suggest that InR can regulate the
Drosophila GSC cell cycle through miRNAs and Dap.
| MATERIALS AND METHODS |
|---|
|
|
|---|
dapL forward, GCTCTAGATTCGCTGGCCAACCC and reverse, GCTCTAGAATAGGCTCTGCCTATGT;
dapS forward, GCTCTAGACTCGTAACCAGTAATTAG and reverse, GCTCTAGAGCCCAGAGATCATAGCAA;
dapF forward, GCCTCTAGAACAACTAATGCTCCAGA and reverse, GCGACTAGTATTTATGTACTACCAAC.
Fragments of dap 3'UTR were amplified by PCR from
Drosophila genomic DNA. Fragments of dapF (1185 bp),
dapL (866 bp) and dapS (630 bp) were ligated into the
tub-GFP plasmid. tub-firefly-luciferase (tub-fLuc)
and tub-renilla-luciferase (tub-rLuc) plasmids were provided
by the Cohen laboratory (Stark et al.,
2003
). dapF was ligated into the tub-fLuc
(tub-fLuc-dapF) vector.
tub-miR-1, tub-miR-7 and tub-miR-309 cluster expression
vectors were obtained from the Cohen laboratory
(Stark et al., 2003
); all
other miRNA expression vectors were constructed from amplicons of 400-1000 bp
containing pre-miRNA sequence and inserted into a tubulin-driven expression
vector. The primers for primary miRNAs were:
miR-289 forward, CACGAAGGATCCAGTCCTGTGCCAG and reverse, CAGCAATCTAGAACCACTTCCAGCAC;
bantam forward, ATAGCGGCCGCGTTAACTGGCAGCATATAATTTC and reverse, ATTCTAGATTATAGGCAGATTTAACATGTGG;
miR-8 forward, ATAGCGGCCGCCGCGGTCACACG CACATTTCAATA and reverse, ATTCTAGAAATGGGAATTGGGAACGATCTCGC;
miR-303 forward, ATAGCGGCCGCTGCATTCGAAAGG CCAGGTGAA and reverse, ATTCTAGATTGTCCAGGATCTAACATGATTTCGT; let-7 (including pre-miR-125) forward, ATAGCGGCCGCGAAGATCAACAGCGATCCATTAAACA and reverse, ATTCTAGATTGCCGATACTTGTGCCTTGA;
miR-34 forward, ATAGCGGCCGCATTTGGCTTGCGCACACACT and reverse, ATTCTAGATTCGTTGTTCAGGCGTCTGGTT;
miR-278 forward, ATAGCGGCCGCTTGGCGCATTAACCGACGCTTT and reverse, ATTCTAGATCCTTGTGCACTCCCAGAAA.
Mutagenesis of the miRNA MREs
dapF was cut from tub-fLuc-dapF and inserted into the
CS2p plasmid (Turner and Weintraub,
1994
). Mutagenesis was by PCR using the following primers
(introduced restriction sites in parentheses; mutated sequences
underlined):
miR-7 mutation (NcoI) forward, GAATATTAATCGTTCCATGGCAACTACTCGTAACCAGTA and reverse, TTACGAGTAGTTGCCATGGAACGATTAATATTCGCAACT;
miR-8 mutation (NcoI) forward, CTGCGATTGTGTCCATGGTCCTAATTTTTTATTACGAACC and reverse, GTAATAAAAAATTAG GACCATGGACACAATCGCAGTGGCTT;
miR-309 mutation (BglII) forward, CTCATTTCTTAAAGATCTCTAAA AATGTCTTTTATGATTTG and reverse, CATAAAAGACATTTTTAGAGATCTTTAAGAAATGAGAGCG;
miR-278 mutation (BglII) forward, CGCTGGCCAAAGATCTGAATTGCAATTTGTAATTTTATTTTTTAC and reverse, TACAAATTGCAATTCAGATCTTTGGCCAGCGAATCTGGAGC.
Mutated dapF fragments were then cut from the CS2p plasmids and inserted into the tub-fLuc plasmid.
The bantam mutation was introduced by PCR using 5'-TAAAGATCTCTAAAAATGTCTTTTATGATTTGCTATCCATGGTGGGCAAATTATGAAAAC-3' (with NcoI) and a T7 primer with the CS2p-dapF-miR-309 mutant as the template.
For UASp-miR-7, 432 nt containing the miR-7 precursor was amplified from pUAST-miR-7 with the following primers and ligated into pUASP: forward, CACGAAGGATCCGTCTAACCACCCATCCCCACAA and reverse, CAGCAATCTAGAATGGGAGGGTACTGGGGAGTTC.
S2 cell culture, transfection and luciferase assay
S2 cells were cultured in Schneider's Drosophila Medium (Gibco)
with 10% heat-inactivated FBS and penicillin/streptomycin at room temperature
(20°C). Transfection used Cellfectin (Invitrogen) according to the
manufacturer's instruction. For the luciferase assays in
Fig. 2, 1 µg of each miRNA
expression plasmid, 100 ng of firefly luciferase reporter plasmid with or
without dap 3'UTR, and 100 ng of renilla luciferase reporter
plasmid were transfected into cells in a well of a 12-well plate. For the
luciferase assays in Fig. S5 in the supplementary material, the amount of
miRNA expression vector added in each group was: 0.6 µg miR-1; 0.2
µg miR-278 and 0.4 µg miR-1; 0.2 µg
miR-278, 0.2 µg miR-309 and 0.2 µg miR-1; 0.2
µg miR-278, 0.2 µg miR-309 and 0.2 µg
miR-7. Combined miRNA expression vectors and 50 ng of firefly
luciferase reporter plasmid with or without dap 3'UTR, and 50
ng of renilla luciferase reporter plasmid were transfected into cells in a
well of a 24-well plate. Luciferase assays (Dual Luciferase System, Promega)
were performed 2 days after transfection. Renilla luciferase activity provided
normalization for firefly luciferase activity. The relative luciferase
activities of the cells transfected with tub-fLuc-dapF and the
different tub-fLuc-mutant-dapF constructs were further
normalized to the relative luciferase activities of tub-fLuc for each
miRNA.
Generation of GFP-dap 3'UTR sensors and UASp-miR-7 transgenic lines
Transgenic flies were generated by injection of purified plasmid DNA into
w1118 Drosophila embryos (Rainbow Transgenic Flies,
Newbury Park, CA, USA). These flies were crossed with
w1118 and transformants were selected based on eye color.
Twelve, nine, one and nine lines were generated for tub-GFP:dapF,
tub-GFP:dapL, tub-EGFP:dapS and UASp-miR-7, respectively.
Recombination for FRT42DmiR-278KO, FRT42DmiR-278Gal4KI and FRT42DmiR-278Gal4KI,miR-7
1/CyO
Two miR-278 mutations were recombined into the FRT42D
chromosome using standard meiotic recombination protocols
(Xu and Rubin, 1993
).
FRT42DmiR-278Gal4KI was further recombined into the
FRT42DmiR-7
1 chromosome.
Fly stocks
We used Drosophila stocks carrying the tub-GFP:2x(miR-7)
reporter, control tub-GFP reporter
(Stark et al., 2003
),
tub-GFP:dapL reporter, tub-GFP:dapF reporter,
tub-GFP:dapS reporter, hsFLP;;UAST-GFPact>CD2> Gal4/TM3Sb,
eyFlp;;FRT82BDcr-1Q1147X/TM3, FRT82BInRex52.1/TM6B,
FRT82BInRex15/TM3, eyFlp;FRT82B, hsFlp;;FRT82BarmlacZ/TM3,
hsFlp;;FRT82BUbi-GFP/TM3, FRT42Bdap4/CyO, FRT42B, eyFlp; FRT42D,
hsFlp;FRT42BUbi-GFP/CyO, hsFlp;FRT42DUbi-GFP/CyO,
FRT42DmiR-278KO/CyO, FRT42DmiR-278KI-gal4/CyO,
FRT42DmiR-7
1/CyO, P{EP}blEP954,
w-;FRT82Bput135/TM3, yw;Mad12FRT40A/CyO,
dap[2x10]/Cyo, dap[g36]/Cyo, ftz-lacZ +;dap5gm.T:Hsap\MYC;+,
w-;Sp/CyO; FRT82BInREX52.1/TM6B, yw
hsFLP;Sp/CyO;FRT82BUbi-GFP/TM6B.
Generation of clones
Clones of GSCs were induced using the heat shock FLP-FRT system
(Dang and Perrimon, 1992
;
Xu and Rubin, 1993
). To
generate GSCs clones during third instar larval or pupal stages, flies were
heat shocked for 1 hour at 37°C for 2 consecutive days. To generate GSCs
clones at the adult stage, newly eclosed flies (1-2 days) were collected and
heat shocked twice per day for 30 minutes at 37°C for 2 consecutive
days.
Antibodies
The following were used: mouse anti-Adducin [clone 1B1, Developmental
Studies Hybridoma Bank (DSHB)]; mouse anti-Cyclin B (DSHB); guinea pig
anti-Cyclin E (T. Orr-Weaver, Whitehead Institute); mouse anti-Dap (I.
Hariharan, University of California, Berkeley); Alexa 488-conjugated rabbit
anti-GFP (Molecular Probes); Alexa 488, 555, 568 or 633-conjugated goat
anti-mouse, anti-rabbit and anti-guinea pig antibodies (Molecular Probes).
Immunostaining and fluorescence microscopy
Ovaries were fixed as described previously: ovaries were dissected in PBS
and fixed in 5% paraformaldehyde in PBS, then sequentially incubated in
primary and secondary antibodies overnight at 4°C, followed by DAPI (1
µg/ml) for 15 minutes. Confocal microscopy and two-photon laser-scanning
imaging were performed with a Leica TCS SP/MP or Leica SPE microscope.
Starvation procedure
The starvation condition was adapted from previous reports
(Drummond-Barbosa and Spradling,
2001
). For poor food conditions, adult flies were collected into
plastic bottles containing molasses plates providing moisture and sugar,
whereas for rich food conditions this was supplemented with wet yeast. Ovaries
were dissected 10 or 14 days later.
Division frequency analysis
Only germaria containing both GFP (or β-gal)-positive and GFP (or
β-gal)-negative GSCs were analyzed for cell division. The average sum of
cystoblasts and cysts generated by individual GFP (or β-gal)-negative
GSCs in region 1-2A of a germarium was normalized to that of individual GFP
(or β-gal)-positive control heterozygous GSCs to obtain the division
index.
Quantitation of GFP in GSCs
MetaMorph (Molecular Devices) software was used to quantify GFP
fluorescence intensity in GSCs imaged on a Leica SP1 confocal microscope.
Images of the brightest GFP optical slice were quantified by drawing an
elliptical field of identical dimensions for each cell and reading the average
intensity in the field.
Quantification of cell cycle markers in GSCs
Quantification of cell cycle marker levels in GSCs was determined with the
histogram function in Adobe Photoshop. For a given GSC, intensity was
determined by averaging intensities from three different regions within the
cell. A background germline intensity value was determined by averaging
intensities obtained from three different regions within region 1 of the
germarium having low-level staining or background staining. For each antibody,
the intensity fold above background was determined as the average GSC
intensity divided by the average background intensity.
miRNA quantitative RT-PCR (qPCR)
RNA was isolated from 10-20 ovaries using Trizol (Invitrogen) and treated
with RNase-free DNaseI (Fermentas). The extracted RNA (0.5 µg) was reversed
transcribed with Omniscript reverse transcriptase (Qiagen). miRNA levels
(dme-miR-8 and dme-miR-278) were quantified using TaqMan
MicroRNA Assays (Applied Biosystems) as per manufacturer's instruction, using
10 ng of total RNA on an ABI 7300 real-time PCR system.
| RESULTS |
|---|
|
|
|---|
miR-7, miR-278 and miR-309 can target the dap 3'UTR directly
To identify which miRNAs repress Dap directly through the dap
3'UTR, we used luciferase assays in S2 cells. Computational algorithms
based on sequence complementarity, homology across species and RNA secondary
structure predict that many miRNAs target the dap 3'UTR,
including miR-7, -8, -34, -278, -289, -303, -309, let-7 and
bantam (Fig. 2A,B)
(Enright et al., 2003
;
Griffiths-Jones et al., 2006
;
Griffiths-Jones et al., 2008
;
Grun et al., 2005
;
Long et al., 2007
;
Ruby et al., 2007
). To test
whether these predicted miRNAs are sufficient to regulate Dap, the full-length
3'UTR of dap, dapF, was fused downstream of a firefly
luciferase gene. Partial precursor sequences of these miRNAs were cloned into
an expression vector driven by a tubulin promoter. miR-1 was used as
a control as there is no predicted miR-1 MRE in the dap
3'UTR. Whereas expression of miR-7, miR-8, miR-278, miR-309 and
bantam inhibited luciferase activity significantly, miR-34,
miR-289, miR-303 and let-7 did not repress the activity
(Fig. 2C). It is notable that
let-7 and miR-289 increased luciferase activity. One
possible explanation for this result is that the negative control miRNA,
miR-1, might still mildly repress the dap 3'UTR even
though there is no predicted MRE for miR-1 and, therefore,
let-7 and miR-289 increased luciferase activities after
normalization to miR-1. It is also possible that let-7 and
miR-289 increased the expression of luciferase through the
dap 3'UTR (Vasudevan et
al., 2007
). Further experiments are required to test this
hypothesis.
|
|
miR-278 and miR-7 affect the cell cycle of GSCs
We further examined whether miR-278 and miR-7 might
regulate GSC division. Two miR-278 null lines,
miR-278KO and miR-278Gal4KI, were
examined (Teleman et al.,
2006
). Quantitative RT-PCR (qPCR) was used to detect mature miRNAs
in FRT42D control or FRT42DmiR-278KO mutant
ovaries. miR-8 was used as a control miRNA as it is expressed in the
GSCs (Shcherbata et al.,
2007
). miR-278 expression was more than 300-fold higher
in FRT42D control ovaries than in miR-278KO
ovaries. By contrast, the control miRNA miR-8 was expressed at
similar levels in the ovaries in both animals
(Fig. 3A; see Table S1 in the
supplementary material). These results show that miR-278 is expressed
in the ovary.
We generated GSC clones deficient for miR-278 using the heat shock FLP-FRT system (Fig. 3B). GSCs can be identified by their position adjacent to the cap cells, and by the shape and position of the fusome stained by anti-Adducin (Add; Hu li tai shao - FlyBase) antibody (Fig. 3B). After generation of clones, the sum of cystoblasts and cysts generated by each mutant GSC in regions 1-2A of the germarium was counted and compared with that generated by the neighboring control GSCs (see Materials and methods). The miR-278 mutant GSCs showed a 21-25% reduction in division index, whereas the FRT42D control clones divided normally (Fig. 3C; see Table S2 in the supplementary material). Similarly, GSCs in transheterozygous (miR-278KO/miR-278Gal4KI) flies showed a 28% reduction in the number of cystoblasts and cysts at region 1-2A in germaria as compared with GSCs in heterozygous (miR-278KO/+) animals 13-14 days after eclosion. These results suggest that miR-278 plays a role in regulating the cell division of GSCs.
|
To characterize the effect of miR-7 on the GSC cell cycle, we
examined the expression of the cell cycle marker Cyclin E (CycE) in
miR-7 mutant (FRT42DmiR-7
1) GSCs
(Li and Carthew, 2005
). It has
been shown that Dap can trap the CycE-Cdk2 complex in a stable but inactive
form (de Nooij et al., 1996
).
Increased levels of Dap result in cell cycle arrest at the G1-S transition and
prolonged expression of CycE protein
(Shcherbata et al., 2004
). We
detected an increase in the frequency of CycE staining in
miR-7
1 GSCs relative to the heterozygous
neighboring control GSCs (Fig.
4C). However, the defects observed in the miR-7 mutant
GSCs were insufficient to cause an obvious reduction in division index
(Fig. 3C; see Fig. S1 and Table
S2 in the supplementary material). Since miR-7 resides in an intron
of a host gene, bancal (Charroux
et al., 1999
), we asked whether the elevated frequency of GSCs
positive for CycE was due to the loss of bancal or miR-7.
Expressing miR-7 with UASp-miR-7 driven by a
germline-specific nanos-Gal4 driver returned the frequency
of GSCs that stained positive for CycE to wild-type levels, thereby showing
that it is the loss of miR-7 and not bancal that is
responsible for the increased frequency of CycE staining
(Fig. 4C). We found further
evidence that miR-7 is sufficient to regulate Dap expression:
follicle cell clones in stage 2-4 egg chambers overexpressing miR-7
with an enhancer trap driver, P{EP}blEP954
(Li and Carthew, 2005
),
exhibited a decreased frequency of Dap staining compared with wild-type
control cells (Fig. 4D,E).
Although disruption of miR-278 or miR-7 showed mild cell division defects or abnormal cell cycle marker expression, respectively, neither alone nor in combination displayed as dramatic a perturbation of the cell cycle as Dcr-1-deficient GSCs (Fig. 3C). These results suggest that regulation of the GSC cell cycle might require miRNAs in addition to miR-7 and miR-278, and possibly a combination of multiple miRNAs.
The dap 3'UTR is regulated by InR but not TGF-β signaling
GSCs, like many other stem cells, change their division rate in response to
extrinsic factors such as nutrition-dependent InR and TGF-β signaling
from the niche cells (LaFever and
Drummond-Barbosa, 2005
; Xie
and Spradling, 1998
). To analyze whether these signaling pathways
affect cell division through miRNA-based Dap regulation, we tested the
responsiveness of the GFP-dap 3'UTR sensor lines to both
TGF-β and InR activity. Interestingly, the GFP intensity of the
dap 3'UTR sensors dapL and dapF was
upregulated in InR mutant GSCs
(Fig. 5A). By contrast, the GFP
intensity in GSCs deficient for Mad or punt, two key
components in the TGF-β pathway, was not affected in the GFP-dap
3'UTR sensor dapL (Fig.
5A,B). This result demonstrates that InR signaling, but not
TGF-β signaling, regulates the dap 3'UTR, suggesting that
InR signaling might affect Dap expression in GSCs through miRNAs. Quantitation
showed that the GFP intensity of the dapL and dapF sensor in
InR mutant GSCs increased 1.39-fold and 1.23-fold, respectively, in
comparison with the neighboring control heterozygous GSCs
(Fig. 5B). Interestingly, the
GFP intensity of the dapS sensor was not significantly affected in
InR mutant GSCs (Fig.
5A,B), suggesting that the InR-responsive dap 3'UTR
region is absent from the dapS construct.
|
The dap-5gm construct does not respond to InR activity
As shown above, Dap expression, and specifically the dap
3'UTR, are responsive to InR activity in GSCs. To test whether other
regions of the dap gene show responsiveness, we used
dap-5gm, a genomic construct that contains the dap promoter
region responsible for GSC expression followed by the dap coding
sequence fused to six Myc-tag coding sequences and lacking most of the
dap 3'UTR (Meyer et al.,
2002
; Hatfield et al.,
2005
). Expression of dap-5gm can be determined with an
antibody against Myc. Expression of the Myc tag was the same in
InR-deficient and neighboring control heterozygous GSCs
(Fig. 6A; see Fig. S4 in the
supplementary material). These data suggest that the regions of the
dap gene contained in dap-5gm, including the GSC-specific
promoter region, are not responsive to InR signaling, supporting our notion
that InR regulation of Dap in GSCs occurs through the dap
3'UTR. Furthermore, in accordance with the dap 3'UTR
sensor data (Fig. 6), the
full-length dap 3'UTR is responsive to InR activity, whereas
the dap 3'UTR region remaining in dap-5gm is not.
miRNAs and dap act downstream of InR in regulating cell division
To determine whether miRNAs are required for InR-dependent regulation of
cell division, we used a protein-restricted diet to reduce InR signaling
(Drummond-Barbosa and Spradling,
2001
) and tested whether Dcr-1 affected the phenotype. We
generated GSC clones homozygous for the Dcr-1 null allele
(Dcr-1Q1147X), as well as parental control
FRT82B, during larval/pupal stages. Two days after eclosion, the
adult flies were kept under two different diet conditions: rich food with wet
yeast and poor food (starvation) without wet yeast. Whereas starvation reduced
cell division of the control GSCs 1.7-fold, the low cell division index of the
Dcr-1-deficient GSCs observed under rich food conditions did not
change under poor food conditions (Fig.
7A). This result is consistent with our hypothesis that miRNAs act
downstream of InR signaling in regulating cell division.
|
|
To further examine the interaction between dap and InR signaling,
we generated GSC clones deficient for InR in a
dap4 or dap2x10 heterozygous
background. InR mutant GSCs show a strong cell division defect
(Fig. 7C)
(LaFever and Drummond-Barbosa,
2005
). This defect can be partially rescued by reducing
dap: the cell division index of InR-deficient GSCs increased
from 40 to 60% when dap was reduced (dap4; a
1.5-fold increase) (Fig. 7C).
Other strong dap mutant alleles provided similar results
(dap2x10; a 1.4-fold increase)
(Fig. 7C, legend). These
results suggest that dap acts downstream of InR in
regulating the cell cycle. Together, these data support our hypothesis that
the InR pathway regulates the GSC cell cycle by reducing the levels of Dap
(Fig. 8).
| DISCUSSION |
|---|
|
|
|---|
|
|
miR-7 and miR-278
Our study reveals novel regulatory roles for miR-7 and
miR-278 in the GSC cell cycle. We have shown by luciferase assays
that miR-7 and miR-278 can directly target Dap. GSCs
deficient for miR-278 show a mild but significant reduction in cell
proliferation. Ectopic expression of miR-7 in follicle cells reduces
the proportion of cells that stain positive for Dap. Furthermore, ablation of
miR-7 in GSCs results in a perturbation of the frequency of
CycE-positive GSCs. However, the cell division kinetics of miR-7
mutant GSCs is not reduced, by contrast with the dramatic reduction of cell
division in Dcr-1-deficient GSCs. It is plausible that miR-7
and miR-278 act in concert with other miRNAs to regulate the level of
Dap in GSCs and thereby contribute to cell cycle control in GSCs. Recently,
the 3'UTR of nerfin-1, a Drosophila zinc-finger
transcription factor gene required for axon pathfinding, has been shown to be
regulated by multiple miRNAs in the developing nervous system
(Kuzin et al., 2007
). Although
we have shown that the dap 3'UTR lies downstream of the miRNA
pathway, it is still possible that some miRNAs control Dap expression
indirectly.
The interaction of multiple miRNAs with the dap 3'UTR might
integrate information from multiple pathways. Further studies will reveal what
regulates miR-7 and miR-278 expression in GSCs and which
other miRNAs might act together in Dap regulation. It is known that
miR-7 and the transcriptional repressor Yan (Anterior open - FlyBase)
mutually repress one another in the eye imaginal disk
(Li and Carthew, 2005
). In
this model, Yan prevents transcription of miR-7 until Erk in the Egfr
pathway downregulates Yan activity by phosphorylation, thereby permitting
expression of miR-7. Conversely, miR-7 can repress the
translation of Yan. Thus, a single pulse of Egfr signaling results in stable
expression of miR-7 and repression of Yan. Whether similar regulation
will be observed between miR-7 and the signaling pathways that
regulate GSC division remains to be seen. It has been suggested that
miR-7 might regulate downstream targets of Notch, such as
Enhancer of split and Bearded
(Stark et al., 2003
). Thus,
miR-7 may have a mild repressive effect on multiple targets in GSCs.
Further experiments might illuminate this possibility.
miR-278, on the other hand, has been implicated in tissue growth
and InR signaling (Teleman et al.,
2006
). Overexpression of miR-278 promotes tissue growth
in eye and wing imaginal discs. Deficiency of miR-278 leads to a
reduced fat body, which is similar to the effect of impaired InR signaling in
adipose tissue. Interestingly, miR-278 mutants have elevated
insulin/Dilp production and a reduction of insulin sensitivity. Furthermore,
miR-278 regulates expanded, which may modulate growth factor
signaling including InR. Since InR signaling plays important roles in tissue
growth and cell cycle control (Edgar,
2006
; Taguchi and White,
2008
; Wu and Brown,
2006
), it will be interesting to further test how miR-278
may regulate InR signaling, and whether InR signaling might regulate
miR-278 in a feedback loop in GSCs.
Other miRNAs or miRNA-dependent mechanisms might also play roles in
Drosophila GSCs. For example, the miRNA bantam is required
for GSC maintenance (Shcherbata et al.,
2007
). A recent study has shown that the Trim-NHL-containing
protein Mei-P26, which belongs to the same family as Brain tumor (Brat),
affects bantam levels and restricts cell growth and proliferation in
the GSC lineage (Neumuller et al.,
2008
). Interestingly, most miRNAs are upregulated in
mei-P26 mutant flies. By contrast, overexpression mei-P26 in
bag of marbles (bam) mutants broadly reduces miRNA levels.
This suggests that Mei-P26 regulates proliferation and maintenance of GSC
lineages via miRNA levels. Since InR signaling cell-autonomously regulates GSC
division but not maintenance, the possible interaction between Mei-P26 and InR
signaling might be complex.
InR signaling regulates Dap and the cell cycle cell-autonomously
The systemic compensatory effect of insulin secretion in mammals with
defective InR signaling is well documented. Insulin levels in mice with
liver-specific InR (Insr - Mouse Genome Informatics)
knockout are
20-fold higher than those of control animals owing to the
compensatory response of the pancreatic β-cells and impairment of insulin
clearance by the liver (Michael et al.,
2000
). Knockout of the neuronal InR also leads to a mild
hyperinsulinemia, indicating whole-body insulin resistance
(Bruning et al., 2000
).
Furthermore, the knockout of components in the InR signaling pathway, such as
Akt2 and the regulatory and catalytic subunits of PI3 kinase, also leads to
hyperinsulinemia and glucose intolerance
(Brachmann et al., 2005
;
Cho et al., 2001
;
MacDonald et al., 2004
;
Ueki et al., 2002
). Therefore,
a systemic decrease in InR signaling may lead to compensatory responses.
To understand the roles of InR signaling in the GSCs while avoiding any systemic compensatory effect we analyzed the phenotypes of GSC clones. Using a panel of cell cycle markers, we find that InR mutant GSCs show cell cycle defects similar to those of Dcr-1 mutant GSCs: a reduction of cell division rate, an increased frequency of cells staining positive for Dap and CycE, and a decreased frequency of cells staining positive for CycB. Using GFP-dap 3'UTR sensors, we show that the dap 3'UTR responds to InR signaling in GSCs, suggesting that InR signaling can regulate Dap expression through the dap 3'UTR. This, together with our genetic data indicating that InR/starvation-dependent cell cycle regulation requires Dcr-1 and dap, led us to propose the hypothesis that InR signaling regulates the cell cycle through miRNAs that further regulate Dap levels (Fig. 8). Since a reduction in dap only partially rescues the cell cycle defects of InR mutant GSCs, it is possible that InR signaling might also regulate GSC division by additional mechanisms (Fig. 8, dashed arrow).
Starvation, InR signaling and cell cycle control
InR signaling regulates the cell cycle through multiple mechanisms, mainly
through the G1-S, but also partly through the G2-M, transition. Recent work
has shown a delay in the G2-M transition in GSCs during C. elegans
dauer formation (Narbonne and Roy,
2006
). Starvation and InR deficiency may also affect the
G2-M checkpoint in Drosophila GSCs
(Hsu et al., 2008
). Here we
dissect one possible molecular pathway that InR signaling utilizes to regulate
the Drosophila GSC G1-S transition and show that InR signaling can
control the cell cycle through miRNA-based regulation of Dap.
Many studies have connected InR and CKIs to Tor (Target of rapamycin) or
Foxo pathways downstream of InR signaling. In S. cerevisiae, the
yeast homolog of p21/p27 is upregulated when Tor signaling is inhibited
(Zinzalla et al., 2007
). Foxo,
a transcription factor that can be repressed by InR signaling, is known to
play important roles in nutrition-dependent cell cycle regulation by
upregulating p21 and p27 (Medema et al.,
2000
; Nakae et al.,
2003
; Seoane et al.,
2004
) and by repressing cyclin D1/D2
(Park et al., 2005
;
Schmidt et al., 2002
). In
C. elegans, starvation causes L1 cell cycle arrest mediated by InR
(daf-2) and Foxo (daf-16): InR represses the function of
Foxo, thereby downregulating the CKI (cki-1) and upregulating the
miRNA lin-4 (Baugh and Sternberg,
2006
). We have now shown that a miRNA-based regulation of Dap can
be coordinated by InR in Drosophila GSCs.
Insulin and insulin-like growth factors (Igf1 and Igf2) are known to play
important roles in regulating metabolic and developmental processes in many
stem cells (Mourkioti and Rosenthal,
2005
; Saltiel and Kahn,
2001
; Ye and D'Ercole,
2006
). In mammals, Igf signaling is required by different stem
cell types, including human and mouse ES cells for survival and self-renewal
(Bendall et al., 2007
;
Hallmann et al., 2003
;
Rubin et al., 2007
;
Wang et al., 2007
), neural
stem cells for expediting the G1-S transition and cell cycle re-entry
(Hodge et al., 2004
), and
skeletal muscle satellite cells for promoting the G1-S transition via
p27kip1 downregulation
(Chakravarthy et al., 2000
).
Here we have dissected the molecular mechanism of the InR pathway in another
adult stem cell type, Drosophila GSCs, showing that InR signaling can
regulate stem cell division through miRNA-based downregulation of the G1-S
inhibitor Dap. Further studies will reveal whether miRNAs also mediate InR
signaling in other stem cell types.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/9/1497/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* These authors contributed equally to this work ![]()
Present address: Department of Life Sciences and Institute of Genome
Sciences, National Yang-Ming University, Taipei 112, Taiwan ![]()
Present address: F. M. Kirby Center for Molecular Ophthalmology, University
of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA ![]()
Present address: Research Group Gene Expression and Signaling, Max Planck
Institute for Biophysical Chemistry, Am Faβberg 11, Goettingen 37077,
Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Ahn, S. and Joyner, A. L. (2005). In
vivo analysis of quiescent adult neural stem cells responding to Sonic
hedgehog. Nature 437,894
-897.[CrossRef][Medline]
Alvarez, B., Martinez, A. C., Burgering, B. M. and Carrera, A.
C. (2001). Forkhead transcription factors contribute to
execution of the mitotic programme in mammals. Nature
413,744
-747.[CrossRef][Medline]
Ambros, V. (2004). The functions of animal
microRNAs. Nature 431,350
-355.[CrossRef][Medline]
Balordi, F. and Fishell, G. (2007). Hedgehog
signaling in the subventricular zone is required for both the maintenance of
stem cells and the migration of newborn neurons. J.
Neurosci. 27,5936
-5947.
Bartel, D. P. (2004). MicroRNAs: genomics,
biogenesis, mechanism, and function. Cell
116,281
-297.[CrossRef][Medline]
Baugh, L. R. and Sternberg, P. W. (2006).
DAF-16/FOXO regulates transcription of cki-1/Cip/Kip and repression of lin-4
during C. elegans L1 arrest. Curr. Biol.
16,780
-785.[CrossRef][Medline]
Bendall, S. C., Stewart, M. H., Menendez, P., George, D.,
Vijayaragavan, K., Werbowetski-Ogilvie, T., Ramos-Mejia, V., Rouleau, A.,
Yang, J., Bosse, M. et al. (2007). IGF and FGF cooperatively
establish the regulatory stem cell niche of pluripotent human cells in vitro.
Nature 448,1015
-1021.[CrossRef][Medline]
Bernstein, E., Kim, S. Y., Carmell, M. A., Murchison, E. P.,
Alcorn, H., Li, M. Z., Mills, A. A., Elledge, S. J., Anderson, K. V. and
Hannon, G. J. (2003). Dicer is essential for mouse
development. Nat. Genet.
35,215
-217.[CrossRef][Medline]
Brachmann, S. M., Ueki, K., Engelman, J. A., Kahn, R. C. and
Cantley, L. C. (2005). Phosphoinositide 3-kinase catalytic
subunit deletion and regulatory subunit deletion have opposite effects on
insulin sensitivity in mice. Mol. Cell. Biol.
25,1596
-1607.
Bruning, J. C., Gautam, D., Burks, D. J., Gillette, J.,
Schubert, M., Orban, P. C., Klein, R., Krone, W., Muller-Wieland, D. and Kahn,
C. R. (2000). Role of brain insulin receptor in control of
body weight and reproduction. Science
289,2122
-2125.
Burgering, B. M. and Kops, G. J. (2002). Cell
cycle and death control: long live Forkheads. Trends Biochem.
Sci. 27,352
-360.[CrossRef][Medline]
Carrington, J. C. and Ambros, V. (2003). Role
of microRNAs in plant and animal development. Science
301,336
-338.
Chakravarthy, M. V., Abraha, T. W., Schwartz, R. J., Fiorotto,
M. L. and Booth, F. W. (2000). Insulin-like growth factor-I
extends in vitro replicative life span of skeletal muscle satellite cells by
enhancing G1/S cell cycle progression via the activation of
phosphatidylinositol 3'-kinase/Akt signaling pathway. J.
Biol. Chem. 275,35942
-35952.
Charroux, B., Angelats, C., Fasano, L., Kerridge, S. and Vola,
C. (1999). The levels of the bancal product, a Drosophila
homologue of vertebrate hnRNP K protein, affect cell proliferation and
apoptosis in imaginal disc cells. Mol. Cell. Biol.
19,7846
-7856.
Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q.,
Crenshaw, E. B., 3rd, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I. and
Birnbaum, M. J. (2001). Insulin resistance and a diabetes
mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta).
Science 292,1728
-1731.
Croce, C. M. and Calin, G. A. (2005). miRNAs,
cancer, and stem cell division. Cell
122, 6-7.[CrossRef][Medline]
Dang, D. T. and Perrimon, N. (1992). Use of a
yeast site-specific recombinase to generate embryonic mosaics in Drosophila.
Dev. Genet. 13,367
-375.[CrossRef][Medline]
de Nooij, J. C., Letendre, M. A. and Hariharan, I. K.
(1996). A cyclin-dependent kinase inhibitor, Dacapo, is necessary
for timely exit from the cell cycle during Drosophila embryogenesis.
Cell 87,1237
-1247.[CrossRef][Medline]
de Nooij, J. C., Graber, K. H. and Hariharan, I. K.
(2000). Expression of the cyclin-dependent kinase inhibitor
Dacapo is regulated by cyclin E. Mech. Dev.
97, 73-83.[CrossRef][Medline]
Drummond-Barbosa, D. and Spradling, A. C.
(2001). Stem cells and their progeny respond to nutritional
changes during Drosophila oogenesis. Dev. Biol.
231,265
-278.[CrossRef][Medline]
Du, T. and Zamore, P. D. (2005). microPrimer:
the biogenesis and function of microRNA. Development
132,4645
-4652.
Edgar, B. A. (2006). How flies get their size:
genetics meets physiology. Nat. Rev. Genet.
7, 907-916.[CrossRef][Medline]
Enright, A. J., John, B., Gaul, U., Tuschl, T., Sander, C. and
Marks, D. S. (2003). MicroRNA targets in Drosophila.
Genome Biol. 5,R1
.[CrossRef][Medline]
Esquela-Kerscher, A. and Slack, F. J. (2006).
Oncomirs-microRNAs with a role in cancer. Nat. Rev.
Cancer 6,259
-269.[CrossRef][Medline]
Forstemann, K., Tomari, Y., Du, T., Vagin, V. V., Denli, A. M.,
Bratu, D. P., Klattenhoff, C., Theurkauf, W. E. and Zamore, P. D.
(2005). Normal microRNA maturation and germ-line stem cell
maintenance requires Loquacious, a double-stranded RNA-binding domain protein.
PLoS Biol. 3,e236
.[CrossRef][Medline]
Fuller, M. T. and Spradling, A. C. (2007). Male
and female Drosophila germline stem cells: two versions of immortality.
Science 316,402
-404.
Galardi, S., Mercatelli, N., Giorda, E., Massalini, S., Frajese,
G. V., Ciafre, S. A. and Farace, M. G. (2007). miR-221 and
miR-222 expression affects the proliferation potential of human prostate
carcinoma cell lines by targeting p27Kip1. J. Biol.
Chem. 282,23716
-23724.
Griffiths-Jones, S., Grocock, R. J., van Dongen, S., Bateman, A.
and Enright, A. J. (2006). miRBase: microRNA sequences,
targets and gene nomenclature. Nucleic Acids Res.
34,D140
-D144.
Griffiths-Jones, S., Saini, H. K., van Dongen, S. and Enright,
A. J. (2008). miRBase: tools for microRNA genomics.
Nucleic Acids Res. 36,D154
-D158.
Grun, D., Wang, Y. L., Langenberger, D., Gunsalus, K. C. and
Rajewsky, N. (2005). microRNA target predictions across seven
Drosophila species and comparison to mammalian targets. PLoS
Comput. Biol. 1,e13
.[CrossRef][Medline]
Hallmann, D., Trumper, K., Trusheim, H., Ueki, K., Kahn, C. R.,
Cantley, L. C., Fruman, D. A. and Horsch, D. (2003). Altered
signaling and cell cycle regulation in embryonal stem cells with a disruption
of the gene for phosphoinositide 3-kinase regulatory subunit p85alpha.
J. Biol. Chem. 278,5099
-5108.
Hatfield, S. D., Shcherbata, H. R., Fischer, K. A., Nakahara,
K., Carthew, R. W. and Ruohola-Baker, H. (2005). Stem cell
division is regulated by the microRNA pathway. Nature
435,974
-978.[CrossRef][Medline]
Hodge, R. D., D'Ercole, A. J. and O'Kusky, J. R.
(2004). Insulin-like growth factor-I accelerates the cell cycle
by decreasing G1 phase length and increases cell cycle reentry in the
embryonic cerebral cortex. J. Neurosci.
24,10201
-10210.
Hsu, H. J., LaFever, L. and Drummond-Barbosa, D.
(2008). Diet controls normal and tumorous germline stem cells via
insulin-dependent and -independent mechanisms in Drosophila. Dev.
Biol. 313,700
-712.[CrossRef][Medline]
Ivanovska, I., Ball, A. S., Diaz, R. L., Magnus, J. F.,
Kibukawa, M., Schelter, J. M., Kobayashi, S. V., Lim, L., Burchard, J.,
Jackson, A. L. et al. (2008). MicroRNAs in the miR-106b
family regulate p21/CDKN1A and promote cell cycle progression. Mol.
Cell. Biol. 28,2167
-2174.
Jin, Z. and Xie, T. (2007). Dcr-1 maintains
Drosophila ovarian stem cells. Curr. Biol.
17,539
-544.[CrossRef][Medline]
Jordan, K. C., Schaeffer, V., Fischer, K. A., Gray, E. E. and
Ruohola-Baker, H. (2006). Notch signaling through tramtrack
bypasses the mitosis promoting activity of the JNK pathway in the
mitotic-to-endocycle transition of Drosophila follicle cells. BMC
Dev. Biol. 6,16
.[CrossRef][Medline]
Kollet, O., Dar, A., Shivtiel, S., Kalinkovich, A., Lapid, K.,
Sztainberg, Y., Tesio, M., Samstein, R. M., Goichberg, P., Spiegel, A. et
al. (2006). Osteoclasts degrade endosteal components and
promote mobilization of hematopoietic progenitor cells. Nat.
Med. 12,657
-664.[CrossRef][Medline]
Kops, G. J., de Ruiter, N. D., De Vries-Smits, A. M., Powell, D.
R., Bos, J. L. and Burgering, B. M. (1999). Direct control of
the Forkhead transcription factor AFX by protein kinase B.
Nature 398,630
-634.[CrossRef][Medline]
Kuzin, A., Kundu, M., Brody, T. and Odenwald, W. F.
(2007). The Drosophila nerfin-1 mRNA requires multiple microRNAs
to regulate its spatial and temporal translation dynamics in the developing
nervous system. Dev. Biol.
310, 35-43.[CrossRef][Medline]
LaFever, L. and Drummond-Barbosa, D. (2005).
Direct control of germline stem cell division and cyst growth by neural
insulin in Drosophila. Science
309,1071
-1073.
Lane, M. E., Sauer, K., Wallace, K., Jan, Y. N., Lehner, C. F.
and Vaessin, H. (1996). Dacapo, a cyclin-dependent kinase
inhibitor, stops cell proliferation during Drosophila development.
Cell 87,1225
-1235.[CrossRef][Medline]
le Sage, C., Nagel, R., Egan, D. A., Schrier, M., Mesman, E.,
Mangiola, A., Anile, C., Maira, G., Mercatelli, N., Ciafre, S. A. et al.
(2007). Regulation of the p27(Kip1) tumor suppressor by miR-221
and miR-222 promotes cancer cell proliferation. EMBO
J. 26,3699
-3708.[CrossRef][Medline]
Li, X. and Carthew, R. W. (2005). A microRNA
mediates EGF receptor signaling and promotes photoreceptor differentiation in
the Drosophila eye. Cell
123,1267
-1277.[CrossRef][Medline]
Long, D., Lee, R., Williams, P., Chan, C. Y., Ambros, V. and
Ding, Y. (2007). Potent effect of target structure on
microRNA function. Nat. Struct. Mol. Biol.
14,287
-294.[CrossRef][Medline]
MacDonald, P. E., Joseph, J. W., Yau, D., Diao, J., Asghar, Z.,
Dai, F., Oudit, G. Y., Patel, M. M., Backx, P. H. and Wheeler, M. B.
(2004). Impaired glucose-stimulated insulin secretion, enhanced
intraperitoneal insulin tolerance, and increased beta-cell mass in mice
lacking the p110gamma isoform of phosphoinositide 3-kinase.
Endocrinology 145,4078
-4083.
Medema, R. H., Kops, G. J., Bos, J. L. and Burgering, B. M.
(2000). AFX-like Forkhead transcription factors mediate
cell-cycle regulation by Ras and PKB through p27kip1.
Nature 404,782
-787.[CrossRef][Medline]
Meyer, C. A., Kramer, I., Dittrich, R., Marzodko, S., Emmerich,
J. and Lehner, C. F. (2002). Drosophila p27Dacapo expression
during embryogenesis is controlled by a complex regulatory region independent
of cell cycle progression. Development
129,319
-328.[Medline]
Michael, M. D., Kulkarni, R. N., Postic, C., Previs, S. F.,
Shulman, G. I., Magnuson, M. A. and Kahn, C. R. (2000). Loss
of insulin signaling in hepatocytes leads to severe insulin resistance and
progressive hepatic dysfunction. Mol. Cell
6, 87-97.[CrossRef][Medline]
Morrison, S. J. and Spradling, A. C. (2008).
Stem cells and niches: mechanisms that promote stem cell maintenance
throughout life. Cell
132,598
-611.[CrossRef][Medline]
Mourkioti, F. and Rosenthal, N. (2005). IGF-1,
inflammation and stem cells: interactions during muscle regeneration.
Trends Immunol. 26,535
-542.[CrossRef][Medline]
Murchison, E. P., Partridge, J. F., Tam, O. H., Cheloufi, S. and
Hannon, G. J. (2005). Characterization of Dicer-deficient
murine embryonic stem cells. Proc. Natl. Acad. Sci.
USA 102,12135
-12140.
Nakae, J., Kitamura, T., Kitamura, Y., Biggs, W. H., 3rd, Arden,
K. C. and Accili, D. (2003). The forkhead transcription
factor Foxo1 regulates adipocyte differentiation. Dev.
Cell 4,119
-129.[CrossRef][Medline]
Narbonne, P. and Roy, R. (2006). Inhibition of
germline proliferation during C. elegans dauer development requires PTEN, LKB1
and AMPK signalling. Development
133,611
-619.
Neumuller, R. A., Betschinger, J., Fischer, A., Bushati, N.,
Poernbacher, I., Mechtler, K., Cohen, S. M. and Knoblich, J. A.
(2008). Mei-P26 regulates microRNAs and cell growth in the
Drosophila ovarian stem cell lineage. Nature
454,241
-245.[CrossRef][Medline]
Park, J. K., Liu, X., Strauss, T. J., McKearin, D. M. and Liu,
Q. (2007). The miRNA pathway intrinsically controls
self-renewal of Drosophila germline stem cells. Curr.
Biol. 17,533
-538.[CrossRef][Medline]
Park, Y., Maizels, E. T., Feiger, Z. J., Alam, H., Peters, C.
A., Woodruff, T. K., Unterman, T. G., Lee, E. J., Jameson, J. L. and
Hunzicker-Dunn, M. (2005). Induction of cyclin D2 in rat
granulosa cells requires FSH-dependent relief from FOXO1 repression coupled
with positive signals from Smad. J. Biol. Chem.
280,9135
-9148.
Rubin, R., Arzumanyan, A., Soliera, A. R., Ross, B., Peruzzi, F.
and Prisco, M. (2007). Insulin receptor substrate (IRS)-1
regulates murine embryonic stem (mES) cells self-renewal. J. Cell.
Physiol. 213,445
-453.[CrossRef][Medline]
Ruby, J. G., Stark, A., Johnston, W. K., Kellis, M., Bartel, D.
P. and Lai, E. C. (2007). Evolution, biogenesis, expression,
and target predictions of a substantially expanded set of Drosophila
microRNAs. Genome Res.
17,1850
-1864.
Sacchetti, B., Funari, A., Michienzi, S., Di Cesare, S.,
Piersanti, S., Saggio, I., Tagliafico, E., Ferrari, S., Robey, P. G.,
Riminucci, M. et al. (2007). Self-renewing osteoprogenitors
in bone marrow sinusoids can organize a hematopoietic microenvironment.
Cell 131,324
-336.[CrossRef][Medline]
Saltiel, A. R. and Kahn, C. R. (2001). Insulin
signalling and the regulation of glucose and lipid metabolism.
Nature 414,799
-806.[CrossRef][Medline]
Schmidt, M., Fernandez de Mattos, S., van der Horst, A.,
Klompmaker, R., Kops, G. J., Lam, E. W., Burgering, B. M. and Medema, R.
H. (2002). Cell cycle inhibition by FoxO forkhead
transcription factors involves downregulation of cyclin D. Mol.
Cell. Biol. 22,7842
-7852.
Seoane, J., Le, H. V., Shen, L., Anderson, S. A. and Massague,
J. (2004). Integration of Smad and forkhead pathways in the
control of neuroepithelial and glioblastoma cell proliferation.
Cell 117,211
-223.[CrossRef][Medline]
Shcherbata, H. R., Althauser, C., Findley, S. D. and
Ruohola-Baker, H. (2004). The mitotic-to-endocycle switch in
Drosophila follicle cells is executed by Notch-dependent regulation of G1/S,
G2/M and M/G1 cell-cycle transitions. Development
131,3169
-3181.
Shcherbata, H. R., Ward, E. J., Fischer, K. A., Yu, J. Y.,
Reynolds, S. H., Chen, C. H., Xu, P., Hay, B. A. and Ruohola-Baker, H.
(2007). Stage-specific differences in the requirements for
germline stem cell maintenance in the Drosophila ovary. Cell Stem
Cell 1,698
-709.[CrossRef][Medline]
Sinkkonen, L., Hugenschmidt, T., Berninger, P., Gaidatzis, D.,
Mohn, F., Artus-Revel, C. G., Zavolan, M., Svoboda, P. and Filipowicz, W.
(2008). MicroRNAs control de novo DNA methylation through
regulation of transcriptional repressors in mouse embryonic stem cells.
Nat. Struct. Mol. Biol.
15,259
-267.[CrossRef][Medline]
Stadler, B. M. and Ruohola-Baker, H. (2008).
Small RNAs: keeping stem cells in line. Cell
132,563
-566.[CrossRef][Medline]
Stark, A., Brennecke, J., Russell, R. B. and Cohen, S. M.
(2003). Identification of Drosophila MicroRNA targets.
PLoS Biol. 1,E60
.[CrossRef][Medline]
Sugiyama, T., Kohara, H., Noda, M. and Nagasawa, T.
(2006). Maintenance of the hematopoietic stem cell pool by
CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches.
Immunity 25,977
-988.[CrossRef][Medline]
Taguchi, A. and White, M. F. (2008).
Insulin-like signaling, nutrient homeostasis, and life span. Annu.
Rev. Physiol. 70,191
-212.[CrossRef][Medline]
Teleman, A. A., Maitra, S. and Cohen, S. M.
(2006). Drosophila lacking microRNA miR-278 are defective in
energy homeostasis. Genes Dev.
20,417
-422.
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Ueki, K., Yballe, C. M., Brachmann, S. M., Vicent, D., Watt, J.
M., Kahn, C. R. and Cantley, L. C. (2002). Increased insulin
sensitivity in mice lacking p85beta subunit of phosphoinositide 3-kinase.
Proc. Natl. Acad. Sci. USA
99,419
-424.
Vasudevan, S., Tong, Y. and Steitz, J. A.
(2007). Switching from repression to activation: microRNAs can
up-regulate translation. Science
318,1931
-1934.
Visone, R., Russo, L., Pallante, P., De Martino, I., Ferraro,
A., Leone, V., Borbone, E., Petrocca, F., Alder, H., Croce, C. M. et al.
(2007). MicroRNAs (miR)-221 and miR-222, both overexpressed in
human thyroid papillary carcinomas, regulate p27Kip1 protein levels and cell
cycle. Endocr. Relat. Cancer
14,791
-798.
Wang, L., Schulz, T. C., Sherrer, E. S., Dauphin, D. S., Shin,
S., Nelson, A. M., Ware, C. B., Zhan, M., Song, C. Z., Chen, X. et al.
(2007). Self-renewal of human embryonic stem cells requires
insulin-like growth factor-1 receptor and ERBB2 receptor signaling.
Blood 110,4111
-4119.
Wang, Y., Medvid, R., Melton, C., Jaenisch, R. and Blelloch,
R. (2007). DGCR8 is essential for microRNA biogenesis and
silencing of embryonic stem cell self-renewal. Nat.
Genet. 39,380
-385.[CrossRef][Medline]
Wang, Y., Baskerville, S., Shenoy, A., Babiarz, J. E., Baehner,
L. and Blelloch, R. (2008). Embryonic stem cell-specific
microRNAs regulate the G1-S transition and promote rapid proliferation.
Nat. Genet. 40,1478
-1483.[CrossRef][Medline]
Wu, Q. and Brown, M. R. (2006). Signaling and
function of insulin-like peptides in insects. Annu. Rev.
Entomol. 51,1
-24.[CrossRef][Medline]
Xie, T. and Spradling, A. C. (1998).
decapentaplegic is essential for the maintenance and division of germline stem
cells in the Drosophila ovary. Cell
94,251
-260.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of
genetic mosaics in developing and adult Drosophila tissues.
Development 117,1223
-1237.[Abstract]
Yamashita, Y. M., Fuller, M. T. and Jones, D. L.
(2005). Signaling in stem cell niches: lessons from the
Drosophila germline. J. Cell Sci.
118,665
-672.
Yang, L., Chen, D., Duan, R., Xia, L., Wang, J., Qurashi, A.,
Jin, P. and Chen, D. (2007). Argonaute 1 regulates the fate
of germline stem cells in Drosophila. Development
134,4265
-4272.
Ye, P. and D'Ercole, A. J. (2006). Insulin-like
growth factor actions during development of neural stem cells and progenitors
in the central nervous system. J. Neurosci. Res.
83, 1-6.[CrossRef][Medline]
Yi, R., Poy, M. N., Stoffel, M. and Fuchs, E.
(2008). A skin microRNA promotes differentiation by repressing
`stemness'. Nature 452,225
-229.[CrossRef][Medline]
Zinzalla, V., Graziola, M., Mastriani, A., Vanoni, M. and
Alberghina, L. (2007). Rapamycin-mediated G1 arrest involves
regulation of the Cdk inhibitor Sic1 in Saccharomyces cerevisiae.
Mol. Microbiol. 63,1482
-1494.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
J.-Y. Yu, S. H. Reynolds, S. D. Hatfield, H. R. Shcherbata, K. A. Fischer, E. J. Ward, D. Long, Y. Ding, and H. Ruohola-Baker Dicer-1-dependent Dacapo suppression acts downstream of insulin receptor in regulating cell division of Drosophila germline stem cells J. Cell Sci., May 1, 2009; 122(9): e1 - e1. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||