Table 3.

RT-PCR oligonucleotide sequences

GeneForward (5′-3′)Reverse (5′-3′)
Scd1 CACTGAATGCGAGGGTTGGTCCAAAGCCACATTACCTTGCA
Dpp4 GGTGGATGCTGGTGTGGATTGGCTCATGTGGGAATAGATGTG
RBP-L GGCGTGCTTCCTGTTTTTGTTCTGGAGAGCAAATCCCCAAT
CC10 TCCTAACAAGTCCTCTGTGTAAGCAAGGAGACACAGGGCAGTGACA
SP-B ACGTCCTCTGGAAGCCTTCATGTCTTCTTGGAGCCACAACAG
SP-C ACCCTGTGTGGAGAGCTACCATTTGCGGAGGGTCTTTCCT
napsinABI catalog # Mm00492829ABI catalog # Mm00492829
β-actin CAGAAGGAGATTACTGCTCTGGACCACCGATCCACACA
Gata6 TGTATTGCTCCAAATCATGTGCTTCTCTCCACGAACGCTTGTGA
Nkx2.1 TCCAGCCTATCCCATCTGAACTCAAGCGCATCTCACGTCTCA
Bmp4 CGAGCCAACACTGTGAGGAGTATACGGTGGAAGCCCTGTTC
Wnt7b GCATCCAAGGTCAACGCAATCTCAGAGTCTCATGGTCCCTTTG