Table 1.

Primers and conditions used for real-time RT-PCR

GeneReferencePrimer sequences (upstream/downstream)Melting temperature (°C)Annealing temperature (°C)/time (seconds)Extension temperature (°C)/time (seconds)Acquisition temperatures (°C)/time (seconds)
Activin BKofron et al. (1999)5′ CAACCTGTGGCTGTACCTGAAG 3′9555/572/1486/3
5′ GCACTCGAGGCCTCTCTTACGGA 3′
CerberusDarras et al. (1997)5′ GCTTGCAAAACCTTGCCCTT 3′9560/572/2081/3
5′ CTGATGGAACAGAGATCTTG 3′
ChordinKofron et al. (1999)5′ AACTGCCAGGACTGGATGGT 3′9555/572/1281/3
5′ GGCAGGATTTAGAGTTGCTTC 3′
DerSun et al. (1999)5′ TGGCAGAGTTGTGGCTATCA 3′9555/572/1882/3
5′ CTATGGCTGCTATGGTTCCTT 3′
GscThis paper5′ TGGCAAGGAGGGTTCATCTCAGAG 3′9558/572/878/3
5′ ATCCAGCTATCCCAATGTGCAAGT 3′
ODCHeasman et al. (2000)5′ GCCATTGTGAAGACTCTCTCCAATC 3′9555/572/1282/3
5′ TTCGGGTGATTCCTTGCCAC 3′
XbraKofron et al. (1999)5′ TTCTGAAGGTGAGCATGTCG 3′9555/572/875/3
5′ GTTTGACTTTGCTAAAAGAGACAGG 3′
XhexChang and Hemmati-Brivanlou (2000)5′ AACAGCGCATCTAATGGGAC 3′9560/572/1387/3
5′ CCTTTCCGCTTGTGCAGAGG 3′
XnotThis paper5′ ATACATGGTTGGCACTGA 3′9550/572/872/3
5′ CTCCTACAGTTCCACATC 3′
Xnr1Kofron et al. (1999)5′ TGGCCAGATAGAGTAGAG 3′9555/572/1281/3
5′ TCCAACGGTTCTCACTTT 3′
Xnr2Kofron et al. (1999)5′ GTCTTCTATATCCAGCAGCAAT 3′9555/572/1181/3
5′ TTGATGGAGATAATACTGGAGC 3′
Xnr4Kofron et al. (1999)5′ ACTTGGCTGCTCTACCTC 3′9555/572/1282/3
5′ CAGCAAGTTGATGTTCTTCC 3′
Xnr5This paper5′ TCCATTGTTACTCCAGGTTCC 3′9555/572/1281/3
5′ AAGCCGCTTCTTATGATGC 3′
Xnr6This paper5′ CAATGAGTTGAATTTGGCTGAG 3′9555/572/1281/3
5′ GTTTGTCTTTAGCGAACACCAC 3′
Xvent1This paper5′ TGGTTCAACAGGGATTCTC 3′9554/572/880/3
5′ CTGCTAAGGAAGGATTTGC 3′
Xwnt8Ding et al. (1998)5′ CTGATGCCTTCAGTTCTGTGG 3′9558/672/1485/3
5′ CTACCTGTTTGCATTGCTCGC 3′