Table 1.

Probes and real-time PCR primers used in this study

Probe sizePrimersGenBank accession no.Gene
500 bpForward, CTCCGCAAGCTCTCGGTGTC
Reverse, CTGCACTAATGTACAGTCAAGCNM_178291 isotocin (it)
550 bpForward, GCAAAGAGAACTTACCCGACG
Reverse, CAACATTCTTTCCGATGACACNM_183070 somatostatin1 (ss1)
450 bpForward, AATGCGCCTCTGTCGACATTG
Reverse, ACTGCTCACATCCTGTGGTACCGAF025305hypocretin (hcrt; also known as orexin)
1325 bpForward, GGGAGCTGCCCTGGATCCACT
Reverse, TCAAACCACCAGCCAGTGATGGAGAF318177 dat
722 bpForward, CACTACAAACCTCAAGTATTC
Reverse, CCCACTTAACAATCATTGNM_131100 otpb
307 bpForward, GACGTGCCGTTTCACCTC
Reverse, CGAGTGCACCTTGTTTCTXP_683186 otpa
1260 bpForward, ATGGCTTCCACAGTGAGAAAATGTC
Reverse, CTGAAAAGACCCAAGACCGAGCTCCR853299 pac1
400 bpForward, GAAGTCCTCCATCTCTTACGG
Reverse, ATCTTTAGGACTGAATGTACACNM_214715pacap1b (also known as adcyap1b)
65 bpForward, AATCGCGAGTGCAGGTCTG
Reverse, GGTGGTCTTCTTGCGCTTCTTXM_215445Otp (rat)
70 bpForward, TGACCGAGCGTGGCTACA
Reverse, CAGCTTCTCTTTAATGTCACGCANM_031144Actb (rat)