Table 1.

Sequences of gene-specific primers used for RT-PCR

GeneForward primerReverse primer
AtMSI1 GCACCGCTCTTCACACATTTGTCGATCCTGCTAAGGTCCCAA
AtMSI2 ATTGGCCACAGCTTCCTCAGATTGGAAGACCTCTCCCTCATGG
AtMSI3 TGCGCCATTACATGTCCTGATCCCCAACCCTGTTGATATCC
AtMSI4 ACGAAGGTTGAAAAAGCGCACGATCAAACAACCGGACAGTG
AtMSI5 GGACAAAGTGGTCGACTTCCACCGCCATATCTGCAATGTACC
AG TCGGACAATTCTAACACCGGACCCATCAATTGCCTGTTGG
AP1 TAGGGCTCAACAGGAGCAGTCCACCCATGTTGAGAAAAGG
AP2 ATTTGGGTTTGTTCGACACCATGACTCGGCATTGAGTTCC
AP3 ACCACAACGAAGGAGATCGTCAAGCTCGTCCAAACACTCA
GAPDH╬▒ TTCTTGGCACCAGCTTCAATCTCCCTTGGAAGGAGCTAGG
LFY ACCAAGGTGACGAACCAAGTATTCTGGAGAGCGTAACAGTGAACGTAG
SUP CACCATGGAGCTATGGAGATTTGCCATTGTTGAGTAAGAG
WUS ACAGCATCAGCATCATCATCTTGGCCATACTTCCAGATGG