Table 1.

Expression profile (real-time PCR) of selected genes in Apcp−/− pancreata

Relative fold change (%) in Apcp−/− pancreata
GeneOligonucleotides (5′-3′)E15.52 months8-10 months
Apc TTGGAAGTGTGAAAGCATTGATG AAGGCACTCAAAACGCTTTTGDown 4.3× (23%)Down 21× (5%)Down 15× (7%)
β-cateninCAGATCTTGGACTGGACATTGG AACGGTAGCTGGGATCATCCTUnchangedUnchangedUnchanged
E-cadherin GAGCGTGCCCCAGTATCGT GGCTGCCTTCAGGTTTTCATCUnchangedUnchangedUnchanged
Tcf4 GGCGAGCAGGAGGAGAAGA GGACTTGACATCGGCTAAATCCUnchangedUnchangedUnchanged
Axin2 GAAGGAAAATGAAACCAATTAAGAAGAC CCCCGCCCTCCTGAAGUp 1.4×UnchangedUp 3.5×
c-jun CTGCATGCTATCATTGGCTCAT CCACACCATCTTCTGGTGTACAGUnchangedUp 4.4×Unchanged
c-myc CCTAGTGCTGCATGAGGAGACA CCTCATCTTCTTGCTCTTCTTCAGAUnchangedUp 3.2×Down 2.6× (38%)
Cdk4 CCCACCTCTCCTTACGAGGTT AGAAGACAGATACACCTGCCCTTTAUnchangedUp 2.3×Unchanged
p21 GCAGACCAGCCTGACAGATTTC GGCACTTCAGGGTTTTCTCTTGUnchangedUnchangedUnchanged
cyclin D2CAGAAGGACATCCAACCGTACAT CACTTTTGTTCCTCACAGACCTCTAGUp 1.5×Up 2.8×Unchanged
  • For each gene, forward primers are shown in the first sequence and reverse primers in the second. Expression levels are relative to transcripts in control (ApcloxP/loxP) pancreata, which were calculated using three different housekeeping genes (Materials and methods), and normalized to 1 (100%). Apc transcripts were measured using primers placed at the junction between exon 14 and 15 (floxed). Five animals were used per condition (three at 8-10 months). Real-time RT-PCR reactions were performed in triplicate. P<0.01.