Table 1.

Primer pairs used for quantitative real-time PCR

GeneGenBank Accession numberPrimerPrimer sequence (5′→3′)Amplicon size (bp)
Jag1 AF171092ForwardCACTTATTGCTGCGGTTGCA51
ReverseTTTTCAGAGGACGCCTCTGAAC
Lfng U94351ForwardCCACCCTCTGATGCCCTATC51
ReverseGCTCTGAACCCCACTTGGTGT
Hes5 D32132ForwardATTTCAGCAAGTGACTTCTGCG51
ReverseATAGAACCCCCGGTGGTGAC
Myosin Vlla U81453ForwardCTGCCACGAGGTCCAGACTC51
ReverseGCAAACCCAGATGCCATAGGT
COUP-TFI U07625ForwardCAGCCCAGCCGCTTTG51
ReverseTGTGCGAAGAGAGGGCAATC
COUP-TFII NM_009697ForwardAGAAGGAACTGTGGAATTTATTGGC51
ReverseTTGTGTCTTGGACACATTCCTTG
Gapdh M32599ForwardAACGACCCCTTCATTGAC191
ReverseTCCACGACATACTCAGCAC