Table 2.

ChIP PCR oligonucleotide sequences

RegionForward (5′-3′)Reverse (5′-3′)
Dpp4 - region ACAATCCCTCAAGACTTGCCATACGAAGGCACCAGCAAGGAAAG
Dpp4 - region BCCCCATGCCACCAGATACTAACAACTCGGAATGAACCAAAACA
Dpp4 - region CTGGGCTACATGCTGAGAAGAAATTCCAGGAGCACCAGATGAAT
Dpp4 - region DCTTCAGTGCCTTCCTGGTGAGTCACCAGTGCTGCACTGGAGTA
Dpp4 - region ECTTTCTTTGCCAGCCAGATAACATGCAGAAACTAGCTGCCAGTTC
Scd1 - region ATGTTCTAGTCAAGAGGCATCTCATGTCTGTTTACCCGTCTAACAGGAAAA
Scd1 - region BGTGGCCTAAAAAGGTGGGAATGCCAATCAGAAAGCAAGCCTAGT
Scd1 - region CTTGGGAAGAAAGAGGAAAATAATCCATGTAACTGTGGTGCGTTTCCA