Table 1.

PCR primers used in this study

PrimerOrientationSequence (5′-3′)
PLE-1ReverseCGGGCTCGTACTTGGTCATC
PLE-FForwardTCCCTCCGAGCAAGATGTGG
PLE-RReverseACCACGGAGCCTTGACATTC
DDC-1ReverseAATCGCTCCACTCAGCATGT
DDC-FForwardGCCAAGCGCACAGCAATCAG
DDC-RReverseATGACTCGCTCGATGTCCTG
RPL32-1ReverseCTTCTTGAGACGCAGGCGA
RPL32-FForwardAGCATACAGGCCCAAGATCG
RPL32-RReverseAGTAAACGCGGGTTCTGCAT