Table 1.

Primers used in this study

PrimerSequence (5′ to 3′)
NAMF′TGCACTTGTTGGGATGAAGA
NAMR′TTCTGAGTCTCCGGCACTG
gob-3 FGCCAACTCCAAGTTTCGCTTC
gob-3 R′GATTAGAAAATCCGCCGTGCAT
GOBstartCTCGAGATGGAGATTTTCATCAGATGC
GOBstopGGATCCTCAGTAGCTCCACATACAGTTCAAG
GOBmR′AGTAGCAGTTGTACTAAAGCACGGTACATGTTCCTTCTTG
GOBmF′AGGAACATGTACCGTGCTTTAGTACAACTGCTACTGCTAC
GOB RT F′CAGGAGTTCGAAGGACGAGTGG
GOB RT R′TTGGCTGTAGTGTATGCAAGGTG
TUBF′CACATTGGTCAGGCCGGTAT
TUBR′ATCTGGCCATCAGGCTGAAT
GOB RACE R′ACGGTCCAATTAACCATCGGATTAGA
GOB RACE R′ NESTEDGATTCTCATGGAGTGATCTTAACGTT
ADAPTOR F′GCACGAGGACACTGACATGGACTGA
ADAPTOR F′ NESTEDGGACACTGACATGGACTGAAGGAGT
ADAPTOR-RNA oligoCGACUGGAGCACGAGGACACUG
miR 164 probeTGCACGTGCCCTGCTTCTCCA
E F′-1GAGGAGGAGGGCCAGAGTAAT
E F′-2GTGGCAACAAACGAGGATTTT
E R′AATATGGATCTCATGGAGCTCCT