Table 1.

Primer and probe sequences

GeneForwardReverseNote
Real-time PCR assays
Ankrd1 CAGTTGTAGAGAAATTCCTGTCAGACAGTGGAGTGCCGTCCGTTTATSybr Green
Erbb3 TAGACGTCAATGGTGCAGATCTGTAGACGTCAATGGTGCAGATCTGSybr Green, mouse
Erbb3 GTGGCACTCAGGGAGCATTTATCTGGGACTGGGGAAAAGGSybr Green, human
Gapdh Proprietary taqman assay from Applied BiosystemsTaqman
Gata2 GGCAGTGGCCCTGTGATCCGAAGCTTGGGACACTTTTTATGSybr Green
Igf1 ACAGGCTATGGCTCCAGCATGCTCCGGAAGCAACACTCATSybr Green
Nrp2 ACGTGGCATTTGGGCATTGAGCATCCCCAGCATGTTGSybr Green
Pdga GGTCCACCACCGCAGTGTCCTGGACCTCTTTCAATTTTGGSybr Green
Plxc1 AGATGACCACTGCCACTTGATTCCTTTGAACTTGTGTTTCCCTCGATSybr Green
Sgk3 TGCCTGGGCGCTGTTCAGCAACATCTCGGCAGTAAAAAGSybr Green
Thbs1 CCTCAAGAAAATGCAGTTTTCAAAAAACCCAAGGAACTCTTCATGGTSybr Green
Tnc TCCCCAAGAGAATTTACAGCTACAGGAGGTATCCAGTGACCGATGCTSybr Green
Vcam1 CGTCGCGAGGTTGTTTAGAGTACAGTCCAAGCAACACTCTCTGATTSybr Green
In situ hybridization probes
Bmp2 AACTAGAAGCCGTGGAGGAACTTCCATTGTGGAGGGCTGCGGGTGTCGTTAGPCR template
Cdh5 ACAACCATGACAACACCGCCAACAATCCAGGTTGCAATGAGGTTGGGTPCR template
Erbb3 BE947142EST template
Gata4 exon 2195-981 of accession AB075549PCR template
HRT1 A1316788EST template
Nfatc1 TGGTGGTTGAGATACCACCTTTCCTAGAAGCGTCACCATGAGGACAACPCR template
Nkx2-5 (Tanaka et al., 1999)
Notch1 AW047868EST template
Nppa (Tanaka et al., 1999)
Pecam CCAACAGAGCCAGCAGTATGAGGACCAGCACCCCCCGAAACACAAGGAAGATAGGPCR template
Plxnc1 BE981975EST template
Snail CAAACCCACTCGGATGTGAAGAGAGTGAAACAGGTGTCACCAGGACAAPCR template
Tbx2 (Bruneau et al., 2001)
Tgfb2 (Pelton et al., 1989)
Thbs1 AW122997EST template
Primers for amplifying Erbb3 promoter and intronic enhancer homology arms
Prom 5′ armGCGGTACCGAGAAAGCCTGTTGACTTGAGTTCCATCGGCTCGAGACTAGTCACCATATCCGGCTCTCCTGCTAC
Prom 3′ armGGACTAGTCCTAATCGCTGGCTGTTCAGGTGGGACCATGGTACCTGCCTGAGAGTTGCCCATC
Enh 5′ armGCGGTACCGCTCCCTTCACCCTCCACTGTAATCGGCTCGAGACTAGTCAGAACCCAAACTCCTTGCCCAGG
Enh 3′ armGGACTAGTCCTGGATAGAATTGCTTCATTGTGGGCTCGAGAACATTTACCCTCTCCTCCTCAACGG
Site-directed mutagenesis
Prom topATCTCCTCTTAACCGTCTCCGGGGGAAAT
Prom botATTTCCCCCGGAGACGGTTAAGAGGAGAT
Enh m1 topCTTAGCTCCTCCCCTAGATGAGGAGAAGGGTTG
Enh m1 botCAACCCTTCTCCTCATCTAGGGGAGGAGCTAAG
Enh m2 topGGAGGCCACCAGTTCCTTAGAATCCAGCTTTAAAGACAAAG
Enh m2 botCTTTGTCTTTAAAGCTGGATTCTAAGGAACTGGTGGCCTCC