Table 1.

Primers used for qRT-PCR and quantitative ChIP studies

Primer pair5′ Sequence3′ Sequence
Gapdh TGGCAAAGTGGAGATTGTTGCCAAGATGGTGATGGGCTTCCCG
Flk1 CTGAATGGCACCATGTTTTCCTGTTTGACCAGGCAATGTC
Rex1 AAGTGAGATTAGCCCCGAGAAAAGGTTTTGCTCCACTTCC
Scl CAGCCTGATGCTAAGGCAAGAGCCAACCTACCATGCACAC
Gata1 ATGGAATCCAGACGAGGAACCTCCCCACAATTCCCACTAC
Gata2 GCAGAGAAGCAAGGCTCGCCAGTTGACACACTCCCGGC
Hand2 TACATCGCCTACCTCATGGAGTTGCTCACTGTGCTTT
Nkx2.5 AGCCTACGGTGACCCTGAATCCGTCTCGGCTTTGTC
Hnf3β ACATACCGACGCAGCTACACCCGGTAGAAAGGGAAGAGGT
Hnf4 AACCACGCTACTTGCCTTTGATGTTTGCACAACCACAGGA
NeuroD GCTCCAGGGTTATGAGATCGTCCTGAGAACTGAGACACTCATC
Fgf5 GGCAGCCTGTACTGCAGAGTCCTACAATCCCCTGAGACAC
Gata4 CGAGGGTGAGCCTGTATGTAACCTGCTGGCGTCTTAGATT
Ttr TTTCACAGCCAACGACTCTGTCTCTCAATTCTGGGGGTTG
Bmp4 GGAGGAGGAAGAGCAGAGCTGAAGAGGAAACGAAAAGCA
Vegf CATAGAGAGAATGAGCTTCCTACAGCTGCTTTCTCCGCTCTGAACAAGG
Pdgfrα AGAAACGATCGTGGTGACCTTTTGATGGATGGGAGTTTGA
Kit ACAGGCCCTCGGCTAACAAAAAGCACTGGCATCAGAGTTG
Rb TGACCTGGTAATCTCATTTCAGCGGGTGTTCGAGGTGAACCAT
Ccnd2 TGTGGATTGTCTCAAAGCCTGCAACATCCCGCACGTCTGTA
Cdk4 CCAATGTTGTACGGCTGATGGTGTCCAGGTATGTCCTCAGGT
p16 CCGCCTTTTTCTTCTTAGCTTTCCCTCCCTCCTTCTGCT
P18 CGAGCAGCACTCTGGACTACAGGCTCGGCCATTCTTTAG
P21 GTGGCCTTGTCGCTGTCTTGCGCTTGGAGTGATAGAAATCTG
P27 TCTCTTCGGCCCGGTCAATGGGGCTTATGATTCTGAAAGTCG
Scl promoterAAAATGAATCATTTGGCCCATAACGAGATAAGGAGCCGCCTC
Scl +19 enhancerCTCCACACAATAACAGGATGTGATCCAGATAGAAGCTTGAGGTAGGGCT
Bmp4 -1034 siteCTCTTAGCCTGGCTCACCTTCTAGCTGGGAGGTGGAATGT
Bmp4 -392 siteCAATCCAACAGCTCCCTTCTATAACTGCTGCCCAAACTGA
Bmp4 TGE siteTTGAAGAAGCCACGCTGAAGAAGCCACGCTGAGATCAT