Table 1.

Primers used and PCR conditions

GeneForwardReverseProduct size (bp)Taq polymerase usedAnnealing temperature (°C)Cycle number
Rex1 CGTGTAACATACACCATCCGGAAATCCTCTTCCAGAATGG129ProMega6035
Fgf5 AAAGTCAATGGCTCCCACGAACTTCAGTCTGTACTTCACTGG465ProMega6035
Pax6 GCTTCATCCGAGTCTTCTCCGTTAGCCATC TTGCTTGGGAAATCCG312platinum6030
Wnt1 GATTGCGAAGATGAACGCTGTTTCTCCTCCACGAACCTGTTGACGG266ProMega5540
Neurod1 CTTGGCCAAGAACTACATCTGGGGAGTAGGGATGCACCGGGAA209ProMega6035
Foxa2 TGGTCACTGGGGACAAGGGAAGCAACAACAGCAATAGAGAAC289ProMega6035
Tcf1 CGAAGATGGTCAAGTCGTACGGCAAACCAGTTGTAGACAC461ProMega6035
Hnf4 ACACGTCCCCATCTGAAGGTGCTTCCTTCTTCATGCCAGCCC270ProMega6035
BrachyuryCATGTACTCTTTCTTGCTGGGGTCTCGGGAAAGCAGTGGC313ProMega6035
Gata1 CATTGGCCCCTTGTGAGGCCAGAGAACCTGATGGAGCTTGAAATAGAGGC289ProMega6035
Csf1r GCGATGTGTGAGCAATGGCAGTAGACCGTTTTGCGTAAGACCTG341ProMega6035
Sox17 GCCAAAGACGAACGCAAGCGGTTCATGCGCTTCACCTGCTTG211platinum6035
Afp GCTCACACCAAAGCGTCAACCCTGTGAACTCTGGTATCAG410platinum6040
Alb1 GCTACGGCACAGTGCTTGCAGGATTGCAGACAGATAGTC266ProMega6035
Hhex AGTGGCTTCGGAGGCCCTCTGTACGCCGGATCCTGACTGTCATCCAGCATTAA540ProMega6035
Ttr AGTCCTGGATGCTGTCCGAGTTCCTGAGCTGCTAACACGG440ProMega6035
Aat AATGGAAGAAGCCATTCGATAAGACTGTAGCTGCTGCAGC484ProMega5535
Tat ACCTTCAATCCCATCCGATCCCGACTGGATAGGTAG205ProMega5535
Cps1 ATGACGAGGATTTTGACAGCCTTCACAGAAAGGAGCCTGA126ProMega6035
Ipf1 CCACCCCAGTTTACAAGCTCTGTAGGCAGTACGGGTCCTC325platinum6035
Mixl1 GCACGTCGTTCAGCTCGGAGCAGCAGTCATGCTGGGATCCGGAACGTGG305ProMega6035
Kdr CACCTGGCACTCTCCACCTTCGATTTCATCCCACTACCGAAAG239ProMega6035
Myf5 GAAGGCTCCTGTATCCCCTCACGTTCTCCACCTGTTCCCTCAGC384ProMega6035
Skeletal actinTTATCGGTATGGAGTCTGCGGGCACAGCACGATTGTCGATTGTGG393platinum6035
Sftpc CATCGTTGTGTATGACTACCAGAGGAATCGGACTCGGAACCAGTATC207platinum6035
β-ActinATGAAGATCCTGACCGAGCGTACTTGCGCTCAGGAGGAGC443ProMega6025