Table 1.

Primers (5′ to 3′) for real-time PCR

Human geneForwardReverse
GAPDH TCGACAGTCAGCCGCATCTTCTTTACCAAATCCGTTGACTCCGACCTT
GLI1 GGCTGCAGTAAAGCCTTCAGCAATTGCAGCCAGGGAGCTTACATACAT
GLI2 AGGACAAGGCCAACATCGTCATCTTCCCTGGCTTTCATTTGCAGTTGG
GLI3 TTGCACAAAGGCCTACTCGAGACTCTTGTTGCAACCTTCGTGCTCACA
NKX2.2 GACAACTGGTGGCAGATTTCGCTTAGCCACAAAGAAAGGAGTTGGACC
OLIG2 GGTAAGTGCGCAATGCTAAGCTGTTACAAAGCCCAGTTTGCAACGCAG
SHH AAGATCTCCAGAAACTCCGAGCGACGAGATGGCCAAAGCGTTCAACTT