Table 1.

Primers for cDNA synthesis, RT-PCR and in situs

NamePrimerSequence (5′ to 3′)
cDNA synthesis and RT-PCR
OsFAMAOsFAMA-FCACCCACCCCCTGAGTTGGAC
OsFAMA-RGTAGTTGACGTCGATGAAGCTAAG
OsMUTEOsMUTE-FATGTCGCACATCGCCGTGGAG
OsMUTE-RGGAATGGAGGTGATTATCGGG
AtMUTEAt-MUTE-FGAACTCCAGAAGAGAATGTTG
At-MUTE-RGATACAGCGTCTAGTACATGTAG
OsSPCH1-SP1OsSPCH1-1-FAATCATCAATTCATCATCCATGTC
OsSPCH1-SP2OsSPCH1-1-RAGGTTCTCGTTCATCTGCTTCCT
OsSPCH2OsSP2-1-FGGTTAGCTTAGCTTAGGTTGTTTGC
OsSP2-1-RACTTGCTGAAGCTCCTTGATGTAAT
OsSP2-2-FAGATCAGGCGTCAATCATAGGAG
OsSP2-2-RAGAAAGTTTGCTGAATTTCTTGCAC
ZmMUTEZmMUTE-FATTATGTCCCACATCGCGGTGGAGC
ZmMUTE-R TGATTCTCCTCCTGCGGCTTCTGCT
In situ hybrizations
OsFAMAOsF-IST4E-FGTGCAGCAGAGAAGCCACCTGGAGAGA
OsF-IST4E-RCTTGACGTTGAAGGAGTAGAGGA
OsMUTEOsMUTE-FATGTCGCACATCGCCGTGGAG
OsMUTE-RGGAATGGAGGTGATTATCGGG
OsSPCH1OsS1-IST3E-FCGGAGACCAGGCATCCATC
OsS1-IST3E-RCTTGACAGTGAAGGAGTTGACG
OsSPCH2OsS2-IST1E-FATGGCGGACGGCGGCG
OsS2-IST1E-RGTAGAAGCATGGCATGAGCGAGCG
OsSCR1OsSCR-FTCCTGCTAACCTCTCCCTCTT
OsSCR-R AAAAAGTAAAACCATGTATCCAGTAGA
Genotyping primers
osfama-1osfama1-FATGATGGATGCTTGGTCTCC
osfama1-RGAATTCATCGTCCTCCATCG
osspch2-1osspch2-1FTGCCATGCTTCTACGTCAAG
osspch2-1RCCTGCACCCACAATTAATAATAC