Table 1.

Sequence of primers used in RT-PCR analyses and genotyping

GeneSense primerAntisense primer
hDBH-Gata3AGT GAC CAG CTA CAG TCG GAGGA GAG GGG TCG TTT AAT GG
Gata3GGT GGA CGT ACT TTT TAA CAT CGACCC TGA CGG AGT TTC CGT AG
ThAGT TCT CCC AGG ACA TTG GAC TTACA CAG CCC AAA CTC CAC AGT
DbhGAC CCA CCT TGT GAG AAG CTA TTCGGA GGG CTA CAC AGA GCT GG
Hand2CGA GTG CAT CCC CAA CGTCCA GGC GCA GTG TCT TGA T
Phox2bCGC CAT TAG CGC AAC TGACGG CTG CGA AGA TTA GGG
Mash 1AACCGGGTCAAGTTGGTCAACGTCTCCACCTTGCTCATCTTC
Sf1GTA CGG CAA GGA AGA CAG CATCCA CCA GGC ACA ATA GCA ACT
GapdhCCT GCA CCA CCA ACT GCT TATCA TGA GCC CTT CCA CAA TG