Table 1.

Details of primers used for RT-PCR analysis

GenePrimersPCR conditionsPolymorphismGel conditionsCross
Osbpl5 F: CCACCATCCCAGATCAAGAC58°CNcol10% polyacrylamideB6/Cast
R: TTCTCCTGTGTGGCTTTGTG
Phlda2 F: CGTGATGTCTTCGAAAACCG57°CDeletion0.6×TBE, 0.5×MDE SSCPB6/Cast
R: TGACGATGGTGAAGTACACG
Cdkn1c (C) F: GCCAAGCGCAAGAGAACT57°CTaql1% agaroseB6/Cast
R: CAACAACCATTCCCCTAGAGTC
Cdkn1c (S) F: TTCAGATCTGACCTCAGACCC58°CAval10% polyacrylamideB6/SD7
R: GACCGGCTCAGTTCCCAGCTCAT
Kcnq1ot1(C) F: CTGAATTGGGGGAATAGCA57°CStul1% agaroseB6/Cast
R: CCATTTCTGCACCTGTTTT
Kcnq1ot1(S) F: TTGCCTGAGGATGGCTGTG57°CMwol1% agaroseB6/SD7
R: CTTTCCGCTGTAACCTTTCTG
Tssc4 F: AGAAGCTGCCCATCCTGAGT59°CAlul10% polyacrylamideB6/Cast B6/SD7
R: GACCCACAATTCCCACAGTC
Cd81(C) F: GCGTCCTTGCTTCAAAGAGA58°CFaul1% agaroseB6/Cast
R: AGGCAAACAGGATCACAAGG
Cd81(S) F: GGGGACATGGCCTGTGTAT58°CDeletion10% polyacrylamideB6/SD7
R: GCTCCCAAAAGGTAACAGGA
Ascl2 F: TGAGCATCCCACCCCCCTA55°CSfcl1% agaroseB6/Cast
R: CCAAACATCAGCGTCAGTATAG