Characterization of Nfatc1 regulation identifies an enhancer required for gene expression that is specific to pro-valve endocardial cells in the developing heart

Previous studies suggest that pro-valve endocardial cells (endocardial cells lining of developing cardiac valve) are a unique subpopulation of endocardial cells with a distinct developmental potential(Wunsch et al., 1994). During embryogenesis and in response to local myocardial cues, endocardial cells in the cardiac outflow tract (OFT) and atrioventricular canal (AVC) undergo an endocardial-to-mesenchymal transformation (EMT), a morphogenic process required for cardiac valve formation and chamber septation(Barnett and Desgrosellier,2003; Eisenberg and Markwald,1995; Schroeder et al.,2003). Despite this, little is known about the molecular mechanisms that establish this unique pro-valve endocardial subpopulation during cardiac ontogeny in vivo.

Members of the nuclear factors of activated T cell (Nfat) family, which mediate transcriptional responses of the Ca²⁺/calmodulin-dependent protein phosphatase calcineurin, have been implicated in cardiovascular development (Bushdid et al.,2003; Graef et al.,2001) and cardiac hypertrophy(Antos et al., 2002; Molkentin et al., 1998; Wilkins et al., 2002). Nfatc3 and Nfatc4 are involved in the development of normal myocardium(Bushdid et al., 2003), and patterning the vasculature in early mouse embryos(Graef et al., 2001). Nfatc3 is also required for cardiac hypertrophic response in vivo(Wilkins et al., 2002). We and others have studied the function of Nfatc1, in the mouse by genetic inactivation, and have found that it is required for cardiac valve formation(de la Pompa et al., 1998; Ranger et al., 1998). Consistent with a function in formation of these endocardial-derived structures, Nfatc1 is exclusively expressed in the endocardium from the initiation of endocardial differentiation in the primary heart-forming field. Subsequently, there is accentuation and sustained expression in pro-valve endocardial cells during EMT and early valve formation followed by rapid attenuation at the initiation of valve leaflet remodeling(Chang et al., 2004; de la Pompa et al., 1998). Nfatc1 is thus a cell-type-specific transcription factor prevalent in pro-valve endocardial cells and represents a unique candidate for delineating the molecular control of endocardial gene transcription during EMT and cardiac valve development.

In this study, we report the identification and characterization of an autonomous cell-specific transcriptional enhancer for pro-valve endocardial cells. Located in the first intron of the mouse Nfatc1, this 250 bp enhancer sequence contains a cluster of Nfat sites and a single Hox site,which are required for gene expression exclusively in pro-valve endocardial cells of the OFT and AVC during valvulogenesis. We demonstrate that autoregulation of Nfatc1 is essential for maintaining the enhancer activity in pro-valve endocardial cells, while the Hox site is required for suppressing its activity in tissues outside of pro-valve endocardium. Our study suggests that this dual regulation provides a molecular mechanism for restricted and high level expression of Nfatc1 in pro-valve endocardial cells, where Nfatc1 is essential for cardiac valve development.

The mouse bacterial artificial chromosome (BAC) clone containing the murine Nfatc1 was isolated from a 129/SvJ BAC library(Zhou et al., 2002). In vivo lacZ promoter reporter constructs were based on pWhere (Invivogen). The promoter reporter construct NX-lacZ consists of a 6.3 kb NheI-XhoI P1 promoter of the murine Nfatc1(Zhou et al., 2002), and XS-lacZ contains a 4.5-kb XhoI-SacII intronic P2 promoter,starting 76 nucleotides downstream of the 3′ end of exon 1 and ending 77 nucleotides into exon 2 (Fig. 2A). The enhancer reporter constructs used a heat-shock protein minimal promoter, HSP68, which, by itself, does not produce detectable activity in vivo. The parent enhancer reporter construct,BB-HSP-lacZ, contained a 4.1 kb BssHII-BssHII intron 1 fragment, starting 214 nucleotides downstream of the 3′ end of exon 1 and ending 199 nucleotides upstream of the 5′ end of exon 2(Fig. 2A). Serial 5′deletions of BB-HSP-lacZ were achieved by insertion of PCR-amplified DNA fragments into the pWhere-HSP vector, yielding an additional seven constructs, named d1 to d7 (Fig. 4A-C). For mutation constructs, a PCR-based mutagenesis was performed as described before (Zhou et al., 1998). Individual mutation of core nucleotides for Gata, or Hox- or Smad-binding sites, was introduced into the conserved putative cis-enhancing elements in d5 construct. All mutations were confirmed by sequence analysis.

Transgenic fragments were separated from the plasmid vector by electrophoresis of PacI-digested plasmid and purified using Qiaex II(Quiagen). The purified DNA fragments were dissolved in the injection buffer(10 mM Tris HCl, pH 7.5 and 0.1 mM EDTA) at a concentration of 2.5 μg/ml. DNA was then injected into the pronucleus of 0.5-day-old fertilized C57BL/6 eggs and the eggs were transferred into the oviducts of ICR pseudo-pregnant foster females. Embryos were harvested, stained with X-gal to detectβ-galactosidase activity and yolk sacs were processed for PCR genotyping. Transgenic lines were established by breeding B6D2F1 mice with PCR-positive founders, and embryos were harvested at embryonic day (E) E8.5 to 14.5.

Embryos were collected in PBS, fixed in 4% paraformaldehyde, and stained in X-gal solution overnight at 30°C. The stained embryos were cleared in a gradient of glycerol and photographed in 100% glycerol with a dissecting photomicroscope. Whole-mount-stained embryos were then processed for sectional examination. For sections, stained embryos were post-fixed with 4%paraformaldehyde, dehydrated in ethanol, cleared in xylene and embedded in paraffin. Continuous cross-sections of 6 μm thickness were cut,counterstained with Eosin and mounted in Permount.

We isolated and established primary embryonic endocardial cell cultures from E11.5 hearts using a magnet-based antibody affinity protocol(Marelli-Berg et al., 2000). Briefly, hearts (without large arteries and surrounding tissues) of E11.5 embryos from 10 pregnant ICR animals were dissected and digested with collagenase (Sigma). Single cell suspensions in PBS plus 2% FBS were incubated with anti-Pecam1 and anti-endoglin monoclonal antibodies, and biotinylated-isolectin B-4. Endocardial cells were then isolated using magnetic bead-conjugated secondary antibodies and magnetic bead-conjugated avidin, seeded into one-well of a 24-well plate with irradiated OP9 feeder cells, and cultured with M199 plus 20% FBS for a week. Confluent cells were then split into one gelatinized well of a 12-well plate without feeders. Using this method, we obtained enriched (>80% pure) endocardial cell cultures determined by their nuclear presence of Nfatc1. These cells express various endothelial markers including Pecam1/CD31, Tie2, endoglin/CD105 and VE-cadherin, and maintain their endocardial phenotype and morphology over 10-15 passages (one to four splits per passage).

Preparation of nuclear extracts from primary cultured endocardial cells and subsequent EMSA were performed as described before(Zhou et al., 2002). ChIP assays were carried out using commercially available reagents and protocol from Upstate (Lake Placid, NY) and monoclonal anti-Nfatc1 specific antibodies(7A6) according to manufacturer's protocol. The primer sets for PCR amplification include: 5′ ChIP primer (5′ GGAGAAAAGCAGCCATTGAAAC 3′) and 3′ ChIP primer (5′ CTGAGTAGGTGCTGGGTGTGAC 3′),which give a 404 bp DNA product containing two conserved regions with multiple Nfat sites; and 5′ control primer (5′ GGCCAGGAGCGACGCGGACGAAG 3′) and 3′ control primer (5′ GAGAAAATGAAAGACAGCAAGATAG 3′), which generate a 426 bp product without consensus Nfat sites.

Two Nfatc1 promoters, P1 and P2, have been described, which in the mouse T cells direct the synthesis of Nfatc1.α and Nfatc1.β isoforms,respectively. To investigate the function of the P1 and P2 promoters in the developing heart, we cloned two DNA fragments, a 6.3 kb NheI-XhoI P1 promoter region and a 4.5 kb XhoI-SacII P2 promoter region(Fig. 1A). Using an RT-PCR strategy with a set of three isoform-specific primers(Fig. 1B), we observed the presence of both isoforms in cultured primary E11.5 endocardial cells. However, consistent with the previous report that the P1 promoter activity accounts for over 90% Nfatc1 transcripts in T cells(Chuvpilo et al., 2002),Nfatc1.α was abundant in the endocardial cells as its transcripts were easily detected with a 35-cycle of amplification while the transcripts of Nfatc1.β regulated by the P2 promoter were barely detected using 40 cycles of amplification. Similar findings were obtained from mRNA isolated from E11.5 embryonic hearts (data not shown).

We next examined whether the 6.3-kb NheI-XhoI P1 promoter contains the essential regulatory elements required for endocardial-specific expression in vivo (Fig. 2A). Although the 6.3-kb NheI-XhoI P1 promoter was able to drive accentuated endothelial-specific gene expression in vitro (data not shown),our transient transgenic analysis in mouse demonstrated that the NX-lacZ reporter with the 6.3-kb NheI-XhoI P1 promoter was unable to confer detectable endocardial expression in vivo(Fig. 2B). We also examined the 4.5 kb XhoI-SacII P2 promoter in transient transgenic experiments (Fig. 2A). Consistent with the RT-PCR results (Fig. 1C), which indicated that the P2 region is at best a weak promoter, the XS-lacZ reporter with the 4.5 kb XhoI-SacII P2 promoter failed to drive endocardial gene expression (data not shown).

Finding that the Nfatc1.α is the major transcript detected in the endocardium during embryogenesis but that the P1 promoter and its upstream sequences were insufficient to drive detectable endocardial expression, we reasoned that enhancers outside the NheI-XhoI fragment must contribute to P1 activation. In scanning the mouse Nfatc1 locus for the putative enhancers, we observed that four out of eight conserved domains(mouse/human) in the 10.8 kb NheI-SacII fragment were located within intron 1, proximal to the P2 minimal promoter. Therefore, a 4.1 kb BssHII-BssHII fragment, without the P2 minimal promoter,was tested for the enhancer activity using the HSP68 promoter, and the enhancer reporter was named BB-HSP-lacZ(Fig. 2A). When this construct was used to produce transgenic embryos, X-gal staining revealed strongβ-galactosidase activity in the endocardial lumen of atrioventricular canal (AVC) (arrowhead) and outflow tract (OFT) (arrow) of the heart(Fig. 2B). Nine out of 10 X-gal stained transient transgenic embryos exhibited endocardial-specific expression with no staining in the myocardium or in the endothelium outside the heart(Fig. 2C).

Further transient transgenic analysis indicated that this endocardial-enhancer activity was detectable at E9.5 by whole-mount X-gal staining (Fig. 3A),highlighting the lumen of AVC (arrowhead), and marking the proximal OFT (the broken line indicates the border of the distal and the proximal OFT). Sectioning of the whole-mount-stained E10.5 embryos confirmed the endocardial specificity of this enhancer (Fig. 3B). Importantly, the enhancer was only activated in the pro-valve endocardial cells that overlie the forming endocardial cushions in the AVC(arrowhead) and the proximal OFT (arrow). The enhancer activity was not found in those transformed endocardial cells that were invading the extracellular matrix-rich endocardial cushions. By E11.5(Fig. 3C), the endocardial activity of the enhancer was persistent in the AVC (arrowhead) and extended from the proximal to distal part of the OFT (arrow), but was continuously inactivated in the mesenchymal cushion cells derived from transformed endocardial cells.

To confirm the finding of transient transgenic analysis and to study in detail the temporal and spatial activity of this endocardial-enhancer, four independent transgenic mouse lines were established with the BB-HSP-lacZ reporter construct. Fig. 4 shows representative findings of endocardial enhancer reporter activity during cardiogenesis. Expression was first detectable at E8.5(Fig. 4A), where lacZ expression was observed in few isolated cells located at the ventricular entrance of the AVC (arrowheads). By E9.5(Fig. 4B), well-defined endocardial-specific expression of lacZ was seen in the AVC of whole-mount-stained embryos (arrowhead). At E10.5(Fig. 4C), lacZexpression extended into the proximal region of OFT (arrow). At E11.5(Fig. 4D),β-galactosidase-positive endocardial cells were evident in the septating OFT (arrow) and AVC (arrowhead), with expression accentuated at the proximal ventricular region of the forming aortic and pulmonary trunk as well as at the ventricular ends of AVC. By E12.5 (Fig. 4E), the endocardial staining was intensified in the newly septated OFT and AVC, as well as the valvulogenic areas. Sectioning of whole-mount-stained embryos indicated that the enhancer is initially activated, between E8.5 or E9.5, in the endocardial cells of the AVC and OFT(Fig. 4F,G); and that its activity increases reaching maximal expression at E12.5 in the endocardial cells lining AVC and recently separated OFT (aortic and pulmonary outlets)(Fig. 4H). In particular,activity was concentrated in those endocardial cells of the forming cardiac valves, marking only the pro-valve endocardium at the endocardial-endothelial junction of ventricular outlets and distal arterial root(Fig. 4I). By E14.5 when the remodeled endocardial cushions begin to assume the morphology of discrete valve leaflets, the enhancer activity was significantly diminished and detectable only in a few endocardial cells lining the newly formed valve leaflets (Fig. 4J).

Comparative sequence analysis of the first intron of the mouse and the human revealed that, in addition to the conservation of the proximal (core) P2 promoter region, there were two distal highly conserved regions located in the 4.1-kb BssHII-BssHII intron 1 fragment(Fig. 5A). Furthermore, a 211 bp pyrimidine-rich stretch and 10 copies of a CTTTT repeat were found in this intron fragment. Using PCR cloning, nucleotide sequences in this P2 fragment essential for endocardial-specific expression were determined by systematic and sequential removal of these unique sequences to produce deletions of the BB-HSP-lacZ reporter construct, named d1-d7(Fig. 5A). Analysis of this series of deletion constructs by transient mouse transgenesis and whole-mount staining of E11.5 embryos demonstrated that constructs d1-d5 were able to confer endocardial-specific expression identical to that of the parent BB-HSP-lacZ reporter (Fig. 5B). Thus, the d5 deletion construct containing a 1.5 kb 3′end sequence of intron 1 is sufficient for the endocardial-specific expression. Removal of 781 bp sequence between the 200 bp conserved region and CTTTT repeats completely abolished this endocardial-specific activity,indicating the d6 sequence with the CTTTT-repeats alone is insufficient for the endocardial gene expression. The endocardial specificity of the d5 construct was verified by cross-sectional examination of the whole-mount-stained embryos (Fig. 5C). At the single cell level of resolution, the expression of lacZ is exclusively restricted to the endocardial cells in the OFT(arrow) and AVC (arrowhead). β-Galactosidase activity is extinguished in those cells that have undergone mesenchymal transformation and invaded the matrix-rich cushions, and no β-galactosidase activity was found in the endothelial cells outside of the heart. These data clearly demonstrated that a crucial enhancer sequence for the pro-valve endocardial cells is located within the 781 bp region.

Together, the data revealed that transcription of Nfatc1 in the pro-valve endocardium is positively regulated by cis-acting elements located in the 781 bp intron 1 sequence (Fig. 6A). To further determine whether this region was sufficient, in isolation, to direct pro-valve endocardial-specific expression, the 781 bp sequence was cloned into the pWhere-HSP reporter and the construct was named ECE(endocardial cell enhancer)-HSP-lacZ(Fig. 6B). An additional construct (ECEΔ-HSP-lacZ) was generated by PCR cloning to remove 250 bp of 5′ end sequence that contained two short conserved domains, ECE1 and ECE2, harboring a cluster of putative transcriptional binding sites (Fig. 6A). The pro-valve endocardial enhancer activity of these constructs was then evaluated in transient transgenic analysis. Whole-mount-stained E11.5 embryos(Fig. 6C,D) and hearts(Fig. 6E,F) with the ECE-HSP-lacZ construct demonstrated the expression of lacZreporter at the lumen of both OFT (Fig. 6, arrowhead) and AVC (Fig. 6, arrow) region. Thus, the 781 bp ECE was sufficient for pro-valve endocardial-specific expression, and functioned as an autonomous tissue-specific enhancer. Deletion of the 250 bp sequence containing ECE1 and ECE2 completely abolished activity (data not shown), indicating that a crucial cis-enhancer element(s) is contained in this 250 bp sequence.

The presence of multiple Nfat sites in ECE1 and ECE2 of the 250 bp sequence prompted us to examine whether Nfatc1 expression is required for activation of the enhancer as previously described for its P1 promoter in T cells(Chuvpilo et al., 2002; Zhou et al., 2002). We therefore crossed the BB-HSP-lacZ transgenic reporter line into the previously described Nfatc1-null mutant mouse line(Ranger et al., 1998). We found that, in both whole-mount E11.5 embryos and cross-sections(Fig. 7), there was a consistent reduction or absence of endocardial gene expression in both OFT(arrow) and AVC (arrowhead) of Nfatc1-null embryos(Fig. 7D-F) compared with their heterozygous littermates (Fig. 7A-C).

We further analyzed whether Nfatc1-dependent expression was dependent on a direct interaction of Nfatc1 and the Nfat sites in ECE1 and ECE2 in situ. This required that we develop a new primary embryonic endocardial cell culture from E11.5 embryos as isolation of a sufficient number of endocardial cells directly from wild-type and Nfatc1-null mutant embryos was not technically feasible. As shown in Fig. 8,these primary endocardial cells (ECCs) have a uniform endothelial-like morphology and express nuclear localized Nfatc1(Fig. 8A), as well as multiple endothelial cell markers, such as Tie2, Pecam1/CD31, endoglin/CD105 and VE-cadherin (data not shown). We then performed EMSA analysis using nuclear extracts prepared from these primary ECCs. Three oligonucleotide probes (N1,N2 and N3) were generated with or without the deletion of core dinucleotides,GG or CC, that are characteristic of the Nfat-binding site; mutated probes were named N1Δ, N2Δ1, N2Δ2 and N3Δ(Fig. 8B). EMSA showed that protein-DNA binding complexes formed using N1 or N2(Fig. 8C, arrow) but not N3 probe (data not shown). Importantly, mutation of any Nfat site in N1 or N2 greatly abolished formation of Nfatc1-DNA complexes, suggesting that these Nfat sites are functional in situ. We then performed ChIP assays with chromatin prepared from cultured wild-type or Nfatc1-null endocardial cells in which the Rel-homology DNA-binding domain has been deleted(Ranger et al., 1998). A set of primers (Fig. 8B, arrow)encompassing ECE1 and ECE2 were used to amplify chromatin pulled down by the anti-Nfatc1-specific monoclonal antibody 7A6. The results demonstrate that Nfatc1 binds to this DNA fragment in situ(Fig. 8D), whereas controls using either no antibody or chromatin from Nfatc1-null endocardial cells showed no product after PCR amplification. In addition, irrelevant primers that flank a non-Nfat site fragment DNA did not produce a PCR product (data not shown). Together, these data suggest that Nfatc1 expression is autoregulated during valve formation by interaction of Nfatc1 and the 250 bp Nfat site-rich region.

To determine the function of other transcription factor-binding sites adjacent to the Nfat sites, constructs containing deletion of core nucleotides for Gata, Hox and Smad sites were used in transient transgenic assays. Although mutation of the Gata and Smad sites did not alter the specificity of in vivo lacZ expression (data not shown), mutation of the Hox site resulted in activation of the enhancer in endocardial cells outside of the valve forming region or non pro-valve endocardial cell and vascular bed outside of the heart (Fig. 9). In whole-mount-stained E11.5 and E12.5 embryos, activity of the enhancer was readily observed in umbilical cord, intersomitic(Fig. 9A, arrows) and head vasculature (Fig. 9C). Sectional analysis confirmed that the enhancer is activated in the endothelium of peripheral vasculature, such as in the head(Fig. 9C, inset), and endothelial cells of ductus venous of E12.5(Fig. 9F, arrow) and E11.5 embryos (Fig. 9H, arrowhead in inset). Within the heart, aberrant enhancer activity was observed in the endocardial cells of the trabeculated ventricular outlet in E12.5(Fig. 9E, arrowhead in the inset) and E11.5 hearts (Fig. 9G, marked by a star), and sinus venous valves(Fig. 9H, arrow). The dysregulated enhancer activity was also observed in the cushion mesenchymal cells (Fig. 9E, inset). In addition to its abnormal non pro-valve endocardial activity, activity of the mutated enhancer appeared to be increased in the pro-valve endocardial cells(Fig. 9B,D, arrowheads),although the transient transgenic approach did not allow us to compare relative activity between the wild-type and mutated enhancer. Thus, these data suggested that the Hox site is required for maintaining the pro-valve endocardial specificity of the enhancer by suppression of its activity in non pro-valve endocardial tissues.

The results of this study offer an initial elucidation of how endocardial-specific gene expression can be achieved during valvulogenesis and cardiac septation. We demonstrate that a sequence of 781 bp within the first intron of the murine Nfatc1 functions as an autonomous cell-specific enhancer to direct strong and highly specific expression in pro-valve endocardium during cardiac development in vivo. Activation of this enhancer element is only observed in the endocardial cells of the AVC and OFT. It is not detected during initial differentiation of the endocardium from the mesoderm in the E7.5 embryo, nor does it drive expression in the transformed endocardial cells at the time when the endocardial cushions are forming and subsequently remodeled into cardiac valves.

It has been shown that mesenchymal cushion formation results at least partially from EMT within the heart tube as a consequence of interaction between both localized myocardial cues and adjacent endocardial responsiveness(Eisenberg and Markwald, 1995; Markwald et al., 1996). Tgfβ/Bmp signaling pathways appear to modulate this myocardial-endocardial interaction in both the avian and mouse embryos(Boyer et al., 1999; Brown et al., 1999). Yet, the transcriptional circuitry that governs the phenotypic changes of these specialized endocardial cells during EMT and later valvulogenesis has not been extensively studied. The enhancer described in our studies could function as a`genetic switch' that turns on and later turns off Nfatc1 expression in response to signals elicited, presumably, from myocardium of the endocardial cushions. Identification of this endocardial enhancer thus provides a novel genetic marker for the unique pro-valve endocardial cells. It may also serve as a genetic readout for the inducible myocardial cues allowing the nature of such signals to be deduced.

Scanning of the 250 bp necessary endocardial enhancer sequence reveals binding sites for several transcription factors, including Smad, Gata and Nfat, which mediate signals known to be involved in regulating EMT and/or later valve formation. We and others have shown an autoregulation of Nfatc1 expression in T cells in the adult animal through the Nfat sites in its P1 promoter (Chuvpilo et al.,2002; Zhou et al.,2002). The sustained high expression of nuclear activated Nfatc1 in endocardium during cardiac valve formation suggests that a similar autoregulatory paradigm may also operate for Nfatc1 expression in the developing endocardium. Consistent with this notion, there are five consensus Nfat sites located in the 250 bp sequence necessary for the endocardial enhancer activity in vivo, and four of them are nested in the two conserved ECEs. We demonstrated, using a genetic approach, that Nfatc1 expression is required for maintaining the activity of the endocardial enhancer. We also determined, using EMSA and ChIP assays, that this Nfatc1-dependent enhancer activity is probably the direct result of interaction of Nfatc1 with one or more Nfat sites in the 250 bp sequence.

Tgfβ/Bmp-Smad pathways play a prominent role during EMT. Both in vitro and in vivo studies have indicated that ligands of Tgfβ/Bmp receptors are strong inducers or positive regulators of EMT, and are essential for later morphogenesis of cardiac valves. However, the nuclear events or targets of Tgf/Bmp activation in the endocardial cells are not fully characterized. Recently, Gata transcription factors have emerged as another cohort of important regulators of EMT. Disruption of Gata4 interaction with its co-factor, Fog2, by a `knock-in' mutation (Gata4^KI/KI)(Crispino et al., 2001) or endothelial-specific deletion of Gata co-factor, Fog1, result in both OFT and AVC defects (Katz et al.,2003). Furthermore, in vitro data suggest that an interaction between Gata5 and Nfatc1 may be important for endocardial cell differentiation(Nemer and Nemer, 2002). In our study, we found that binding sites of Gata and Smad factors in the conserved enhancer region are not essential for the specificity of the enhancer, although we could not rule out their effect on the level of enhancer activity.

By contrast, the Hox site was found to be required for maintaining the specificity of the enhancer by suppressing its activity outside the pro-valve endocardial cells. Thus, the intact Hox-binding site represents a negative cis-element where its interaction with its binding factors in non pro-valve endocardial tissues is probably required for limiting Nfatc1 expression outside of the pro-valve endocardial cells. Hox factors consist of a large number of homeobox transcription proteins and the binding site for these factors is relatively diversified, and thus less defined when compared with the Nfat site. We do not know which Hox factor plays a role in suppression of the enhancer activity outside the pro-valve endocardial cells, such as endocardial cells of ventricular trabeculae and transformed endocardial cells. In the developing heart, Msx1, previously known as Hox7, is expressed in the developing endocardium (Lyons et al.,1992; Robert et al.,1989), while a closely related gene, Msx2, is highly expressed in the cushion cells that are transformed from endocardial cells(Abdelwahid et al., 2001). In addition, other homeobox genes, iroquois 5 and iroquois 6, are only expressed in the E11.5 endocardial cells lining the trabeculated myocardium(Christoffels et al., 2000). Whether any or all of these factors are upstream regulators of this enhancer is currently under investigation.

In summary, mesenchymalization of the endocardial cushions by EMT, and the later remodeling of the cushions into the mature valves and septa are crucial morphogenic processes susceptible to environment and genetic alterations that result in common congenital heart diseases. These processes must require the coordinated regulation of several signaling pathways. Our data provide initial in vivo identification and characterization of a crucial enhancer required for cell-specific autoregulation of Nfatc1 expression in the pro-valve endocardial cells as well as suppression of its expression in those non-valve endocardial cells. This work should facilitate further delineation of how multiple signals are integrated at the transcriptional level to orchestrate valvulogenesis and should provide valuable in vivo models to specifically investigate gene function in pro-valve endocardium required for normal cardiac valve formation.

We thank Dr. M. A. Brown for providing the mouse Nfatc1.β plasmid, and Drs P. Robson and S. Brandt for critical reading and helpful discussion. This work was supported by a Scientist Development Grant from American Heart Association (B.Z.) and funding from the National Institute of Health(H.S.B.).