HECT-E3 ligase ETC-1 regulates securin and cyclin B1 cytoplasmic abundance to promote timely anaphase during meiosis in C. elegans

The anaphase inhibitor securin plays a key role as a mitotic substrate of the anaphase promoting complex/cyclosome (APC/C) by regulating the timing of sister chromatid separation (Musacchio and Salmon, 2007). It binds and inhibits separase, a protease that cleaves the cohesin component Scc1/Rad21. Once all pairs of sister chromatids have achieved bipolar spindle attachment via the kinetochore, APC/C targets securin for ubiquitin-mediated proteolysis. This degradation of securin allows separase to cleave Scc1/Rad21, leading to sister chromatid separation.

In budding yeast, the recognition and ubiquitylation of securin by APC/C is regulated by the phosphorylation status of securin, which is controlled by Cdk1 and Cdc14 (Holt et al., 2008). As budding yeast Cdc14 is activated by separase (Stegmeier et al., 2002; Queralt et al., 2006), this Cdk1-Cdc14-mediated regulation of securin stability is likely to constitute a positive-feedback loop that leads to sudden and rapid destruction of securin to enable the switch-like activation of separase. Chromosome missegregation frequency is high in unphosphorylatable securin mutants (Holt et al., 2008), suggesting that abrupt destruction of securin is crucial to maintain chromosome stability. In mouse oocytes, accumulation of securin titrates APC/C activity, thereby increasing the stability of another mitotic APC/C substrate, cyclin B1, to drive entry into M phase (Marangos and Carroll, 2008).

The APC/C-mediated regulatory system also controls meiotic progression (Pesin and Orr-Weaver, 2008). During meiosis, two rounds of chromosome segregation occur sequentially, without an intervening S phase, to generate haploid cells. During meiotic prophase, each pair of homologous chromosomes is connected via the meiotic cohesin complex, in which the mitotic cohesin component Scc1/Rad21 is replaced by the meiosis-specific cohesin component Rec8 (Parisi et al., 1999; Lee et al., 2003; Xu et al., 2005). Meiotic cohesin also connects sister chromatid pairs until meiosis II division. Separase cleaves Rec8 for onset of anaphase I and anaphase II.

The requirement for APC/C-mediated degradation of securin to activate separase for Rec8 removal from meiotic chromosomes is a widely conserved mechanism in the reproduction process in eukaryotes. In C. elegans, mutational inactivation or RNAi-mediated knockdown of APC/C components causes meiotic metaphase I arrest (Furuta et al., 2000; Golden et al., 2000; Davis et al., 2002; Shakes et al., 2003; Shakes et al., 2011). Similarly, knockdown of APC/C activators FZY-1/Cdc20, IFY-1/securin and SEP-1/separase causes metaphase I arrest (Siomos et al., 2001; Kitagawa et al., 2002; Shakes et al., 2003). The temperature-sensitive allele of APC/C components exhibits abnormalities in both meiosis I and II at semi-permissive temperature. However, defects during meiosis II include a failure in sister chromatid separation and meiosis II spindle elongation but not metaphase II arrest; therefore, whether APC/C activity is required for the onset of anaphase II remains unclear.

In C. elegans, in addition to APC/C, another type of E3 ligase, cullin 2 (CUL-2), plays a crucial role in meiotic progression (Liu et al., 2004; Sonneville and Gönczy, 2004; Vasudevan et al., 2007). Loss of function of the elongin-CUL-2-RBX-1 E3 ligase complex or its substrate-specific adaptor, ZYG-11, delays the onset of anaphase II and exit from meiosis II (Liu et al., 2004; Sonneville and Gönczy, 2004; Vasudevan et al., 2007). Depletion of CUL-2 or ZYG-11 causes accumulation of cyclins B1 and B3, but it remains unclear whether these cyclins are the targets of CUL-2 and ZYG-11 or accumulate as an indirect consequence of the accumulation of other CUL-2 targets. For faithful chromosome transmission during meiosis and mitosis, other ubiquitin E3 ligases might function synergistically or independently to achieve the ubiquitin-mediated proteolysis essential for proper cell cycle progression. To understand the molecular mechanism underlying the coordination of cell cycle events, it is important to identify the E3 ligase and its substrate for proteolysis.

We have previously reported that IFY-1 acts as securin in C. elegans embryos (Kitagawa et al., 2002). IFY-1 interacts with the APC/C activator FZY-1 and separase SEP-1. IFY-1 accumulates in APC/C-defective embryos. Also, RNAi-mediated depletion of IFY-1 phenocopies SEP-1-defective embryos. Unlike Pds1 in budding yeast and Pttg1 in mouse [which act as securin to maintain chromosome stability but are dispensable for growth and fertility (Yamamoto et al., 1996; Jallepalli et al., 2001)], IFY-1 has an essential function during meiotic progression and IFY-1-depleted embryos arrest before anaphase I (Kitagawa et al., 2002).

Here, we show that ETC-1, a HECT-E3 ligase, regulates the stability of cytoplasmic IFY-1 and CYB-1 in post-meiosis I C. elegans embryos. An in vitro ubiquitylation assay revealed that ETC-1 ubiquitylates IFY-1 and CYB-1 in the presence of the E2 enzyme UBC-18. These data and those obtained from RNAi-mediated functional analysis suggest that ETC-1 and UBC-18 target cytoplasmic IFY-1 and CYB-1 for ubiquitin-mediated proteolysis independently of APC/C, thereby leading to rapid degradation of cytoplasmic IFY-1 and CYB-1 after anaphase I.

C. elegans strains and alleles are listed in supplementary material Table S1. Transgenic worms were generated by ballistic transformation with expression vectors using PDS-1000 (Bio-Rad) as described (Praitis et al., 2001).

RNAi was performed by feeding with double-stranded RNA (dsRNA)-expressing bacteria or by the soaking method, as described previously (Maeda et al., 2001; Kamath and Ahringer, 2003). RNAi vectors for targeting apc-2, sep-1, ubc-18, ify-1 and etc-1 were retrieved from the Ahringer C. elegans RNAi feeding library (Wellcome/CRC Institute, University of Cambridge, UK) (Kamath and Ahringer, 2003) obtained from Geneservice (Cambridge, UK). The L4440 RNAi vector (pPD129.36) was used as an RNAi empty vector control. For etc-1 RNAi, bacterial cells in induced culture were pelleted and resuspended in M9 buffer. Aliquots were frozen and stored at -80°C. For each experiment, the bacterial suspension was freshly thawed and seeded onto nematode growth medium (NGM) plates. Worms were transferred to newly seeded plates every 24 hours for 4 days. For co-depletion of IFY-1 and ETC-1, equal volumes of ify-1(RNAi) and etc-1(RNAi) bacterial cell suspensions were thoroughly mixed and plated. For depletion of IFY-1 alone as a control, the ify-1(RNAi) bacterial cell suspension was mixed with an equal volume of Escherichia coli OP50 cell suspension.

For RT-PCR analysis of etc-1 expression, total RNA was extracted using Trizol according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). DNA contamination was removed by incubation with DNase I at 37°C for 20 minutes. One-step RT-PCR was performed using QIAGEN OneStep PT-PCR kit according to the manufacturer’s protocol (Qiagen) with primers (5’-3’): etc-1, CTGAGTGGAATCGGAGAACA and GAGGTCGGCTTG ATATGATCT; actin (internal control), CGGTATGGGACAGAAGGACT and GTGCTCGATTGGGTACTTCA.

For time-lapse movies of embryos in utero, young adult hermaphrodites were anesthetized with 0.0125% tetramisole (Sigma) in M9 and mounted on 1% agarose pads with a thin layer of mineral oil between the coverslip and pad. A set of images at three focal planes at 2 μm intervals was taken at each time point. Live images were taken by a DM IRE2 motorized fluorescence microscope (Leica Microsystems, Allendale, NJ, USA) equipped with a Plan Apo 63× lens (NA=1.4, Leica) and an ORCA-ER high-resolution digital CCD camera (Hamamatsu, Bridgewater, NJ, USA) under the control of Openlab software (Improvision, Lexington, MA, USA). IFY-1-GFP and GFP-CYB-1 levels were quantitated by measuring the fluorescent signal with Openlab and subtracting background fluorescence. When collecting data from each embryo, the intensity of the signal in an oocyte at the -1 position was also measured and used to calculate the value for each embryo relative to the -1 oocyte. For still images, 10-15 focal planes at 1 μm intervals were taken and processed into extended-focus images using Volocity software (Improvision).

Immunofluorescence experiments were performed as described (Watanabe et al., 2008). The primary antibody for immunofluorescence microscopy was anti-REC-8 (Pasierbek et al., 2001). The secondary antibody was Alexa Fluor 594-conjugated anti-rabbit IgG antibody (Molecular Probes). To visualize DNA, 1 μg/ml DAPI was added to the secondary antibody solution.

The N-terminal half of etc-1 cDNA (bp 1-1416) was cloned into pGEX4T1 (GE Healthcare, Piscataway, NJ, USA). Bacterially expressed and purified GST-ETC-1Nter (amino acids 1-472) was used to immunize two rabbits. Antisera were generated by Pocono Rabbit Farm and Laboratory (PRF&L, Canadensis, PA, USA). Immune sera were depleted of anti-GST antibodies by passages through a GST-coupled column; then, anti-ETC-1 antibody was purified on GST-ETC-1 immobilized on a PVDF membrane and eluted with 100 mM glycine (pH 2.5). Eluate was neutralized with 2 M Tris-HCl (pH 8.5) and dialyzed against PBS (pH 7.4) containing 10% glycerol.

The protein lysate was prepared from gravid worms expressing GFP and IFY-1-GFP (strains RQ281 and RQ423, respectively) grown at 16°C, and immunoprecipitation was performed with anti-GFP antibody as described (Watanabe et al., 2008). Immunoprecipitates were separated on 4-12% Nu-PAGE (Invitrogen) and stained with SYPRO Ruby (Invitrogen). Gel slices containing protein bands in IFY-1-GFP immunoprecipitates and those at corresponding positions in immunoprecipitates with GFP alone were excised, reduced, and alkylated with iodoacetamide and digested with trypsin. Tryptic peptides were analyzed by liquid chromatography with tandem mass spectrometry (LC-MS/MS) at the Proteomics Core Facility (St Jude Children’s Research Hospital, Memphis, TN, USA) using an LTQ linear ion trap mass spectrometer (ThermoElectron, San Jose, CA, USA). Database searches were performed using LTQ.raw files in combination with the Mascot search engine (Matrix Science). The proteins identified are described in supplementary material Table S2.

For the co-immunoprecipitation assay, GFP, IFY-1-GFP and GFP-CYB-1 were immunoprecipitated with anti-GFP antibody or rabbit IgG from the whole-worm protein lysate prepared from strains RQ281, RQ386, RQ414, and N2. Immunoprecipitates were separated on 4-12% Nu-PAGE and transferred to a PVDF membrane. The membrane was divided in two at the position of the 102 kDa marker protein. The top portion (proteins larger than 102 kDa) was blotted with anti-ETC-1 antibody. The bottom portion (proteins smaller than 102 kDa) was blotted with anti-GFP mouse monoclonal antibody (Roche Diagnostics, Indianapolis, IN, USA).

The His6-IFY-1 expression vector was constructed by cloning a full-length ify-1 cDNA into pRSETA (Invitrogen). To construct the CYB-1-His6 expression vector, full-length cyb-1 cDNA was amplified by PCR from a yeast two-hybrid cDNA (RB1) library (gift from Robert Barstead, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA) using specific primers (a T7 promoter sequence and a His-6 coding sequence were added to the forward and reverse primers, respectively) and cloned into a pBluescript SKII plasmid (Stratagene, La Jolla, CA, USA). The His6-EGFP expression vector pET9d-EGFP was described previously (Meacci et al., 2006) and kindly provided by Karsten Kruse (Max-Planck Institute for the Physics of Complex Systems, Dresden, Germany). GST-ETC-1 expression vector was constructed by cloning a full-length cDNA of etc-1 into pGEX4T1. Expression vectors for GST-WWP-1 and GST-UBC-18 were obtained from Andrea Carrano and Andrew Dillin (The Salk Institute for Biological Studies, La Jolla, CA, USA), and for GST-APC-11, GST-APC-11m and His6-UBC-2 were obtained from Lynn Boyd (University of Alabama in Huntsville, Huntsville, AL, USA). GST-APC-11m is GST fused mutant APC-11, in which a cysteine in position 100 of the RING finger of APC-11 was replaced with a leucine, and used as an E3 ligase inactive control for the in vitro ubiquitylation assay (Frazier et al., 2004).

To express fusion proteins for use in ubiquitylation assays, 30 ml of a saturated culture of BL21 bacteria carrying individual expression plasmids was inoculated into 1 liter of LB medium containing 100 μg/ml ampicillin and grown to an optical density of 0.3-0.5 at 37°C. Cultures were induced for 2-4 hours by adding IPTG to a final concentration of 1 mM. His6-IFY-1, CYB-1-His6, His6-EGFP and His6-UBC-2 were purified under nondenaturing conditions using nickel-nitrilotriacetic acid (Qiagen, Germantown, MD, USA). GST, GST-ETC-1, GST-WWP-1, GST-APC-11 and GST-APC-11m were purified by glutathione S-transferase (GST) chromatography (GE Healthcare, Waukesha, WI, USA). The GST tag on UBC-18 was removed by thrombin cleavage, and thrombin was absorbed by incubating with benzamidine Sepharose 4B beads. Eluted proteins were dialyzed against ubiquitylation buffer (50 mM Tris pH 8.0, 5 mM MgCl₂, 2 mM NaF, 0.5 mM DTT) or storage buffer (50 mM HEPES pH 8.0, 100 mM NaCl, 10% glycerol). To check the purity and the amount of GST-proteins used for the assay, purified samples were separated on SDS-PAGE, and visualized by staining the gel with Simply Blue. His6-proteins were separated on SDS-PAGE, transferred to a PVDF membrane, then blotted with anti-penta his antibody.

Ubiquitylation assays were performed in a reaction volume of 30 μl in ubiquitylation buffer for 1.5 hours at 32°C. The reaction mixture consisted of 550 ng/μl UBE1 (Boston Biochem, Cambridge, MA, USA), 1.8 μg/μl UBC-2 or UBC-18, 20-25 μg GST-fused E3 ubiquitin ligases, 100 mM ATP and 10 μg/μl hemagglutinin-tagged ubiquitin (HA-Ub). Sample buffer was added to stop the reaction. The reaction mixture was separated on SDS-PAGE and transferred to a PVDF membrane. Ubiquitylation and substrate modification were detected by probing with anti-HA antibody (rat monoclonal, 1:1000; Roche) and anti-His antibody (mouse monoclonal, 1:2000; Qiagen), respectively. The detection was performed with chemiluminescent reagents (GE Healthcare).

To further characterize the physiological function of IFY-1, we generated a transgenic worm strain expressing IFY-1 fused at the C-terminus with GFP (IFY-1-GFP) under the control of its endogenous promoter and 3′ region (supplementary material Fig. S1). The ify-1 mutant allele tm947 contains a genomic deletion of 648 bp, from -594 bp to +53 bp of the ify-1 coding sequence, and is therefore likely to be a null allele. tm947 homozygotes derived from heterozygous parents exhibited an embryonic lethal phenotype (supplementary material Table S1). IFY-1-GFP expression suppressed the embryonic lethality of tm947 homozygotes, suggesting that IFY-1-GFP is functional. Although tm947 also deletes rpl-22 from -520 bp to +127 bp, which encodes an essential ribosomal protein large subunit on the complementary strand, our construct also contains the entire rpl-22 coding region and an adequate level of RPL-22 is likely to be expressed from the transgene. The spatiotemporal dynamics of IFY-1 expression was determined throughout development using a strain expressing IFY-1-GFP in an ify-1 null background (tm947 homozygotes).

Fluorescence microscopy analysis identified substantial levels of IFY-1-GFP in the cytoplasm of germ cells (Fig. 1A). The cytoplasmic IFY-1-GFP was maintained at a high level during oocyte maturation. Upon nuclear envelope breakdown (NEBD) in mature oocytes, IFY-1-GFP began associating with chromosomes and meiosis I spindle microtubules, and remained associated with them during meiosis I but disappeared immediately after homologous chromosome separation (anaphase I) (Fig. 1B). Cytoplasmic levels of IFY-1-GFP were also reduced immediately after chromosomal IFY-1-GFP degradation and maintained at a low level during meiosis II and the following mitoses. This drastic change in the total cellular level of IFY-1 during meiosis is comparable to securin dynamics in mouse oocytes (Nabti et al., 2008; McGuinness et al., 2009).

There was no appreciable chromosomal association of IFY-1-GFP fluorescence signal in embryonic cells undergoing mitosis during early stage embryogenesis (supplementary material Fig. S2A). However, when a spindle checkpoint-dependent mitotic delay was induced by CYB-3 depletion (Deyter et al., 2010), chromosome-associated IFY-1 was seen (supplementary material Fig. S2A), suggesting that IFY-1 is stabilized as a result of inhibition of APC/C by the spindle checkpoint. Also, there was cell cycle-dependent chromosomal association of IFY-1 in embryos developing further than the 4E stage (50-90 cells) (supplementary material Fig. S2B). The cell cycle lengths of blastomeres during 4E are longer than during the early stage (Bao et al., 2008). Given that the IFY-1-GFP signal became detectable even during early stage embryogenesis if the cell cycle length was extended by CYB-3 depletion, it is possible that IFY-1-GFP needs to be newly synthesized before mitosis in each round of the cell cycle and becomes detectable only when the cell cycle length is long enough for it to become fluorescent (by being properly folded). Alternatively, control of the chromosomal association of IFY-1 during the early and later stages of embryogenesis might be distinct. Taken together, the association of IFY-1 with mitotic chromosomes in a cell cycle-dependent manner suggests its role as a securin during mitosis.

C. elegans proteins were screened by immunoprecipitation-mass spectrometry analysis to identify those that associate with IFY-1. Forty-seven proteins were identified in IFY-1-GFP co-immunoprecipitates, including 31 proteins also identified in co-immunoprecipitates with GFP alone (supplementary material Fig. S3). SEP-1, a known IFY-1 interactor, was one of the 16 proteins identified specifically in IFY-1-GFP co-immunoprecipitates (supplementary material Table S2).

To determine which of these candidate IFY-1-associated proteins are required for proper function of IFY-1, we analyzed the effect of their RNAi knockdown on the subcellular dynamics of IFY-1-GFP. First, we confirmed whether IFY-1 dynamics is affected by reduction of APC/C activity or depletion of its binding partner SEP-1. Depletion of an APC/C component (e.g. APC-2) or a substrate-specific activator of APC/C (e.g. FZY-1) causes strict arrest of meiotic embryos before anaphase I (Golden et al., 2000; Kitagawa et al., 2002). In these arrested embryos, IFY-1-GFP remained associated with meiotic chromosomes and the cytoplasmic level of IFY-1-GFP remained high (Fig. 2A). SEP-1-depleted embryos were also arrested in meiosis I and failed to progress to meiosis II. In SEP-1-depleted oocytes, IFY-1-GFP entered the nuclei before NEBD (supplementary material Fig. S4). During meiosis I, there was no detectable association of IFY-1-GFP with chromosomes (Fig. 2A; supplementary material Fig. S4). These observations suggest that IFY-1 is retained in the cytoplasm when it forms a complex with SEP-1 during interphase, and the IFY-1-SEP-1 complex is recruited to meiotic chromosomes after NEBD in an SEP-1-dependent manner. In SEP-1-depleted embryos, an IFY-1-GFP signal coincident with the meiosis I spindle was still detectable (Fig. 2A; supplementary material Fig. S4), suggesting that IFY-1 associates with the meiosis I spindle independently of SEP-1. The budding yeast securin Pds1 also localizes to the spindle independently of the separase Esp1 (Jensen et al., 2001), suggesting that IFY-1 possesses a conserved securin function.

We identified the D2085.4 gene product with eight unique tryptic peptides, which cover 11.6% of the entire protein (supplementary material Table S2), as an IFY-1 interactor. The D2085.4 gene product has sequence similarity with the human HECT domain-containing E3 ligase UBE3C (supplementary material Fig. S5); therefore, we refer to this protein as ETC-1 [from UBE Three C-1]. Our RNAi screen revealed that knockdown of ETC-1 altered IFY-1 stability during meiotic division. We performed RNAi-mediated ETC-1 knockdown by feeding worms with etc-1 dsRNA-expressing bacteria, which reduced the endogenous etc-1 mRNA level to less than 10% of that in untreated worms (supplementary material Fig. S6A). The effectiveness of etc-1 RNAi by the feeding method was also confirmed by substantial reduction of the GFP signal in transgenic embryos expressing GFP-ETC-1 (supplementary material Fig. S6B).

The expression pattern of IFY-1-GFP in etc-1(RNAi) germ cells was comparable to that in untreated controls until germ cells entered meiosis II (supplementary material Fig. S7). The stability of cytoplasmic IFY-1-GFP during meiosis II appeared altered in etc-1(RNAi) embryos (Fig. 2A,B; supplementary material Fig. S7). In untreated embryos, the cytoplasmic IFY-1-GFP signal drastically diminished immediately after the disappearance of chromosome-associated IFY-1-GFP. However, in etc-1(RNAi) embryos the cytoplasmic IFY-1-GFP signal gradually reduced after anaphase I, but ∼50% of the signal remained in the cytoplasm during meiosis II (Fig. 2A,B). Thus, RNAi knockdown of ETC-1 substantially stabilized cytoplasmic IFY-1 in post-meiosis I embryos.

Corresponding to the stabilization of IFY-1 in post-meiosis I embryos, the duration of meiosis II (the interval between the onset of anaphase I and anaphase II) was substantially extended in etc-1(RNAi) embryos (Fig. 3A). Since anaphase II is triggered by cleavage of the meiosis-specific cohesin subunit REC-8 by SEP-1, this extension might be a consequence of SEP-1 inhibition by the stabilized IFY-1. Consistent with this hypothesis, immunostaining analysis revealed that REC-8 remained between sister chromatids during the extended meiosis II in etc-1(RNAi) embryos (Fig. 3B).

Deficiency of the cullin family protein CUL-2 causes extended meiosis II (Liu et al., 2004; Sonneville and Gönczy, 2004). The delay in anaphase II of a cul-2-defective mutant depends on stabilization of the cyclin B1 CYB-1 (Liu et al., 2004). We analyzed the effect of ETC-1 depletion on the stability of CYB-1, using GFP-CYB-1-expressing embryos. In wild-type embryos, the GFP-CYB-1 signal accumulated in mature oocytes and immediately diminished as meiotic division progressed (Fig. 4A). In etc-1(RNAi) embryos there was a high level of GFP-CYB-1 in the cytoplasm of meiotic embryos and postmeiotic cells (Fig. 4A). Thus, ETC-1 is required to regulate the cytoplasmic level of not only IFY-1 but also CYB-1.

Upon onset of anaphase I, APC/C targets securin and cyclin B1 for ubiquitin-mediated proteolysis. Upregulated securin competes with cyclin B for APC/C-mediated degradation, thereby regulating entry into M phase in mouse oocytes (Marangos and Carroll, 2008). Therefore, ETC-1 knockdown might indirectly stabilize CYB-1 by causing accumulation of IFY-1, which would compete with CYB-1 for APC/C-mediated degradation. We tested this possibility by analyzing the effect of co-depleting IFY-1 and ETC-1 on CYB-1 stability. When GFP-CYB-1-expressing gonad was depleted of IFY-1, embryos were arrested in the 1-cell stage. Chromosomes in arrested embryos were eventually decondensed, and a nuclear membrane formed around each mass of scattered DNA without cell division. Thus, aged embryos became 1-cell embryos with multiple small nuclei (Fig. 4A). The GFP-CYB-1 fluorescence signal was diminished in these arrested ify-1(RNAi) embryos. We optimized the condition for co-depletion of IFY-1 and ETC-1 by the feeding method, and confirmed that the efficiency of IFY-1 knockdown in the ify-1(RNAi); etc-1(RNAi) gonad was comparable to that in ify-1(RNAi) alone using IFY-1-GFP-expressing worms (supplementary material Fig. S8). ify-1(RNAi); etc-1(RNAi) embryos expressing GFP-CYB-1 were also arrested at the 1-cell stage.

If accumulation of GFP-CYB-1 in etc-1(RNAi) embryos is a consequence of IFY-1 accumulation, which titrates APC/C, co-depletion of IFY-1 should prevent CYB-1 accumulation. However, accumulation of GFP-CYB-1 was comparable in ify-1(RNAi); etc-1(RNAi) and etc-1(RNAi) embryos (Fig. 4A,B). Thus, ETC-1 depletion caused accumulation of GFP-CYB-1 regardless of the cellular IFY-1 level. These results suggest that ETC-1 regulates CYB-1 stability in postmeiotic embryos independently of IFY-1. Thus, IFY-1 might not help to regulate CYB-1 levels in postmeiotic embryos. Instead, we found that IFY-1 knockdown affected CYB-1 levels in embryos at the +1 position (immediately after fertilization). In contrast to wild-type embryos at the +1 position, in which the intensity of GFP-CYB-1 remained high (103% of the intensity of the oocyte at the -1 position), ify-1(RNAi) embryos at the +1 position retained only 53% of the GFP-CYB-1 intensity of the oocyte at the -1 position (Fig. 4B). This suggests that depletion of IFY-1 accelerated CYB-1 degradation during meiosis in embryos. As this effect only occurred in embryos with normal levels of ETC-1 [wild type versus ify-1(RNAi)], IFY-1 might compete with CYB-1 during meiotic division for ETC-1-dependent degradation.

We next tested whether ETC-1 physically interacts with CYB-1 as well as with IFY-1 in vivo. We generated anti-ETC-1 rabbit polyclonal antibody, which specifically reacts with endogenous ETC-1 in whole-worm lysate (supplementary material Fig. S9), to analyze whether ETC-1 co-immunoprecipitates with CYB-1 (Fig. 5). When GFP-CYB-1 was ectopically expressed in worms and immunoprecipitated with anti-GFP antibody or rabbit IgG from whole-worm lysate, endogenous ETC-1 was specifically detected in the GFP immunoprecipitate but not in the IgG immunoprecipitate. Endogenous ETC-1 also co-immunoprecipitated with IFY-1-GFP but not GFP alone, confirming that our immunoprecipitation assay identified specific interaction of ETC-1 with IFY-1 and CYB-1. Association of ETC-1 with IFY-1 and CYB-1 was also demonstrated in an in vitro GST pull-down assay. ³⁵S-labeled His6-IFY-1 or CYB-1-His6 expressed in the rabbit reticulocyte system was co-purified with GST-ETC-1 bound to GST-Sepharose beads (supplementary material Fig. S10). Taken together, these results support the proposal that ETC-1 directly associates with CYB-1, as well as with IFY-1, to regulate their dynamics during and after meiosis.

ETC-1 has the E3 ligase motif containing a HECT domain. Given that ETC-1 binds IFY-1, we hypothesized that ETC-1 ubiquitylates IFY-1 for ubiquitin-mediated proteolysis. We established an in vitro system to assess the ubiquitin ligase activity of ETC-1 using bacterially expressed and purified recombinant proteins. C. elegans has 22 proteins with homology to E2 ubiquitin-conjugating enzymes (Kipreos, 2005). Previously reported mutant phenotypes and RNAi phenotypes suggest that the E2 enzymes UBC-2 and UBC-18 can function during germ cell development. UBC-2 functions with the ring domain E3 ligase APC-11 (an APC/C constituent) during meiosis (Frazier et al., 2004). UBC-18 functions with the ARI-1 E3 ligase to regulate pharyngeal development (Qiu and Fay, 2006) and with the WWP-1 E3 ligase to regulate diet restriction-induced longevity (Carrano et al., 2009). In addition, RNAi knockdown of UBC-18 causes a reduction of brood size, suggesting its function in germ cell development (Fay et al., 2003).

We first tested UBC-2 and UBC-18 for in vitro ubiquitin ligase activity of ETC-1. When an E3 ligase protein is incubated with its functional E2 partner and HA-ubiquitin, ligase activity promotes the conjugation of HA-ubiquitin to E3 ligases or E2 enzymes as a step prior to the ubiquitylation of substrate proteins. Therefore, E3 ligase activity can be assessed in the absence of substrate proteins by the formation of high molecular weight HA-ubiquitin conjugates with E3 and E2, which can be detected by western blotting with anti-HA antibody. ETC-1 exhibited robust ubiquitin ligase activity with UBC-18 but not UBC-2 (supplementary material Fig. S11).

Next, we tested whether IFY-1 and CYB-1 were in vitro substrates for ETC-1. When bacterially expressed and purified His6-IFY-1 and CYB-1-His6 were added to the system, modified forms of proteins were detected as multiple bands in the reaction containing both ETC-1 and UBC-18 concomitantly with robust E3 ligase activity (Fig. 6). These protein modifications were not detected in the reaction containing GST-WWP-1, which also exhibited a robust E3 ligase activity with UBC-18. When His6-GFP was added as a negative control substrate, there was no modification even in the presence of active ETC-1 and UBC-18, suggesting that IFY-1 and CYB-1 were specifically ubiquitylated by ETC-1 in a UBC-18-dependent manner. Consistent with this result, RNAi knockdown of UBC-18 increased the stability of IFY-1 in embryos in post-meiosis I (supplementary material Fig. S12). Since UBC-18 functions in pharyngeal development in parallel with LIN-35/Rb, UBC-18 depletion in a lin-35 mutant causes a synthetic lethal phenotype (Fay et al., 2003). By contrast, RNAi knockdown of ETC-1 in the lin-35 mutant in our study did not affect the viability of mutant worms (supplementary material Fig. S13), suggesting that UBC-18 functions with ETC-1 specifically in germ cells in a manner that is distinct from its other functions.

ETC-1 knockdown under our experimental conditions caused elevated levels of cytoplasmic IFY-1 and CYB-1 in post-meiosis I embryos and extended the duration of meiosis II. Nevertheless, these changes did not affect brood size or the viability of progeny in a wild-type genetic background. However, ETC-1 knockdown substantially reduced the viability of progeny in combination with reduction of APC/C activity (Fig. 7A). mat-1(ax161ts) is a temperature-sensitive allele of the APC/C component apc-3 (also known as mat-1) (Shakes et al., 2003). At the restrictive temperature (25°C), mat-1(ax161ts) homozygotes exhibit a strict metaphase-to-anaphase transition (mat)-defective phenotype. At the permissive temperature (16°C), although their brood size is smaller than of the wild type, most mat-1(ax161ts) embryos complete meiosis and develop in a manner indistinguishable from the wild type (Golden et al., 2000; Wallenfang and Seydoux, 2000). ETC-1 knockdown in mat-1(ax161ts) worms caused an embryonic lethal phenotype at 16°C.

To determine the cause of the embryonic lethality of mat-1(ax161ts) etc-1(RNAi) at the permissive temperature, we generated a strain expressing mCherry-histone H2B that was homozygous for mat-1(ax161ts) and analyzed chromosome morphology in developing germ cells and embryos. When depleted of ETC-1 at 16°C, mat-1(ax161ts) embryos were arrested before anaphase I, similar to embryos shifted to the restrictive temperature (Fig. 7B). Thus, the mat-1(ax161ts) etc-1(RNAi) phenotype at 16°C was comparable to that of mat-1(ax161ts) at 25°C.

An embryonic lethal phenotype also occurred with ETC-1 knockdown in combination with fzy-1(h1983), a hypomorphic allele of fzy-1 that suppresses lethality caused by loss of spindle assembly checkpoint activity (Kitagawa et al., 2002). Mutant protein expressed from h1983 cannot bind IFY-1. Furthermore, IFY-1 stability is increased in fzy-1(h1983) embryos (Tarailo et al., 2007). Thus, although ETC-1 activity is dispensable during meiosis I in the presence of an intact APC/C, it becomes essential for progression of meiosis I when APC/C activity is compromised, suggesting that ETC-1 and APC/C function redundantly to maintain the cytoplasmic level of IFY-1 and CYB-1 during meiosis I. Consistent with this, overexpression of CYB-1 also sensitized worms to ETC-1 knockdown (Fig. 7A).

In addition to the defect in metaphase-to-anaphase transition during meiosis I, we found premature NEBD in four out of 30 mat-1(ax161ts) etc-1(RNAi) gonad arms (Fig. 7B). NEBD marks the transition from meiotic prophase to metaphase, and is characteristic of this transition as it occurs occurring during oocyte maturation (McCarter et al., 1999). In the wild-type gonad, NEBD is restricted to the oocyte at the -1 position (the most proximal oocyte next to a spermatheca). Mature oocytes are fertilized within 6 minutes of NEBD. By contrast, in the mat-1(ax161ts) etc-1(RNAi) gonad, NEBD occurred in premature oocytes located in the middle of the proximal region of the gonad arm. After NEBD, oocytes proceeded with meiosis I division, producing a polar body, but did not enter meiosis II, and the chromosomes decondensed before fertilization. This premature NEBD phenotype was not observed in gonads when mat-1(ax161ts) animals were shifted to 25°C or when ETC-1 was knocked down in a wild-type background. These results suggest that ETC-1 and APC/C function cooperatively to maintain oocyte nuclei in diakinesis (the final stage of prophase I) until oocytes are positioned at the most proximal region of the gonad arm.

We have identified that the HECT domain-containing E3 ligase ETC-1 regulates the cytoplasmic level of IFY-1 and CYB-1 during meiotic progression, probably by targeting these proteins for ubiquitin-mediated proteolysis. As both IFY-1 and CYB-1 are crucial mitotic substrates of APC/C, it is possible that ETC-1 controls their stability by regulating APC/C activity. However, ETC-1 physically associates with IFY-1 and CYB-1 and ubiquitylates them in vitro. Therefore, it is more likely that ETC-1 functions independently of APC/C. Unlike loss of APC/C activity, which causes strict arrest at metaphase I, depletion of ETC-1 in a wild-type background substantially increased the stability of IFY-1 and CYB-1 during meiosis II and caused a delay in anaphase II; no other changes in meiotic progression were evident. However, ETC-1 knockdown under reduced APC/C activity revealed that ETC-1 functions in meiosis I redundantly with APC/C (Fig. 8). In mammals, APC/C activity and inactivation of CDK1 by separase are required to reduce cyclin B1 levels sufficiently to allow meiosis I to complete (Gorr et al., 2006). Therefore, our finding that APC/C is not the sole factor driving the completion of meiosis I in C. elegans supports a proposal that there are similar regulatory mechanisms of meiotic progression in worms and mammals. Reduction of activity of ETC-1 and APC/C also caused the premature NEBD phenotype with low-penetrance during prophase I. In mammalian oocytes, APC/C activity is required to maintain low cyclin B1 levels during prophase I arrest (Reis et al., 2007; Holt et al., 2011). CYB-1-dependent phosphorylation of the nuclear pore component NPP-12 (Gp210) is required for timely NEBD during mitosis (Galy et al., 2008). Consistent with this, CYB-1 depletion causes a delay in NEBD (Galy et al., 2008; van der Voet et al., 2009). Given that both ETC-1 and APC/C target CYB-1 for ubiquitin-mediated proteolysis, premature NEBD in mat-1(ax161ts) etc-1(RNAi) might be due to dysregulation of CYB-1.

Recently, Green et al. reported (as part of an RNAi-based functional analysis of 554 essential genes, using gonad morphology as a substrate for high-content phenotypic profiling) that ETC-1 knockdown causes several morphological defects in gonad architecture, including delayed oocyte budding (Green et al., 2011). We obtained the strain used by Green et al. that expresses fluorescent markers to visualize the plasma membrane and chromosomes and confirmed that RNAi-mediated depletion of ETC-1 using our feeding method caused the delayed oocyte budding phenotype (supplementary material Fig. S14). Interestingly, in their assay Green et al. (Green et al., 2011) also observed a delayed oocyte budding phenotype upon knockdown of APC/C components and separase, suggesting that common targets of APC/C and ETC-1, such as IFY-1 and CYB-1, are involved in regulating the timing of oocyte budding. Further studies are needed to elucidate the ETC-1 substrates responsible for the abnormalities observed in the etc-1(RNAi) gonad.

It has been reported that ETC-1 knockdown by RNAi causes sterility (Maeda et al., 2001). However, under our experimental conditions ETC-1 knockdown did not have a severe effect on fertility in a wild-type genetic background. We also tested RNAi by the soaking method and the microinjection method, but found no increase in the severity of phenotypes (our unpublished observations). Furthermore, we recently found that a worm strain homozygous for the etc-1 deletion allele tm5615 (kindly provided by Dr S. Mitani) is viable and fertile (our unpublished observations). Since tm5615 deletes only exons 3 and 4 of etc-1, a truncated yet functional protein might be expressed in tm5615 homozygotes. Although our phenotypic analysis of etc-1(RNAi) or etc-1(tm5615) homozygotes did not identify significant developmental defects, when GFP-fused ETC-1 was exogenously expressed by the pie-1 promoter, a substantial amount of GFP-ETC-1 accumulated in the epidermal tissues of L1 larvae (supplementary material Fig. S6B), suggesting a role for ETC-1 in postembryonic development. This function of ETC-1 might be evident only when other proteins functioning in parallel are simultaneously depleted.

ETC-1 is a HECT domain-containing E3 ligase and has amino acid sequence similarity to budding yeast Hul5. It was recently shown that Hul5 plays an important role in ubiquitylating cytosolic misfolded proteins to maintain protein homeostasis in response to heat shock (Fang et al., 2011). In C. elegans, ubiquitin-mediated proteolysis of misfolded or aggregated proteins is also proposed as a primary mechanism to maintain protein quality. Consistent with this, it has been shown that inhibition of the proteasome and RNAi knockdown of CUL-1 and CUL-2 increase sensitivity to the expression of toxic polyglutamine repeat proteins (Mehta et al., 2009). However, they also showed that ETC-1 knockdown caused the opposite effect: ETC-1 knockdown worms were more resistant to the accumulation of toxic aggregated proteins (Mehta et al., 2009). This suggests that ETC-1 knockdown stabilizes stress response proteins to keep the stress response pathway active. Given that FZY-1 knockdown did not affect sensitivity to the accumulation of aggregated proteins, the target of ETC-1 responsible for the phenotype is unlikely to be IFY-1 or CYB-1.

Taken together, our results support the proposal that ETC-1 is required for the immediate removal of proteins that are transiently accumulated in the cytoplasm, so that the cytosolic protein concentration is brought back to a level that enables cells to quickly restore their normal status.

We thank the Caenorhabditis Genetics Center for strains; Andrea Carrano, Andrew Dillin, Robert Barstead, Shohei Mitani, Ann M. Rose, Lynn Boyd and Josef Loidl for generous gifts of reagents; and Edward Kipreos and Andy Golden for critical reading of the manuscript.