Table 1.

Primers for RT-PCR

GeneOrientationSequence (5′ to 3′)
Mouse
GAPDH STGTCAGCAATGCATCCTGCA
GAPDH ASTGTATGCAGGGATGATGTTC
ΔNp63SGTTGTACCTGGAAAACAATGCTCAG
TAp63 SGTGGATGAACCTTCCGAAAA
p63αASTGATACGCTGCTGCTTGTTGCG
p63βASCTTGCCAAATCCTGACAATGCTGC
p63γ AS CTCCACAAGCTCATTCCTGAAGC
Human
GAPDH STCACCAGGGCTGCTTTTAAC
GAPDH ASTGGAAGATGGTGATGGGATT
DLX1 STCCAGCCCCTACATCAGTTCG
DLX1 ASCTGGAACCTCCGGTTCAAAGC
DLX2 SGCACATGGGTTCCTACCAGT
DLX2 ASACTTTCTTTGGCTTCCCGTT
DLX5 SCTACAACCGCGTCCCAAG
DLX5 ASCACCTGTGTTTGTGTCAATCC
DLX6 SCCTCGGACCATTTATTCCAG
DLX6 ASTTGTTCTGAAACCATATCTTCACC
  • AS, antisense; S, sense.