Table 1.

Primer sequences of the JmjC domain-containing genes

GeneAccession No.Primer 1Primer 2Amplicon (bp)
1110034B05Rik NM_001037742TGTGCAGATCTTGGACAGAGCTTCTTGCTGTAGGCTTTGTCTTG114
2410016O06Rik (No66) NM_023633GAGACATTGGGGGTTTTATATGGATACAAACTTAACGCGCAGCAC100
2610003J06Rik NM_028101ACACTCCTCCAGTTCCCTGAGAGGACAACAACCGGTACATGG127
A630082K20Rik (KIAA1718) NM_001033430TGCTAACATCCAAGGTGCATACTGAACATGTTTCCCTGCAAAG126
Fbxl10 (Jhdm1b) NM_001003953ACCTCTCCCTCAGACTTGAGCAGGGTGTGGGCACATTTATTC124
Fbxl11 (Jhdm1a) NM_001001984TTGGAAGTGTGTGTGCATGTGCGTTCAATGCAAAGTCAAAGG147
Hif1an (Fih1) NM_176958TCTGGTCCCTTTGGTACATTTCCCACCCCCACAAGTCATTATAG112
Hr NM_021877ACTGCTTTTGCCTTCCTACCTCAAAAATCCCCAAACCACAGC101
Hspbap1 NM_175111AAGTACTCTGGCTCTGCATGGAACACCACGTGGGTATGTGAG102
Jarid1a XM_359326GCTGAATAAATTGGCCAAGAAGTCTTCTCCGTGCTCTCTTTCAC107
Jarid1b NM_152895GCACCAAGCCGAAAGTAAAAACCCAGTCCTGTAGCTTTGCTGAG100
Jarid1c NM_013668TTTTCCCTTCCCCTTACTGTTCCCAAAAGCCTTCAGACCATAGG123
Jarid1d NM_011419CCATCAATATTCCTGGGACTAGCGTTTTGATGTGTGATTGATGAAGG144
Jarid2 NM_021878TGATGTACCGCTACGATGAGGTTGGTGTGGGTTTGTTGAGAC111
Jmjd1a (Jhdm2a) NM_173001CGTCTGGACAGCTCATTCAAGCACTTCCTCCATTGCTCTTCTG131
Jmjd1b (Jhdm2b) XM_619530ACTCCTCATGTGTGTCCAAACGAAAACTCCACTGAGTTGGAAAGC123
Jmjd1c (Jhdm2c) XM_907708TCTCATTTTGGTAAAATTTATGTGAAGTTGCACTTTAACAAAAGCAAGC131
Jmjd2a NM_172382ACAGGTTCCTGAATTTGTTTGCACAAGGTAATGCACCGGTTTTC150
Jmjd2b NM_172132GAGAGGTCCGGGTTTTTGTGGATACTGAACTGGAGGCCAGAG109
Jmjd2c NM_144787TTGAACACTTCATAATTCCTGTTCTGGGCTGTTTTGCAAAGAAAAATC148
Jmjd2d NM_173433TTGACCGCTAGATTACTCCTCACTGTGAAAGCTGGGTGAGACAC118
Jmjd3 NM_001017426TACGTCCTGCACTTTCTTGGACCAGTTCCCACTTCTTCCCCTAC103
Jmjd4 NM_178659GGCCAGCAACTTAATTTACCTCGGCATAGTGGCATGTGTGTATC130
Jmjd5 NM_029842TGGCTCTACTCCAGCTGTTCTCGTTACATATGGGGCAAGTGGAC107
Mina NM_025910TTGAGCATACATGACCCCTTTCTCTGGCTCTTCTGTCATCTTCC135
Phf2 NM_011078TTATCCACTCCCACTTGACCTGCAAGGACAGGGTCAAGGAAAAC131
Phf8 NM_177201TAAAAACAAACCCACCGCTTCACAAGGGGAACAAACAACAGAG139
Pla2g4b XM_355378TTCTGGTGTGCCTGAAGATAGCAACTCAGGACCTTTGGAAGAGC133
Ptdsr (Jmjd6) NM_033398GACACCCAGAGAACAAGGACACGTTTCATTGGCACCATCCAC111
Utx NM_009483AGCCTAGCTGGTCATTTCTTTGAACAAGACAGAAATTCATAAAAGCAG129
Uty NM_009484GGCATGGGAGGATAAATGATGTCGTGCACAGTTCTGACAATG134
  • Sequences are shown 5′ to 3′.