Table 1.

Primers used in this study

GeneAccession number X. laevisForward primerReverse primer
SRFP2 AF136184AACAAGGTCTGCTCCTTCCAATGGTGTCTCCACCTCCTTG
cyclin D1 BC041525.1CCAGACATTTGTTGCCCTCTGTTGTGTTGCTGCTGTGCTT
SOX2 AF005476GTCAAGTCGGAATCCAGCTCTTCTGCCCCAGGTAGGTACA
UnknownnTTTCGTGGTGATCGGTAACATGCTCGGAGGAGACAAGTTT
SP5 AY062264GTGTCCCAACTGCCAAACTTAGCTTTTGCCACAGAACAGC
Cerberus BC081277GAATGGAGCCCCACAGAATATTGCTGATTTGGAACATGGA
GATA4 DQ096869GCTTAAAACTCTCGCCACAGATGCTTTAAGCTAAGACCAGGTTG
TFAP2A M59455AGAGCTGCCTGACCCACTTTTGTCCATTGCTTTGAGTGC
Cadherin 1 L29057CCTGCCAATCCAGATGAAATGAGCCACTGCCTTCGTAATC
cyclin B1 AJ304991TTGTCCATCAATTGGTGACTTTGTGCACCATGTCATAGTCTGTC
Xiro1 AJ001834AAACCTGAGTTCCCTCAGCATGTTTTCACGAACAGCTTGG
BTG4 BC088789AAGCAGCTGAGCAAGCAGACGGAATGCTTGTCCTTTTGT
ROR2 AB087137AACTGATGGGAAACTCCATGCACCCCATAGGACCAAATATCTGAA
PDGFRA M80798GAATGGCAAAACCTGACCATGCGAGTAACTGCAGGGTGAT
FBXO43 AF176353AATCCATCCATTCAGCAAGCTCTGCTGCAAGTCCCTCTTT
H2BFS XLHISH3AGATACCGGCATCTCTTCCAAATGGTGGAGCGCTTGTTGTA
RPN2 BC046727.1ATCCGCTCCAATGTTGACTCGTGAGCAAGGCTTCAATGGT
KRT24 BC043901.1AGTTCTGCAGGTGGTTTTGGGCAAGACGGTCATTGAGGTT
UnknownBC097911.1GCCCCAGAACCACTAAGTAACCCTGGACCACCATCTCTGAA
YWHAH BC075238AGGCCTTTGAAATCAGCAAACTTGTCCACAGGGTCAGGTT
WDR20 BC070814CATGAATGCCACAAGTCCACGCAAACTTGCTGACACCAGA
CEPB1 BC077702AAAATGTCCAGTCGCAGGATAGAGCCCCCACAAATACAGT
VLDLR AB006906CTTGCCAACCAGACCAATTTCATCACTCCAGTCCTTGCAG
FOXI1 BC042303AGTCCTCAGCGACCTTCAAAGATATGGAGGAGGTGTGATGGAA
CSNK1E AF183394TGCACATCGAGAGCAAATTCACCAAGCCCCATTAGGAAGT
RBP1 BC068742GATGATCGCAAATGCATGACAAACCTGTTTACAGACAACATCTCC
LOC494796 BC082922TATGAAGCCGTGCATCAGACCTCAAGAAGACATCAAGGCAATC
PGK2 BC077781TTCCATGTGGAGGAAGAAGGGCTCTGTGTGCAGTTCCAAA
C15ORF20 BC097805GCTGTGCGTGGTAAAGATGATCTGTACATCTGCCAAGTCG
SYTL2 BC082628TCTCAAAATGATTGATCTCAGCTTCACGTTCCTCCTCTGCTTTC
ECT2 AY487422GCATCAAGGGCCATAAAGAACTTCGGCCATCTGCATTTT
MCM10 BC070548CCCAAAACAAGGTGCAGAATTGCGTTTAATGCTGTTTGGA
KCTD14 BC068871CAGCGAGAACATTGAGGTGATCATGGCACTTGCCTACATC
PI4K2B BC077943CAAGGCAGTGTGGCTTGTAAGCTTTCTGGTATTTTCAGGTAAGG
FBXO33 BC099041CCAGTTGCCAACACCATAGACTTGCCATTTCTGCTGTGAA
VRK1 BC054213GTTCATGGAAGCAGTTAAAGAACTAGGACTGCCACTGGCTTTT
TNRC17 BC070738AGCTGGAGTTCCCTGCCTTAAGACTGGCTCCACAACTGGT
BTG1 BC090221GTCCTACAGGAGGCCATGAATCAAAAGGGTCAACCCAAAG
RBM5 BC077408CGCCTTCGTGGAGTTTTATCCGAAAGTTGTACAGGCCACA
cyclin D1 BC106631AAATAGTGGCCACCTGGATGTCAGTGGGATCGTTTCCTTC
UnknownX92851TGGTTCAACAGGGATTCTCTATGTGGGGCACAAGGTATGT
DHRS3 BC073416AACCATTTTGGTGAACAATGCCAATGTGGCCATTCTGAAGTT
Claudin 4 BC099009TTCATTGGCAACAACATCGTGAAGGGCCAGCAGAGAGTC
ATP2A2 BC098958AGATGTCAGTCTGCAGGATGTTGACCATCATATTGGTGGCATT
TRIM29 BC044714TCCTTCTGTGAAACCCATCTTGTTTTGCTGTGGAGCTGAC
ELAVL3 U17598ATTGAGTCCTGCAAGCTGGTGGGTGTTTATTGCTTTATCTGC
SLC2A2 BC070704GTCTGGCATCAGGACTGGTTTCCCTGTGACAATAGCCAACT
UnknownAJ009297CACAACATCTTGGCAGTTGGGGGGAATAGAGTTCGGCTTC
POLE3 AY271302CTTGGAAGTTTACAGGCAGGACTTGTCCTGATCCTCAGAGTCG
HUNK AY318878ATGAGACGTCAAGATTCCCACACTCTGTACTGGTGATTTGGG
DLX6 D10259ATCCGGTTTAATGGGAAAGGAGTGCCAGGTACTGGGTTTG
Epiplakin 1 BC082957ATCAGGAAAGGCAGGTGATGGCACTGCAATGACCTCTTCA
SLC2A2 BC070704GTCTGGCATCAGGACTGGTTTCCCTGTGACAATAGCCAACT
LMO3 BC106431GCCGCTTGCAGTAAACTGATCTTCAGGAAAAACTTGTCCCC
MX11 DQ104100GCCTCCACATCCTAATCCAAGCGGCCCGATACAATAACTA
NGFR BC068640AATGCAAAGAAACCGAGGTGTTTGGCCAACTGCTTCTTCt
UnknownBC108804CCATTCGCCTTTGTGGAATTTGGAAACTCAACACGCAAG
ALCAM BC074313ATGGAAGCAAGTGCAAGGACCGTTTCTCCATAAACTGCATTG
EFS BC084637ATGTGATGCTAGTTCTGGAGCGCCTGATACTCGCTTTCCTG
GATA3 BC110754CACCACCCGGCTCTATTAAAATTGAAGAGTACATCCATGTC
LRRN1 AB014462AGAACCCTATTCGCAAGATCCCGATCTACAGACACCAACTCTGC
PTAFR BC046657AGCCAGTGAAGTCGAGGAAAGAGTCCAAGGGCCATCTACA
HTRA1 BC087471GGGGATACGGATGATGTCACCTTCAAGCCAGCCTCTTCAG
IER5L BC081197CGGATATTTGCACCAGGACTGAGCCGAAGATGGAGATCAG
PDCD4 BC056125GGGCAGGTCTATGGAGATCAATTCTTGCACCATTGGCTTC
OSR2 BC108579AGCTCACCAACTACTCCTTCCTGGCATCCATTAAGCCTTG
SALL1 BC059284CCAGCATAGGAACAACAGCAAGATGGATCTGCAAGGCACT
UnknownBC110732ATCAGCTACAGCCTGTCTCCAGAGCACAAAAGGTGGCACTA
ZFHX1B BC084972TGGACCACTCCAGGAGCATAAGTCCAAGGGCTCAGCTT
UnknownAJ009297GCTGAGAGGAGGCAGCTAGAGGGGAATAGAGTTCGGCTTC
RBM12 BC059291TCTGAAGCGTAACCGAATGTTAGTTGCTGCATCAAAGGAG
STAG2 AF255018GAGAATTTGCCATGCTTACCACCCAAGACAATATGTCGTAGCTT
HNRPU BC046700AGAGCTTTGCACTTCTCTGGGCAACACCATTGCAACATTT
UnknownBC045031TGGAAGCCTGGTACAGAGGAGTTTCTGCCAAAGTGCCTTC
IGSF4 BC108832GCTGGTTCAAGGGAAACAAACAGCTGGATGGTCAACAAGA
DYNLL1 BC073042GGAAGGAATTTTGGCAGCTAGAAGGTTTGTTCCCTTGGTT
NUDT22 BC068937TACCTGCAAGGAGGTCCTGAGGCTGATGGACACAGTTCCT
GATA6 BC082349CCTTTCTGACTTTTGCACAGCGGCAAAGTCTGTTGGATGGT
MEIS1 BC084920CGATTCCACCTGTTGGAGTTAACCCGGTGTACCTGAGTGAG
SALL1 AF310007GAACAGCACACCTGCAAGAACCAGCCATTGGAGTAATGC
CYP26A1 BC073518GGAGAGACTCTGCAAATGGTGGTGCAGGTTGGACAGACAGC
MGC61598 BC084778GACCAACTGCGAGTTTAACGGCCCCAAACTTTACCAACAG
ZFP36L1 BC100162AGCTTGTTTGCTCCAAGCATCTGGAACTGCTCAGGTAGCC
ZNF503 BC046863ACTGTTCTCCCCCTGGATCTTTTTCTTGGCATCCAGCTCT
KIAA1324L BC077391CCAAGGGGACAAAATACTACCACCTTTGCTGTCTGATGGGATA
P4HB BC077772TGCCAAGATGGATTCTACAGCCATCTCCCTCCTCCAAATCA
  • Sequences are shown 5′ to 3′.