Table 1.

Primers and conditions for reverse transcriptase PCR

GeneForward primerReverse primerProduct (bp)Annealing temp. °CCycles
Oct4 GGCGTTCTCTTTGGAAAGGTGTTCCTCGAACCACATCCTTCTCT3135525
Nanog ATGAAGTGCAAGCGGTGGCAGAAACCTGATGGAGTCACAGAGTAGTTC4406526
Fgf5 ACCCTTTGAGCTTTCTACCCCCGTCTGTGGTTTCTGTTGAGG1885835
Rex1 AGGCCAGTCCAGAATACCAGGGAACTCGCTTCCAGAACCT2335830
brachyuryGTGACTGCCTACCAGAATGAATTGTCCGCATAGGTTGGAG3365733
Id1 TCCGCCTGTTCTCAGGATCAGTAGCAGCCGTTCATGTCGT2175530
Id3 CGACATGAACCACTGCTACTCTCCTCTTGTCCTTGGAGAT2215530
β-actin (Actb)GGCCCAGAGCAAGAGAGGTATCCACGCACGATTTCCCTCTCAGC4605525
  • Primer sequences are shown 5′ to 3′.