Table 1.

Primer sequences

NameSequence (59 to 39)
Expression analysis
Ubq-FAACCAGCTGAGGCCCAAGA
Ubq-RACGATTGATTTAACCAGTCCATGA
OsMADS50-FCAGGCCAGGAATAAGCTGGAT
OsMADS50-RTTAGGATGGTTTGGTGTCATTGC
Ehd1-FTGCAAATGGCGCTTTTGAT
Ehd1-RATATGTGCTGCCAAATGTTGCT
RFT1-FTGACCTAGATTCAAAGTCTAATCCTT
RFT1-RTGCCGGCCATGTCAAATTAATAAC
Hd3a-FGCTCACTATCATCATCCAGCATG
Hd3a-RCCTTGCTCAGCTATTTAATTGCATAA
OsMADS14-FCGGTTGCGAGACGAGGAA
OsMADS14-RGAAAGACGGTGCTGGACGAA
OsMADS15-FCGTCGTCGGCCAAACAG
OsMADS15-RTGACTTCAATTCATTCAAGGTTGCT
Hd1-FTCAGCAACAGCATATCTTTCTCATCA
Hd1-RTCTGGAATTTGGCATATCTATCACC
Ghd7-FATGGGGATGGCCAATGAGGAGTC
Ghd7-RGAGGAATCCGGCCGCCTTTTTTC
RID1/Ehd2/OsID1-FCGACGACAATAGCTCGATCGC
RID1/Ehd2/OsID1-R GTGCATGGTCACGGAGCCTT
RNAi constructs
Hd3a-FTACTTCAACTGCCAGCGCGAGGCAG
Hd3a-RTGCTGGATGATGATAGTGAGCATGC
RFT1-FTACTTCAACTGCCAGCGCGAGG
RFT1-R AGCTATAGCTGCTGCATGCATGGA
pRFT1::RFT1:GFP
RFT1 promoter-FAAGCTTTGATATTCTCGCACCCAGTCTTGCT
RFT1 promoter-RCCCGGGGATGCACTAGTTGTGCAAGCTTCTC
RFT1 5′-FACTAGTCCTGTCACTGTTTGGCTAGCTTA
RFT1 5′-RGCGGCAGGAGGGTCTACCCCTCTAGA
GFP-FTCTAGATCTAGAGTGAGCAAGGGCGA
RFT1 3′-R ACTAGTTATACAGCTAGGCAGGTCTCAG
Screening pRFT1::RFT1:GFP transgenic plants
GFP2-FTACGGCGTGCAGTGCTTC
GFP2-R CGGGCATGGCGGACT
Screening RNAi plants
Hd3a-FGTCTACTTCAACTGCCAGCGCGAG
Hd3a-RGAACCTGCAATGTATAGCATGCTGG
RFT1-FGTCTACTTCAACTGCCAGCGCGAG
RFT1-RCTTAGCTATAGCTGCTGCATGCATG